ID: 1179872788

View in Genome Browser
Species Human (GRCh38)
Location 21:44251661-44251683
Sequence GCGCCGTACACAAGATCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 6}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179872785_1179872788 -8 Left 1179872785 21:44251646-44251668 CCCAGGGGAGGTGTGGCGCCGTA 0: 2
1: 0
2: 0
3: 1
4: 25
Right 1179872788 21:44251661-44251683 GCGCCGTACACAAGATCGAAGGG 0: 2
1: 0
2: 0
3: 0
4: 6
1179872786_1179872788 -9 Left 1179872786 21:44251647-44251669 CCAGGGGAGGTGTGGCGCCGTAC 0: 2
1: 0
2: 0
3: 5
4: 47
Right 1179872788 21:44251661-44251683 GCGCCGTACACAAGATCGAAGGG 0: 2
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179872788 Original CRISPR GCGCCGTACACAAGATCGAA GGG Exonic
1164886633 19:31783894-31783916 GCATCGTAAACAAGATGGAAGGG - Intergenic
1176284393 21:5011814-5011836 GCGCCGTACACAAGATCGAAGGG - Intergenic
1179872788 21:44251661-44251683 GCGCCGTACACAAGATCGAAGGG + Exonic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
952342011 3:32454900-32454922 GGGCCAGACACAAGCTCGAATGG - Exonic
976390975 4:84503137-84503159 GCGCCGAACGCAAGATCCTACGG - Intergenic
1186070984 X:5820419-5820441 GTGCAGTACACAATATTGAAGGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic