ID: 1179871361

View in Genome Browser
Species Human (GRCh38)
Location 21:44244508-44244530
Sequence CGGGATTAAATTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179871361_1179871370 20 Left 1179871361 21:44244508-44244530 CCTTCCACCTCAATTTAATCCCG No data
Right 1179871370 21:44244551-44244573 CCACATGAGGTAACATTCACAGG No data
1179871361_1179871372 27 Left 1179871361 21:44244508-44244530 CCTTCCACCTCAATTTAATCCCG No data
Right 1179871372 21:44244558-44244580 AGGTAACATTCACAGGATCCGGG No data
1179871361_1179871366 7 Left 1179871361 21:44244508-44244530 CCTTCCACCTCAATTTAATCCCG No data
Right 1179871366 21:44244538-44244560 AGTCCTTCCTTTGCCACATGAGG No data
1179871361_1179871371 26 Left 1179871361 21:44244508-44244530 CCTTCCACCTCAATTTAATCCCG No data
Right 1179871371 21:44244557-44244579 GAGGTAACATTCACAGGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179871361 Original CRISPR CGGGATTAAATTGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr