ID: 1179874508

View in Genome Browser
Species Human (GRCh38)
Location 21:44261382-44261404
Sequence GGGTGTCACCGCGGGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179874508_1179874517 0 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874517 21:44261405-44261427 ACCTGCCCAACCCAGGGATGAGG 0: 1
1: 0
2: 5
3: 39
4: 299
1179874508_1179874520 2 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874520 21:44261407-44261429 CTGCCCAACCCAGGGATGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 210
1179874508_1179874519 1 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874519 21:44261406-44261428 CCTGCCCAACCCAGGGATGAGGG 0: 1
1: 0
2: 2
3: 31
4: 273
1179874508_1179874526 16 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874526 21:44261421-44261443 GATGAGGGGCAGGACAGCCAAGG 0: 1
1: 0
2: 3
3: 32
4: 372
1179874508_1179874523 6 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874523 21:44261411-44261433 CCAACCCAGGGATGAGGGGCAGG 0: 1
1: 0
2: 0
3: 30
4: 336
1179874508_1179874513 -7 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874513 21:44261398-44261420 GACACCCACCTGCCCAACCCAGG 0: 1
1: 0
2: 4
3: 19
4: 289
1179874508_1179874514 -6 Left 1179874508 21:44261382-44261404 CCTGAACCCCCGCGGTGACACCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1179874514 21:44261399-44261421 ACACCCACCTGCCCAACCCAGGG 0: 1
1: 0
2: 4
3: 39
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179874508 Original CRISPR GGGTGTCACCGCGGGGGTTC AGG (reversed) Intronic
901006468 1:6174038-6174060 GGGAGTCACCCTGGGGGTGCAGG + Intronic
901871850 1:12142955-12142977 GGGTGTCACCTCTGAGGTCCAGG - Exonic
903652250 1:24929466-24929488 GGGTGTCGCCGCGGCGTCTCGGG + Intronic
904011612 1:27393250-27393272 AGGTGTTACCGCGGGAGTGCGGG + Intronic
908938976 1:69409728-69409750 GGGTGTCACAGCCCTGGTTCAGG - Intergenic
919061684 1:192641990-192642012 GGGTGTGACTGCAGGAGTTCAGG - Intronic
920949003 1:210555275-210555297 TGGTGTCACAGCGAGGGGTCAGG - Intronic
921308284 1:213818687-213818709 GGGTGTGACCGTGGAGGTGCAGG + Intergenic
924825137 1:247531070-247531092 GGGAGCCACAGCGAGGGTTCCGG + Exonic
1062838448 10:651234-651256 TGGCGTCACAGCGTGGGTTCCGG + Exonic
1063974693 10:11405887-11405909 GGGTGTCTCACAGGGGGTTCAGG - Intergenic
1067428955 10:46229517-46229539 GGGTGTCACTGTAGGGGTTATGG - Intergenic
1070551788 10:77495875-77495897 GGGAGGAACCGCGGGGGTACTGG - Intronic
1074495609 10:113977795-113977817 GGGTGCCACGGCAGAGGTTCAGG + Intergenic
1077011276 11:380432-380454 GGGCCTCACCGTGGGGGTCCCGG - Exonic
1077173866 11:1180104-1180126 GGCAGTCTCCACGGGGGTTCCGG - Intronic
1080334007 11:31175096-31175118 GGGTGTCACAGCCTTGGTTCAGG - Intronic
1083805060 11:65068380-65068402 GGGTGTGACGACGGGGGTTCAGG + Intronic
1090678411 11:129027406-129027428 GGGTGTCACCATAGGGGTTTTGG - Intronic
1091581575 12:1793650-1793672 TGGTGTCACCGCAGGAGTTGGGG + Exonic
1091720891 12:2812693-2812715 GGCTGTCGCGACGGGGGTTCAGG + Exonic
1092695940 12:11171397-11171419 GGGTGTCGCGGCGGGGCTTGAGG - Intronic
1096503659 12:52080201-52080223 GAGTGTGGGCGCGGGGGTTCGGG + Intergenic
1096839059 12:54369977-54369999 GGGTGTCTCCAAGGGGGCTCGGG + Exonic
1098275667 12:68808741-68808763 GGAGGTCTCCGCGGGAGTTCAGG + Intronic
1099557659 12:84129300-84129322 GGGTGTCACAGCCCTGGTTCAGG - Intergenic
1108844239 13:54659073-54659095 GGGTGTCACCGCCCTGGCTCGGG + Intergenic
1118317825 14:64736622-64736644 GGTAGTCACAGCGGGGGTCCTGG + Intronic
1122352397 14:101103642-101103664 GGGTTGCACCGCGGGGGCTCTGG + Intergenic
1127735522 15:61835361-61835383 GGGTCTGACAGCTGGGGTTCAGG + Intergenic
1132368564 15:101276996-101277018 GGGTGACAGCGCGGGGAGTCAGG + Intronic
1135115457 16:19719391-19719413 GGGTTTCACCGCGCTGTTTCAGG - Intronic
1136670335 16:31850705-31850727 AGGCGTCACCGTGGGGCTTCGGG + Intergenic
1142245181 16:88967112-88967134 GAGTGGCACCTCGGGGGTTGGGG - Intronic
1144764074 17:17723587-17723609 GGCTCTCACCGCGGGGCCTCGGG - Intronic
1146320741 17:31844550-31844572 GAGTGTTACAGCTGGGGTTCTGG - Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1151833510 17:76569319-76569341 GGGGGGCACAGCGGGGGTTAGGG + Intronic
1152045957 17:77935781-77935803 GGGTGGGGCCGAGGGGGTTCAGG + Intergenic
1152843922 17:82587745-82587767 CGGTGTCGGCGCGGAGGTTCTGG - Intronic
1158931197 18:62325916-62325938 GGGTGTCCCCGAAGGGGCTCAGG - Intronic
1160019201 18:75167337-75167359 GGGTGTCCCGGCTGGGGTCCGGG + Intergenic
1160407922 18:78655443-78655465 GGGTGCCACCGTGGGGGATGGGG + Intergenic
1160427466 18:78788038-78788060 GGATGTCACCTCCGGGGCTCTGG - Intergenic
1160529866 18:79556723-79556745 GGGAGTCTCCTGGGGGGTTCTGG - Intergenic
1160733572 19:651871-651893 GGGCGTGACCTCGGGGGCTCAGG + Intronic
1161108662 19:2456530-2456552 GGGGGTTTCCGCGGGGTTTCGGG - Intronic
1165311360 19:35030888-35030910 GGGGGGCACCGCGGGGGCACTGG + Intronic
1166110169 19:40617210-40617232 GGGCGTCACTGCGTGGGTACGGG + Exonic
1166375489 19:42324830-42324852 GGCGGTCACCACGGGTGTTCCGG - Exonic
932345809 2:70994607-70994629 GGGTCGCATCGCGGGGGTTTCGG - Intronic
939337552 2:140849729-140849751 GGGTTTCACCGTGTTGGTTCAGG + Intronic
948870761 2:240796796-240796818 AGGTGTCACTGGGGGTGTTCTGG - Intronic
1172689343 20:36779528-36779550 GGGTGGCACCGGGGGGTTGCTGG + Exonic
1178953842 21:37006454-37006476 GGGTGTCAAGGAGGGGGGTCCGG - Intronic
1179035810 21:37758012-37758034 GGGTGTCACTGGGTGGGTTGAGG + Intronic
1179874508 21:44261382-44261404 GGGTGTCACCGCGGGGGTTCAGG - Intronic
1180045136 21:45301732-45301754 TGGTGTCACCGGGGGCCTTCTGG - Intergenic
950128798 3:10527772-10527794 CGGTGTCCCCGCTGGGTTTCAGG + Intronic
957156575 3:76551617-76551639 GGGTGTCACAGCGCTGGTTCAGG - Intronic
957307849 3:78481039-78481061 GGGTGTCACAGCCCTGGTTCAGG - Intergenic
958823031 3:98998109-98998131 GGATGTCACCTCGGGGACTCAGG - Intergenic
962211923 3:133486653-133486675 GGGTGTCACAGCCCTGGTTCGGG + Intergenic
968472019 4:786712-786734 GGGGGTCAGGGCGGGGGTCCCGG + Intronic
969054227 4:4391570-4391592 GGGTGTCACCGAGAGGTTTAAGG + Exonic
992207577 5:74445825-74445847 GGGTGTCGCAGGGGGGCTTCAGG + Intergenic
997519597 5:134514279-134514301 GGGTCTCACAGCGGGGGGTGGGG + Intergenic
999702973 5:154245015-154245037 GGGTGCCACTGCAGGGATTCTGG + Intronic
1001959695 5:175872519-175872541 GTGGGTCTCCGCGGGGGTCCGGG + Intronic
1003857431 6:10290618-10290640 GGGGGTCACCTCAGGGGTTAGGG - Intergenic
1004044475 6:12011847-12011869 GGGCGTCCCCGCGGGGGCTGGGG - Intronic
1010534664 6:77012097-77012119 GGGTGTCACAGCCGTGGTTCAGG - Intergenic
1017665875 6:156719906-156719928 GGGATCCACCGCGGGGCTTCTGG + Intergenic
1017826703 6:158086959-158086981 GGGGGTCTCTGCGGGGGTTGAGG - Exonic
1018903911 6:168064323-168064345 GGCTGTCACCCCGGGGATGCAGG - Intronic
1019429350 7:991508-991530 AGGTGGCACCTCCGGGGTTCGGG - Intergenic
1019737729 7:2658958-2658980 TGTTCTCACAGCGGGGGTTCTGG - Exonic
1026983911 7:74542831-74542853 GGGTGGCACTGCAGGGGTTGGGG + Intronic
1034680735 7:152925650-152925672 GGGAATCACCGCAGGGGCTCAGG - Intergenic
1038575579 8:28701362-28701384 GGGTGTCACCGCGGAGCTGCGGG + Exonic
1045432229 8:102124433-102124455 GGGCTTCACCGCGGGGTTGCAGG + Intronic
1049178131 8:141206443-141206465 GGGTGTCACCACGGGGCTCCTGG - Intergenic
1049623844 8:143611390-143611412 GGGTGTCAGCGGGAGGGTTAGGG + Intergenic
1051726351 9:20090608-20090630 TGGTTTCACGGCGGGGGTTGGGG - Intergenic
1053790486 9:41683004-41683026 GGTAGTCTCCGCGGTGGTTCTGG + Intergenic
1054178831 9:61894703-61894725 GGTAGTCTCCGCGGTGGTTCTGG + Intergenic
1054658706 9:67686128-67686150 GGTAGTCTCCGCGGTGGTTCTGG - Intergenic
1054973060 9:71111465-71111487 GGATGGCATCGCGGGGGTTGGGG + Intronic
1057445027 9:95107713-95107735 GGGGGTCAGGGCGGGGGGTCGGG + Intronic
1057934169 9:99222475-99222497 GGGTGTCTAGGCCGGGGTTCTGG + Intronic
1060992450 9:127856801-127856823 GGGTGGCTCGGTGGGGGTTCAGG + Intergenic
1186637886 X:11426260-11426282 TGGTGTCACCTCGGGGCTCCTGG - Intronic