ID: 1179874838

View in Genome Browser
Species Human (GRCh38)
Location 21:44262358-44262380
Sequence AAGGGTGAAGAAAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1508
Summary {0: 1, 1: 0, 2: 13, 3: 140, 4: 1354}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179874838 Original CRISPR AAGGGTGAAGAAAGGGATGA GGG Intergenic
900088284 1:908809-908831 AGGGGGGAAGGGAGGGATGAGGG + Intergenic
900469735 1:2847864-2847886 AGGGGTGAAGAAAGAGACCATGG - Intergenic
900859543 1:5218242-5218264 AAAGGGGAAGAGAGGGATGGTGG - Intergenic
901001297 1:6150140-6150162 ATGGGTGGACAAATGGATGATGG + Intronic
901333656 1:8429984-8430006 TAGGGTGAAAAAAGGGAACATGG + Intronic
901529007 1:9842167-9842189 AAGGGAGAAGAAGGGCAAGAAGG - Intergenic
901621906 1:10595335-10595357 AAAGGAGGAGAAAGGGACGAGGG - Intronic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
901675375 1:10880381-10880403 CAAGGTGAAGAAGGGGAAGAAGG - Intergenic
901860859 1:12073450-12073472 AAGGAAGAAGAAAGGAAGGAAGG - Intronic
901890389 1:12258540-12258562 AAGGGTGAAGTACGTGGTGAAGG + Intronic
901909068 1:12439735-12439757 AGGAGGGAAGAAAGGGAAGAAGG + Intronic
902206099 1:14869179-14869201 AAGGGTCAAGACAGGCAGGAAGG - Intronic
902778919 1:18692192-18692214 AGGGGGGAAGAAAAGGAAGAAGG + Intronic
902926418 1:19698704-19698726 AAGGAAGAAGAAAGGGAAGGAGG - Intronic
903138813 1:21326450-21326472 AAGGGTGAAGAAGGGGTCCAGGG + Intronic
903156404 1:21446551-21446573 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
903172124 1:21560855-21560877 AAGGGTGTTTAAAAGGATGAGGG + Intronic
903363213 1:22790140-22790162 ATGGGTGAAGGTAGGGAGGAAGG + Intronic
904109077 1:28111161-28111183 AAGGGGGAAGTAATGGATAATGG - Intergenic
904277493 1:29393934-29393956 AAGGGAGAAGGAGGGGAGGAGGG - Intergenic
904390784 1:30184431-30184453 AGGAGTGAAGAAGGGGAAGAAGG - Intergenic
904390801 1:30184525-30184547 AGGAGTGAAGAAGGGGAAGAAGG - Intergenic
904933644 1:34110743-34110765 GAGGGTGGAGAACGGGAGGAGGG + Intronic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905146729 1:35893067-35893089 AGGGTGAAAGAAAGGGATGAAGG - Intronic
905222678 1:36459701-36459723 GAGGGAGAAGAAAAGAATGAAGG + Intronic
905323134 1:37131781-37131803 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
905389585 1:37627812-37627834 AGGGGTGCAGGGAGGGATGAAGG - Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905520299 1:38593899-38593921 GAGGGGGAAGAAAGTGATGTAGG - Intergenic
905696960 1:39981593-39981615 AAGGAAGAAGAAAGGGAGAAAGG - Intergenic
905751367 1:40467562-40467584 TGGGATGAAGAAAGGCATGAGGG - Intergenic
906140955 1:43533185-43533207 AAGAAGGAAGAAAGGGAGGAAGG - Intronic
906246856 1:44282347-44282369 AAGAGAGAAGAAAGGGAAGGGGG + Intronic
906327512 1:44856676-44856698 AAGGGGGAAGAAACTGAAGAAGG + Intronic
906382664 1:45342640-45342662 AATGGTGAGGAAATGGTTGAGGG + Exonic
906983672 1:50659260-50659282 AAGGGAGAAGAAGGGGAAAAGGG + Intronic
907072704 1:51551368-51551390 ACGGATGAAGAAAAGGAAGATGG - Intergenic
907229215 1:52979907-52979929 AAAGGGAAAGAAAGGGAGGAAGG - Intronic
907550226 1:55298820-55298842 TAGGGTGTAGAGAGGGATGCTGG + Intergenic
907670568 1:56471371-56471393 AGGAGTGAAGGAAGGGAAGAAGG + Intergenic
907866891 1:58407271-58407293 AAGGGAGACTAAAGGGCTGAGGG - Intronic
908144919 1:61230713-61230735 AAGTGTGAAAAACGGGATGCGGG - Intronic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
908916732 1:69136244-69136266 AAGGGAGGAGAAAGGGAAGGAGG + Intergenic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909209811 1:72808754-72808776 AAGGGGGAAGAAAGTGATTGTGG - Intergenic
909541887 1:76800795-76800817 AAGGGTGCAGAAAGAGAAGTTGG - Intergenic
909877919 1:80834037-80834059 TAGGGTGAGGAAAGTGGTGATGG - Intergenic
909885219 1:80933433-80933455 AAGGGGGGAGGATGGGATGAGGG - Intergenic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
910491145 1:87773039-87773061 AAGGGAGAAAAAAGGGGAGAAGG + Intergenic
910835812 1:91508866-91508888 AAGGGGGAACAAAGAAATGATGG - Intronic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
910959872 1:92750781-92750803 AAGGTTGATGATATGGATGATGG - Intronic
911390067 1:97230483-97230505 GAGGGTGAAGGATGGGAGGAGGG + Intronic
911629822 1:100170696-100170718 AAGAAAGAAGAAAGGGATGGAGG - Intronic
911811353 1:102285834-102285856 AAAGGTAGAGAAAGGGATAAGGG + Intergenic
911826533 1:102493242-102493264 AAGGAAGAAGAAAGGAAGGAAGG + Intergenic
911980811 1:104563145-104563167 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
912151882 1:106869635-106869657 GAGGGTGAAGAATGGGAAGAGGG - Intergenic
912817331 1:112839677-112839699 GAGGGTGAAGAAGGGGAGAATGG - Intergenic
913016475 1:114741591-114741613 AAGGGTAAAGAAAGTGAAGGAGG + Exonic
913208926 1:116567295-116567317 GAGGGAGAAGAAAGGGACAAGGG + Intronic
913428148 1:118757863-118757885 ATGGATGAAGGAAGGGAGGATGG + Intergenic
913457771 1:119051174-119051196 AAGGGTGTCGAATGGGAGGAGGG - Intronic
913966718 1:143382984-143383006 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914061095 1:144208591-144208613 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914118055 1:144757778-144757800 AAGGGAGAAGAAAGGAAGGCAGG + Intergenic
914901784 1:151715044-151715066 ATGGGAGAAGAGAGGGATGATGG - Intronic
914990732 1:152497655-152497677 AAGGGGGAAACTAGGGATGAGGG - Intergenic
915105569 1:153533370-153533392 AAGGGGGAGGAAAGGGGTGTAGG + Intergenic
915447073 1:155979871-155979893 ATGGGTGAAGAAGGAGGTGAAGG - Intronic
915512040 1:156391792-156391814 AGGGGTGAGGGAAGGGGTGAGGG - Intergenic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915626843 1:157119023-157119045 AAGGATGGGCAAAGGGATGAGGG - Intergenic
915779655 1:158532662-158532684 AAGGGTGCAGAAGGGGAAGAGGG - Intergenic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916386064 1:164271856-164271878 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
916392307 1:164343786-164343808 GAGGGTGAAGACAGGAATGCTGG + Intergenic
916473446 1:165145970-165145992 AGGAGAGAAGAAAGGGAAGAAGG - Intergenic
916621893 1:166507318-166507340 GAGGGTGGAGAGTGGGATGAGGG - Intergenic
916848895 1:168683265-168683287 AAGGGTGCAGAACTGGATGGAGG - Intergenic
917060965 1:171038822-171038844 AATGGTCAAGAAGGGGATCATGG + Intronic
917451547 1:175151479-175151501 AATGGTGGAGAAGGGGAGGAGGG + Intergenic
918156345 1:181850223-181850245 AAGGGTGCAGAACTGGATGGAGG + Intergenic
918476835 1:184934318-184934340 GAGGGAGAAGGAAGGGAGGAGGG + Intronic
918598725 1:186326153-186326175 GAGGGTGAAGATAGTAATGAAGG - Exonic
918633932 1:186752207-186752229 ATGGGTGAACAAAATGATGATGG - Intergenic
918756850 1:188348874-188348896 AAGGATGAAGAAAGTGTTGAGGG - Intergenic
919058883 1:192606104-192606126 AAGGGGGAAGGAAGGAAGGAGGG + Intergenic
919377457 1:196812349-196812371 AAGGCTGAAGAAGGAAATGAAGG + Intergenic
919389745 1:196968252-196968274 AAGGCTGAAGAAGGTAATGAAGG + Intergenic
919613135 1:199771971-199771993 AAGGAAGAAGGAAGGGAAGAAGG + Intergenic
919613555 1:199776937-199776959 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
919839967 1:201601872-201601894 GAGGGAGTAGAAAGGGATGCTGG - Intergenic
920103953 1:203537237-203537259 AGAGGTGAGGAATGGGATGAGGG + Intergenic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920222866 1:204416925-204416947 AAGGAAGAAGAAAGGGAGGGAGG + Intergenic
921191250 1:212710688-212710710 AAGGAGGAAGGAAGGGAGGAAGG - Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
922004908 1:221520464-221520486 AAGGAAGAAGAAAGGAAGGAAGG - Intergenic
922004914 1:221520499-221520521 AAGAAGGAAGGAAGGGATGAAGG - Intergenic
922020582 1:221700170-221700192 AAGGGAGAGGGAAGGGAAGAGGG + Intergenic
922384338 1:225067108-225067130 GAGGGTGGAGAGTGGGATGAGGG - Intronic
922556145 1:226533796-226533818 AAGTCAGAAGAGAGGGATGAAGG - Intergenic
923357634 1:233176352-233176374 ACGGGAGAAGAAAAGGAAGAAGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923688789 1:236173436-236173458 AAGGAGGAAGAAAGGAAGGAAGG + Intronic
923762029 1:236855574-236855596 AATGGTGAAGGAAGGGATCAAGG - Intronic
923861781 1:237898918-237898940 CAGGGGGAAGGAAGGGATCAGGG - Intergenic
924005122 1:239600676-239600698 AAGGGAGAAGAAAGGAAGGAAGG - Intronic
924712483 1:246541362-246541384 GAGGGTGAAGGATGGGAGGAGGG + Intronic
1063018277 10:2100321-2100343 AAAGGTGAAATAAGGGCTGATGG - Intergenic
1063105344 10:2987340-2987362 AAGAGGGAAGGAAGGAATGAGGG - Intergenic
1063111416 10:3041021-3041043 AAGAAAGAAGAAAGGGAGGAAGG + Intergenic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063257610 10:4345651-4345673 AAGGAAGAAGGAAGGGAGGAAGG + Intergenic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1063691861 10:8295438-8295460 AAGAAGGAAGAAAGGGAGGAAGG - Intergenic
1063708318 10:8452616-8452638 AAGAGGGAAGAAAGGAAGGAAGG - Intergenic
1063875864 10:10477698-10477720 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1063915118 10:10873819-10873841 AAGGCTGGACAAAGGGGTGAAGG - Intergenic
1063964969 10:11339631-11339653 GCGGGTGCAGAAAGAGATGACGG - Intergenic
1064409501 10:15092835-15092857 GGGGGGGAAGAAAGGGAGGAGGG + Intergenic
1064479630 10:15726269-15726291 AAGGGAGAAGGAAGGAAAGATGG + Intergenic
1064490563 10:15851381-15851403 AAGGGTGAAGAGGGAGATGCAGG - Intronic
1064526032 10:16257682-16257704 AAGGGTGCAGTAAGCTATGATGG + Intergenic
1064703968 10:18051159-18051181 AAGAGAGAAGGAAGGGAGGAAGG + Intergenic
1064823948 10:19373545-19373567 AAGGAAGAGGAAAGGGAAGAAGG + Intronic
1065458904 10:25934857-25934879 AAGGGTGGCGTAAGGGGTGAAGG + Intronic
1066066083 10:31761830-31761852 AGGGAGGAAGAAAGGAATGAAGG + Intergenic
1066125360 10:32336387-32336409 AAGGAGGAAGACAGGGATGAAGG - Intronic
1066173567 10:32879145-32879167 AAGGATGAAGATAAGGTTGATGG - Intronic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1066502427 10:36007089-36007111 GAGGGTGGGGAAAGGGAGGAGGG - Intergenic
1066522702 10:36240276-36240298 AAGGGTGGAGGATGGGAGGAAGG - Intergenic
1066658721 10:37719826-37719848 AAGGTCCAAGAAAGGGATGGGGG - Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067280647 10:44869490-44869512 AAGGAGGTAGAAAGGGAGGAAGG + Intergenic
1067678705 10:48411830-48411852 GAGGGTGGAGAAAGGAAGGAAGG - Intronic
1068119340 10:52770521-52770543 AAGAATGAAGAGAGGGCTGAGGG + Intronic
1068254211 10:54487340-54487362 AAGGGTGAAGAATGGGATTGGGG + Intronic
1068329098 10:55538473-55538495 AAGGAGGAAGGAAGGGAGGAAGG - Intronic
1068329109 10:55538517-55538539 AAGGAGGAAGGAAGGGAGGAAGG - Intronic
1068553970 10:58437332-58437354 AAGACTGGAGAAAGGCATGAGGG + Intergenic
1068816776 10:61324758-61324780 AACGAAGAAGAAAGGGATGAGGG - Intergenic
1068948662 10:62755351-62755373 AAGGAGGAAGAAAGGGAGGAGGG + Intergenic
1069634055 10:69914584-69914606 AAAGTAGAAGAGAGGGATGACGG + Intronic
1069668731 10:70183564-70183586 AAGGGAGAAGGAAGGAAAGAAGG + Intergenic
1069725826 10:70577662-70577684 AAGGGAGAAGAAAAGGAGAAAGG - Intergenic
1069945961 10:71985880-71985902 AAGGGTCAAGGAAGGGGTGGGGG - Intronic
1070082478 10:73202660-73202682 AAGGAAGAGGGAAGGGATGAAGG - Intronic
1070144799 10:73765988-73766010 AAGGGACAAAAAAGGGGTGAGGG - Intronic
1070616204 10:77971245-77971267 AAGGGAGAATGAAGGGATCAGGG + Intronic
1070707508 10:78651326-78651348 AATGGTGAAGAAAGAGGTAAAGG + Intergenic
1070758525 10:79008646-79008668 AGGGGTGGTGAAAGGGAGGAGGG + Intergenic
1070780142 10:79132847-79132869 AAGGGAGAAAAAAGGGAAGTGGG - Intronic
1071106333 10:82100364-82100386 AAGGCTGAAAAAAAGGAAGAGGG - Intronic
1071271118 10:84008689-84008711 AAGGATGAAGAAGGAGAAGATGG - Intergenic
1071416148 10:85443859-85443881 AAGGAAGAAGAAAAGAATGAAGG + Intergenic
1071480019 10:86058095-86058117 AGTGGGGAAGAAAGGGAGGAAGG + Intronic
1071585554 10:86817250-86817272 AAGGATGGGGAAAGGGAAGAAGG - Intronic
1071751117 10:88477333-88477355 GATGGTGAAGTTAGGGATGAAGG + Intronic
1071751143 10:88477527-88477549 GATGGTGAAGACAGGGATGATGG + Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072169024 10:92842530-92842552 AAGGGAGAGGAAAGGGAGAAAGG + Intronic
1072782317 10:98259248-98259270 GAGGGTGGAGGAAGGGCTGAGGG + Intronic
1072794808 10:98346586-98346608 AAGGGGGAGGAAAGGGAAGAGGG + Intergenic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073169353 10:101490256-101490278 AAGGAAGAAGAAAGGAAGGAAGG - Intronic
1073251227 10:102121246-102121268 AAGGCTGGAGAAAGGGGGGAAGG - Intergenic
1073283272 10:102370249-102370271 AAGGATGAAGAAAGGAAACATGG + Intronic
1073615144 10:104987215-104987237 AAGGGAGAAAAAAGGAATGAGGG + Intronic
1073697174 10:105882783-105882805 AAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1073985314 10:109201680-109201702 GAGGGTGAAGGATGGGAGGAAGG + Intergenic
1074364972 10:112850428-112850450 AAGGGTAAAGAAGAGGGTGAGGG + Intergenic
1074495310 10:113975179-113975201 TAGCGTGAAGGAAGGAATGAAGG - Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074885438 10:117689323-117689345 AAGGGGGAAGAAGGGGAGGGAGG + Intergenic
1074950128 10:118325767-118325789 AAGGGTTAAGAAAAGGTTCAGGG + Intronic
1074967515 10:118504484-118504506 AAGGGGGAAGGAAGGAAGGAAGG + Intergenic
1075164812 10:120058154-120058176 AAGGGTGGAGGATGGGAGGAAGG + Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076505772 10:130971708-130971730 AGGGATGAAGGAAGGGACGAAGG - Intergenic
1076558674 10:131346874-131346896 AAGGAAGAAGGAAGGAATGAAGG - Intergenic
1076558687 10:131346921-131346943 AAGGAAGAAGGAAGGAATGAAGG - Intergenic
1076558700 10:131346968-131346990 AAGGAAGAAGGAAGGAATGAAGG - Intergenic
1076558712 10:131347015-131347037 AAGGAAGAAGGAAGGAATGAAGG - Intergenic
1076558721 10:131347062-131347084 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1076558752 10:131347208-131347230 AAGGAAGAAGGAAGGGAGGAAGG - Intergenic
1076758106 10:132585702-132585724 AAGGATGAAGAAAGAGATGGTGG - Intronic
1077664798 11:4098289-4098311 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1077733845 11:4766720-4766742 AAGGATGAAAAAAGGAAGGAAGG - Intronic
1078450878 11:11439869-11439891 AGGGGTGAAGAACAGGATGATGG + Intronic
1079002822 11:16772109-16772131 TTTGGTGGAGAAAGGGATGATGG - Intergenic
1079339866 11:19602952-19602974 AAAGATGGAGAAAGGGAGGAAGG + Intronic
1079739843 11:24044107-24044129 AGGGGTGAAAAAAAGGGTGATGG - Intergenic
1079768295 11:24423251-24423273 AAAGAGGAAGAAAGGAATGAAGG - Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079800406 11:24860930-24860952 AAGGGTGCAGAACTGGATGGAGG + Intronic
1080133112 11:28819582-28819604 AAGAGAGAAGAAAGAAATGAAGG + Intergenic
1080135039 11:28844624-28844646 AGGGAAGAAGAAAGGGAGGAAGG - Intergenic
1080299696 11:30770292-30770314 GAGGGTGAAGGAAGGGACTAGGG - Intergenic
1080302303 11:30798178-30798200 AAGAGAGAAAAAAGGGATAAAGG - Intergenic
1081454817 11:43211592-43211614 AAGGGTGCAGAACTGGATGGAGG - Intergenic
1081929429 11:46858516-46858538 GTGGGTAAAGACAGGGATGAAGG - Exonic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082053857 11:47796520-47796542 AAGGGGGAAGAAAGGAAAGGAGG + Intronic
1082703868 11:56468268-56468290 AAGGGTGGAGATTGGGAGGAGGG + Intergenic
1083123778 11:60542289-60542311 AAGAAAGAAGAAAGGGAGGAAGG + Intronic
1083213430 11:61203688-61203710 GAGGGAGAAAAAAGGGAAGAAGG - Intronic
1083347184 11:62001673-62001695 AGGGGTGAATAGAGGGGTGAGGG + Intergenic
1083471226 11:62885389-62885411 ATGGGAGAAGAAAGGGTTGTTGG + Intronic
1083568934 11:63745411-63745433 AAGGGAATAGAAAGTGATGAAGG + Intronic
1083734215 11:64670415-64670437 AGGGCTGGAGAAAGGGAAGAAGG + Intronic
1084021062 11:66418592-66418614 AAGGGTCTAGAAAGGGACAAGGG - Intergenic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084341995 11:68510952-68510974 AAGAGAGAAAACAGGGATGAAGG - Intronic
1084406544 11:68977153-68977175 AAGGGGGAAGAAAAGAAGGAAGG + Intergenic
1084444166 11:69193830-69193852 ATGGGTGAAGGAAGGAGTGAGGG + Intergenic
1084453671 11:69254847-69254869 AGGGGAGAAGAATGGGATGTGGG + Intergenic
1084706223 11:70817375-70817397 AGGGGTGGGGAAAGGGAAGATGG + Intronic
1085095341 11:73755811-73755833 AAGGGGGAAGGAAGGGAGAAGGG + Intronic
1085148900 11:74231758-74231780 AATGGTGGAGAAATGGAAGATGG + Intronic
1085499468 11:77006450-77006472 AATGATGAAAAAAGGGATCATGG - Intronic
1085521173 11:77139681-77139703 GAGGGAGAAGGAAGGGAGGAAGG - Intronic
1085849515 11:80103424-80103446 AAGGGGGAAAAAAGGAAGGAGGG - Intergenic
1085849519 11:80103440-80103462 AAGGTTGAAGAAAAGGAAGGGGG - Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086212292 11:84335197-84335219 AAGGGAAAGGAAAGGAATGAAGG + Intronic
1086301638 11:85432297-85432319 AAGGGTGCAGAACTGGACGAAGG + Intronic
1086384735 11:86295531-86295553 AAAGGTGATGAAGGGGAGGAAGG + Intergenic
1086513956 11:87590087-87590109 AAGGGTGAAGAACTGGAAGGAGG + Intergenic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1086763675 11:90666843-90666865 AGCGATGAAGAAGGGGATGATGG - Intergenic
1087729540 11:101762684-101762706 AAGGGTGGAGAGTGGGAAGAGGG - Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087908455 11:103725958-103725980 AAGGGTGAAGGATGAGAGGAAGG + Intergenic
1088059888 11:105634427-105634449 AAGGGAGGAGAAAGGAAGGAAGG + Intronic
1088146817 11:106690528-106690550 GAGGGTGAAGGATGGGAGGAGGG + Intronic
1088348937 11:108862866-108862888 AAGGGTGATGAAAGGGACATTGG + Intronic
1088798782 11:113286879-113286901 AAGGGTGATGTAGGGGATGATGG - Intergenic
1088832760 11:113551409-113551431 AAAGCAGAATAAAGGGATGAAGG - Intergenic
1088868054 11:113867828-113867850 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
1089105437 11:115999363-115999385 AAGACTGAGGAAAGAGATGATGG + Intergenic
1089333158 11:117704111-117704133 AAGGAAGAAGGAAGGGAGGAGGG + Intronic
1089429112 11:118406517-118406539 AGAGGTGAAGAAAGGGATGAAGG - Intronic
1090116987 11:123984147-123984169 AAGGGTGCAGAACTGGATGGAGG - Intergenic
1090264732 11:125346816-125346838 AGGGGGGAAGGAAGGGAGGAAGG + Intronic
1090328515 11:125910043-125910065 GAGGGGGAAGAATGGGATGTAGG - Intronic
1090872168 11:130758226-130758248 GAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1090964462 11:131585869-131585891 CAGGGAGAAGAAAGGAAAGATGG - Intronic
1091102501 11:132888090-132888112 AAGGGGGAATAAAGAGAAGAGGG + Intronic
1091142804 11:133250481-133250503 AAGAATGAAGAAAGGGAGGAAGG + Intronic
1091308339 11:134555214-134555236 AAGGATGTTGAAAGGAATGATGG - Intergenic
1091676404 12:2493728-2493750 AAGAGGCAAGAAAAGGATGAGGG - Intronic
1091700186 12:2653978-2654000 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1091842012 12:3628118-3628140 AAGGGTGAAGGAAGGGAGGGAGG - Intronic
1093007913 12:14070908-14070930 GAGGGTGAATATAGGGATAAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093071366 12:14709586-14709608 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1093087737 12:14885634-14885656 AAGGGGGAAGAAGAGGAGGAGGG + Intronic
1093220995 12:16420553-16420575 AAGGGAGGAGAAAGGGTAGAAGG + Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1093913359 12:24772517-24772539 AAAGATGAAGAAAGGAAAGAAGG + Intergenic
1093950927 12:25164415-25164437 AAGGGAGAAGAAGGGAATGGAGG - Intronic
1094019574 12:25899990-25900012 AAGGGGGAAGAAAGGGTAAAGGG - Intergenic
1094020714 12:25911214-25911236 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1094085571 12:26587724-26587746 GATGGAGGAGAAAGGGATGAAGG - Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094220594 12:27988706-27988728 AAGGGTCAGGAAATGCATGAAGG - Intergenic
1094374217 12:29773302-29773324 AAGGGAGAAGAAAGAGTTGTTGG + Intronic
1094382658 12:29860039-29860061 AATGGTGAAGAAACTGATCATGG - Intergenic
1094636702 12:32233509-32233531 AAGGGGGAAGAACGGGAGGGAGG - Intronic
1095045264 12:37496459-37496481 AAGGGTGGAGAACGGAATGGTGG - Intergenic
1095145619 12:38722493-38722515 CAGGTTGAAGAAGGGGTTGAGGG - Intronic
1095258818 12:40074689-40074711 AAGGGGGAAAAATGGGCTGAAGG - Intronic
1095502897 12:42860054-42860076 AGGGAAGAAGAAAGGAATGAAGG - Intergenic
1095764169 12:45876204-45876226 AAGGATGGAGAGAGAGATGAAGG + Intronic
1096008729 12:48194566-48194588 AAGGGGCAGGTAAGGGATGAAGG + Intergenic
1096014923 12:48261952-48261974 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096066919 12:48748409-48748431 GAGGGTGGAGAAAGAAATGAGGG - Intergenic
1096402511 12:51318992-51319014 AAGGGTGGAGCCAGGGAGGATGG - Intronic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1096970002 12:55657929-55657951 AATGGAGAAGGAAGGAATGAAGG + Intergenic
1097350608 12:58544510-58544532 AAGAGAGAAGAAAGGGAAGAAGG - Intronic
1097640228 12:62172238-62172260 GAGGATGAAGGAAGGGAGGAAGG - Intronic
1097926535 12:65134247-65134269 AAGGAGGAAGGAAGGGAGGAAGG + Intergenic
1098375702 12:69811232-69811254 AAGGGTGGAGGATGGGAAGAGGG + Intronic
1098429406 12:70403096-70403118 AAGGAAGAAGAAAGGGAACAAGG + Intronic
1098654047 12:73006751-73006773 AAGGATGAAGAAGGGGTTGGGGG + Intergenic
1098685708 12:73417352-73417374 ATAGGTGAGAAAAGGGATGAAGG + Intergenic
1099099866 12:78425345-78425367 AAAGATTAAGAAGGGGATGAGGG + Intergenic
1099141155 12:78977142-78977164 AAGGGCAAAGAAAGTGAGGAAGG + Intronic
1099227212 12:79983594-79983616 TAGGGTGAAGAAAGGGAGTCTGG + Intergenic
1099252854 12:80279435-80279457 AAGGGTGAAGGATGGGAGGAGGG - Intronic
1099278814 12:80615627-80615649 AGGGGTGAAGAAGGGCATAAAGG + Intronic
1099723066 12:86389186-86389208 GAGGGTGCAGAATGGGAGGACGG - Intronic
1100057323 12:90527988-90528010 AAGGATGAAGAAAGGGAGCTTGG + Intergenic
1100184975 12:92129089-92129111 AAGGGAGAAGGAAGGGGCGATGG + Intronic
1100356791 12:93838534-93838556 AAGAGAGAAGCAAGGGAGGAAGG - Intronic
1100648388 12:96556902-96556924 GAGGGTGAAGGGTGGGATGAGGG + Intronic
1100877238 12:98975173-98975195 AAGGAAGAGGAAAGGGAGGAAGG - Intronic
1100888025 12:99093894-99093916 AAGGGTGAAGGTAGTGGTGAAGG + Intronic
1100947232 12:99799725-99799747 AAGGGGGAAGAAAGTCATGAGGG + Intronic
1100953744 12:99882645-99882667 AAGGGTGGGGAAGGGGGTGAAGG + Intronic
1101146035 12:101841230-101841252 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1101161953 12:101986571-101986593 AAGGGTGAAGAAAGGAAGATGGG + Intronic
1101231611 12:102747178-102747200 ATTGTTGAATAAAGGGATGAAGG + Intergenic
1101284327 12:103294904-103294926 GAGGGTGAAGGATGGGAGGAGGG - Intronic
1101348217 12:103905426-103905448 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348265 12:103905556-103905578 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348278 12:103905606-103905628 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348304 12:103905673-103905695 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101533011 12:105591757-105591779 AAGTGTGAAGAGAGAGCTGAAGG - Intergenic
1102061882 12:109938776-109938798 AAGGGTGAAGGAGGGGAAAAGGG + Intronic
1102078601 12:110080012-110080034 AAGGGAGAAGACAGGGAGAAAGG + Intergenic
1102513308 12:113429993-113430015 AAGAATGAAGAAAGGAAGGAGGG - Intronic
1102669212 12:114602701-114602723 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1102822947 12:115923761-115923783 GAGGGTGAGGAAGAGGATGAGGG - Intergenic
1102992026 12:117322416-117322438 AGGAGTGAGGAAAGGGAGGAGGG - Intronic
1103199162 12:119072429-119072451 AAGGATGAAGAAAGGGAGCAGGG + Intronic
1103216154 12:119202866-119202888 AAGGGTGAAGCAGGGCATGCAGG - Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103688537 12:122752148-122752170 AAGGATGAAGGAAGGGAGGGAGG + Intergenic
1103729106 12:123014122-123014144 AGGGGTGTGGAAAGGGAGGAGGG + Intronic
1104173530 12:126305483-126305505 AAGGGTGAGGAACGGAATCATGG + Intergenic
1104213172 12:126710257-126710279 GAGGGTGGAGAATGGGAAGAGGG - Intergenic
1104213326 12:126711518-126711540 AAGGGAGAAGGGAGGGATGGAGG + Intergenic
1104338290 12:127922118-127922140 AAGGGTGAAGGATGGGAGGAGGG - Intergenic
1104466373 12:128994073-128994095 AAGGGGGCAGGAAGGGAAGATGG - Intergenic
1105294294 13:19074653-19074675 AATGGTGATGATAGTGATGATGG - Intergenic
1105303350 13:19153706-19153728 AAGGATCAAGCAGGGGATGAGGG + Intergenic
1105643706 13:22293695-22293717 AAGGGTGGAGGATGGGAGGAGGG - Intergenic
1105715657 13:23061423-23061445 AAGGAGGAAGAAAGAGATGGAGG + Intergenic
1105737059 13:23282473-23282495 AAGGGTGGAGGATGGGAGGAGGG - Intronic
1106432228 13:29692214-29692236 AAGGGAGAAGAATGGAATGCAGG + Intergenic
1106630539 13:31467518-31467540 AAGGGAGAAGGAAGGAACGAAGG - Intergenic
1106970388 13:35133846-35133868 GAGTGTGAAGAATGGGATGATGG + Intronic
1107015806 13:35706869-35706891 AAGGGAGGAGAAAGAGAGGAAGG + Intergenic
1107022616 13:35766933-35766955 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
1107423420 13:40270757-40270779 TGAGGTGAAGAAAGTGATGATGG - Intergenic
1107463524 13:40628460-40628482 AAAAGTGCAGAAAGGGATGAGGG - Intronic
1107597120 13:41974456-41974478 AAGTGTGAAGAAAGGTGTGGAGG + Intergenic
1107756978 13:43635063-43635085 AAGGGGAGAGAAAGGAATGAAGG + Intronic
1108111498 13:47078621-47078643 GAGGGTTAAGAATGGGAGGAGGG + Intergenic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108787543 13:53923680-53923702 AAGGGTGTTGAAGGGGGTGAGGG - Intergenic
1108875953 13:55051313-55051335 AAGAGAGAAGGAAGGGAGGAGGG + Intergenic
1108922395 13:55692481-55692503 AGGGATGAAGAAATGGATGCTGG + Intergenic
1109181588 13:59220098-59220120 AAGGGGGAAGGAAGGAAGGAAGG + Intergenic
1109404697 13:61881597-61881619 AAGGAAGAAGAAAGGAAGGAAGG - Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1109730332 13:66404772-66404794 AAGGGGGGAAAAAGGCATGAAGG - Intronic
1110290419 13:73799256-73799278 GAAGGTGATGAAAGGGAGGAGGG + Intronic
1110570182 13:76994383-76994405 GAGGGCAAAGAAAGAGATGAAGG - Intronic
1110619343 13:77577870-77577892 AAGGTGGAAGAAAGGAGTGAGGG - Intronic
1110659419 13:78041909-78041931 AAGGGTGCAGAATAGGAGGAAGG - Intergenic
1110854639 13:80283016-80283038 AAGAGTGAAGACAGGGATTGTGG - Intergenic
1110935394 13:81281152-81281174 AAGAATGAAGAAAGGGAAGGAGG + Intergenic
1111073061 13:83195071-83195093 AAGGGGAAAGGAAGGGATGGTGG + Intergenic
1111720644 13:91939773-91939795 AGGGCTGAAGAAGGGGTTGAAGG + Intronic
1111827235 13:93282694-93282716 GAAGGGGGAGAAAGGGATGATGG - Intronic
1111827246 13:93282855-93282877 GAAGGGGGAGAAAGGGATGATGG - Intronic
1111827257 13:93283016-93283038 GAAGGGGGAGAAAGGGATGATGG - Intronic
1112195298 13:97219823-97219845 AAGTGTGAAAAAAGGTTTGAAGG + Intergenic
1112733135 13:102389107-102389129 AAAGGGGAAGAAGGGGAAGAAGG - Intronic
1112942898 13:104888214-104888236 AAGGGAGAAAAAAGGAAAGAAGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113633519 13:111904401-111904423 AAGGGTGATGAAGAGGCTGATGG - Intergenic
1113796531 13:113061735-113061757 AAGGGAGGGGAAAGGGAAGAGGG - Intronic
1113983063 13:114292770-114292792 GAGGGTGGAGAATGGGAGGAGGG - Intronic
1114242357 14:20880206-20880228 AAAGGTGAATAAAGTGATGATGG + Intergenic
1114469194 14:22947514-22947536 AAGGGAGAGGAAAGAGATTAGGG + Intronic
1114614032 14:24059014-24059036 ATGGGTGAATGATGGGATGAGGG - Intronic
1114652704 14:24296388-24296410 AAGGGAGAAGAAAGAGATGGGGG + Intronic
1114993696 14:28319461-28319483 AAGGGAGGAGAAAAGGATGGGGG + Intergenic
1115825489 14:37267537-37267559 AAAGAGGAAGAAAGGGAAGAAGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115924343 14:38413593-38413615 AAGGGTGCAGAACTGGATGGAGG + Intergenic
1115928703 14:38467012-38467034 AAGGGTGCAGAAATGGACAAAGG - Intergenic
1116290007 14:43022451-43022473 AGGAGAGAAGAAAGGGATGGAGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116560797 14:46376613-46376635 AAGGGTGCAGAACTGGATGGAGG - Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116659610 14:47692206-47692228 AAGAGGGAAGAAAGGGAGGAAGG - Intergenic
1116844753 14:49854865-49854887 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1117558298 14:56909258-56909280 AAGGCTGAAGTAAGCCATGATGG - Intergenic
1117617271 14:57546404-57546426 AAGTGAGAGGAAAGGGAGGAAGG + Intergenic
1117619382 14:57568875-57568897 TATGGAGAAGAGAGGGATGAGGG + Intronic
1117701802 14:58421327-58421349 AAGGGTTAAGGAATGGATGAGGG + Intronic
1117814969 14:59588075-59588097 AAGAATGAAGAAAGGGTAGAGGG - Intergenic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1117903503 14:60560396-60560418 AAGGGTGCAGAAAAGGAAGCTGG + Intergenic
1117918275 14:60701569-60701591 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
1117918293 14:60701637-60701659 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1117918317 14:60701727-60701749 AAGAGTGAAGGAAGGAAAGAGGG - Intergenic
1117976351 14:61300821-61300843 AAGGTTGACAAAAGGGAAGATGG - Intronic
1118247926 14:64129682-64129704 AATAGTACAGAAAGGGATGAAGG - Intronic
1118573333 14:67216639-67216661 ATGGGTGAAGGAAGAAATGAAGG - Intronic
1118665915 14:68069428-68069450 AAGGGTGGAGAGTGGGAGGATGG - Intronic
1118981333 14:70719161-70719183 AGGGACGAAGAAAGGGGTGAGGG + Intergenic
1119108231 14:71944691-71944713 AAAGGTGCAAAAAGGGATAATGG + Intronic
1119316973 14:73704400-73704422 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1120143119 14:80950692-80950714 AAGGGAGAGGAAAGTGATAAGGG + Intronic
1120287125 14:82518104-82518126 AAGGATGAAGAAAGGAAGGAAGG + Intergenic
1120288172 14:82532317-82532339 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1120313285 14:82859017-82859039 AAGGCTTAATAAAGGGATCATGG + Intergenic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120539757 14:85737627-85737649 AAGGGTGAAGAAGGGGTTGGGGG + Intergenic
1120768619 14:88354926-88354948 ATGGGTGAAGGAAGGGTAGATGG - Intergenic
1121077019 14:91077348-91077370 AAGGGAGAAGGAAGGGAGGGAGG + Intronic
1121603201 14:95221296-95221318 ATGGGAGAAGAAGGGGAAGAGGG - Intronic
1121800224 14:96768747-96768769 AAGGATGAAGGAAGGAAGGAAGG - Intergenic
1121924901 14:97918455-97918477 AAGACTGAAGAAAGGGAATAGGG + Intergenic
1122011540 14:98753092-98753114 ATGGGTGAATGAATGGATGATGG + Intergenic
1122053934 14:99079489-99079511 GAGGGTGAGAAAAGGGATGGTGG - Intergenic
1122411950 14:101530055-101530077 AAGAGTTAAGAAAGGCAGGAAGG + Intergenic
1123470490 15:20548366-20548388 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123647569 15:22452334-22452356 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1123730789 15:23143344-23143366 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123748928 15:23340770-23340792 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123757241 15:23406603-23406625 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
1124281300 15:28364653-28364675 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124301402 15:28546968-28546990 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1124394702 15:29291080-29291102 TAGGGGGAAGAAAGGGATGGGGG - Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1125107216 15:35986308-35986330 AAGGGTGAAGAAAAGGACAGTGG - Intergenic
1125444053 15:39733964-39733986 AAAGGAGAAAAAAGAGATGATGG + Intronic
1126171272 15:45697168-45697190 GAAGGAGAAGAAAGGGAAGAAGG - Intergenic
1126289878 15:47062048-47062070 AAGGGTGAAGAAAGAAATGGTGG + Intergenic
1126551028 15:49929653-49929675 AATATTGAAGAATGGGATGAAGG + Intronic
1126642292 15:50840487-50840509 AGGAAAGAAGAAAGGGATGATGG + Intergenic
1127013397 15:54655418-54655440 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1127595292 15:60475891-60475913 ATGTGTGGAGAAAGGAATGAAGG + Intronic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1127980771 15:64033283-64033305 AAGGGGGAAGGAAGGAAGGAAGG + Intronic
1127988130 15:64090963-64090985 GAGGCTGGAGAAAGAGATGAAGG + Intronic
1128109215 15:65066145-65066167 AAAGAAGAAGAGAGGGATGAAGG + Intronic
1128371258 15:67041139-67041161 AAGGGAGAAGGAAGGAAGGAAGG + Intergenic
1128624854 15:69189964-69189986 GAGGGTGGAGAGTGGGATGAGGG - Intronic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128799498 15:70488646-70488668 AAGGGGCAAGAAAGAGATGAGGG + Intergenic
1128826116 15:70719024-70719046 AAGGAGGAAGGAAGGGAGGAAGG + Intronic
1129001717 15:72341171-72341193 AAGGGTGAAAGAAAGGATGTAGG - Exonic
1129068745 15:72933363-72933385 AAAGGTTAAGAAAGTCATGAAGG + Intergenic
1129119187 15:73385211-73385233 GAGGGTGAAGGCAGGGATAATGG + Intergenic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1129289941 15:74557511-74557533 AAGGGTGAAGAAAAAAATAATGG - Intronic
1129659586 15:77545577-77545599 AAGTGAGAAGAAAGAGAAGAGGG - Intergenic
1129907023 15:79195593-79195615 AAGGTGGAAGGAAGGGATGTAGG + Intergenic
1129933049 15:79428256-79428278 GAGGGAGAAGAAAGGAAGGAGGG - Intergenic
1130008761 15:80130009-80130031 AAGGATGAAGAAAATCATGAAGG + Intronic
1130070171 15:80640415-80640437 ATGGTTGAGGAAAAGGATGAGGG - Intergenic
1130858138 15:87860204-87860226 GAGGGTGAAGAATGGGGTGATGG + Intronic
1130885645 15:88090369-88090391 AATGCTGAAGAAAGGAAGGAAGG + Intronic
1130916092 15:88305919-88305941 AAGAGAGAAGAAAGGGAGGGAGG + Intergenic
1131449285 15:92525860-92525882 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1131499527 15:92948490-92948512 AACCATGAAGAAAGGGGTGATGG + Intronic
1131833234 15:96367356-96367378 AAGGGGGAAAAAAGGCAAGATGG - Intergenic
1131915695 15:97263528-97263550 AAAGGAGAAGAAAGGGAGGGAGG + Intergenic
1132010737 15:98274048-98274070 AAGGGGGAAGAAAGGGAGGTGGG - Intergenic
1132307016 15:100823143-100823165 AAGGGAGGAGAAAGGGAGTAGGG - Intergenic
1132754948 16:1479303-1479325 AAGGGTGGAGGACGGGAGGAGGG + Intergenic
1132997537 16:2830969-2830991 AAGGGAGAAGGTAGGGAGGACGG - Intronic
1133031329 16:3012677-3012699 AAGGGTAAAGGAGGGGAAGATGG - Exonic
1133039937 16:3055270-3055292 AAGGGTGCAGGAAGGGGTGCAGG + Intronic
1133043818 16:3075101-3075123 AAGGGTGCAGGAAGGGGTGCAGG + Intronic
1133204757 16:4226651-4226673 AAGGGTGAATGGAAGGATGATGG + Intronic
1133417285 16:5616532-5616554 GAGGGAGAGGAAAGGGAAGAGGG - Intergenic
1133551158 16:6855802-6855824 AAGGAGGAAGGAAGGGAAGAAGG - Intronic
1133658965 16:7896254-7896276 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1133717893 16:8466918-8466940 AAGGAAGAAGAAAGGAAGGAGGG + Intergenic
1134205559 16:12234992-12235014 AAGGAGGAAGGAAGGAATGAGGG - Intronic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134629566 16:15747099-15747121 AAGGAAGAAGAAAGGAAGGAAGG + Intronic
1135149059 16:19989465-19989487 AAGGAAGGAGAAAGGGAAGAAGG - Intergenic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1135547812 16:23377575-23377597 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1135632625 16:24047962-24047984 AAGGGTGAGGGAAGGGAGGAGGG + Intronic
1135738788 16:24955878-24955900 AAGACTGAAGAAAGGGGTGAGGG + Intronic
1135892655 16:26371497-26371519 AAGGAAGAAGAAAGGGAGGGAGG + Intergenic
1135893062 16:26374460-26374482 AAGGGTGAATGTATGGATGATGG + Intergenic
1135902951 16:26483076-26483098 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1135911329 16:26564087-26564109 GAGGGTGAAGGATGGGGTGAGGG + Intergenic
1135975956 16:27109224-27109246 AAGAGGGAAGGAAGGGAGGAAGG + Intergenic
1136221673 16:28833320-28833342 AAGGGAGAAGACAAAGATGAGGG + Exonic
1136234724 16:28906284-28906306 AACGGGGAAGGAAGGGAGGATGG + Intronic
1136645449 16:31609745-31609767 AAGGGTGCAGAACTGGATGGAGG + Intergenic
1137683343 16:50369271-50369293 AAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1137874679 16:51984613-51984635 GAGTGGGAAGAAAGTGATGAGGG + Intergenic
1137947993 16:52752591-52752613 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
1137977316 16:53042514-53042536 AAAGATGAAGAAAGGGAGGAGGG - Intergenic
1138010158 16:53371992-53372014 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1138894822 16:61190803-61190825 GAAGGGGAAGAAAGGGAAGAAGG - Intergenic
1139039551 16:62984224-62984246 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039568 16:62984285-62984307 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039585 16:62984346-62984368 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039602 16:62984407-62984429 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039651 16:62984593-62984615 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139144766 16:64310032-64310054 AAGCATGAAGAAAGAGAAGAAGG + Intergenic
1139320416 16:66109719-66109741 AAGGGGGAAGGAAGGGAAGAGGG + Intergenic
1139320451 16:66109812-66109834 AAGGGGGAAGGAAGGGAGGAGGG + Intergenic
1139320459 16:66109835-66109857 AAGAGGGAAGGAAGGGAGGAGGG + Intergenic
1139332654 16:66205539-66205561 AAGGGGGAAGACAGGCAGGAGGG + Intergenic
1140018678 16:71215247-71215269 AAGGAGGAAGAAAGGGAGGAAGG + Intronic
1140033083 16:71353974-71353996 AAGGAGGATGAAAGGGATGCAGG - Intergenic
1140263779 16:73403141-73403163 AAGGGTGGAAAAAAGGTTGAGGG + Intergenic
1141012295 16:80414184-80414206 GAGGGTGAAGCTAGGGCTGAAGG - Intergenic
1141782445 16:86172500-86172522 AAGGGAGAAGAAAGAAATGGAGG - Intergenic
1141792311 16:86244994-86245016 AAGGGTTGAGAAAAGGCTGAGGG + Intergenic
1141890307 16:86922091-86922113 AAGGGGAAGGAAAGGGAAGATGG + Intergenic
1143181368 17:4986390-4986412 AAGGATGAGGAAAGGGAGGGAGG + Intronic
1143862662 17:9902130-9902152 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1143913544 17:10272092-10272114 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1143914213 17:10276860-10276882 AAAGGTGAAGGATGGGCTGAAGG - Intergenic
1144135512 17:12291260-12291282 AGGGGTGAAGAAAAGTATCAGGG - Intergenic
1144163905 17:12588923-12588945 AAGGGTGGAGGAAGGGAGGAGGG + Intergenic
1144179417 17:12737810-12737832 TGGGGTGAAGATAGGCATGACGG - Intronic
1144224189 17:13128780-13128802 AAAGGTGAAGGAAAGAATGAAGG - Intergenic
1144307968 17:13986615-13986637 AAGTAAGAAGAAAGGGAGGATGG - Intergenic
1144403418 17:14929020-14929042 AACTGTGAAGAAAAGTATGAAGG - Intergenic
1144409899 17:14990652-14990674 AAGGATGGAGATAGGGATGGGGG + Intergenic
1144512993 17:15893505-15893527 AGGGAGGAAGAAAGGGAGGAGGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1144741414 17:17584608-17584630 AAAGGTAAAGAAAAGGAAGATGG - Intronic
1146182362 17:30706405-30706427 GAGGGTCTAGAAAGGGGTGAGGG + Intergenic
1146834682 17:36100800-36100822 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1146849290 17:36207985-36208007 AAGGGTGAAGGGTGGGAGGAGGG - Intronic
1147481394 17:40767458-40767480 TCTGGTGAATAAAGGGATGAGGG - Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147499503 17:40949112-40949134 AAGGGTGACGAGATGGCTGATGG + Intergenic
1147530172 17:41268987-41269009 AAGAGAGAAGAAAGGAAGGAAGG + Intergenic
1147837877 17:43347910-43347932 GAGGGTGAGGAAAGGCAGGAGGG + Intergenic
1148193991 17:45700171-45700193 AAGGGAGAGGAAGAGGATGATGG - Intergenic
1148525339 17:48327528-48327550 TAAGGAAAAGAAAGGGATGAAGG - Intronic
1148579640 17:48734680-48734702 GAGGGAGGAGAAAGGGAGGAAGG + Intergenic
1148605757 17:48927789-48927811 AAGGGTGAGGAAAGAGGGGAGGG - Exonic
1148713638 17:49700009-49700031 GAGGGTGGAGAAAGGAAGGAAGG + Intergenic
1148872816 17:50668700-50668722 AGGGAGGAAGAAAGGGATGTGGG - Intronic
1149014101 17:51888186-51888208 AAAGGAGAAGAAAGGAAAGAAGG + Intronic
1149084970 17:52705683-52705705 AAGGGTTAAGATAGTAATGATGG - Intergenic
1149278344 17:55071303-55071325 AAGAGTGAATATAGGGATGGAGG - Intronic
1149506458 17:57197959-57197981 AAGCAGGAAGGAAGGGATGAAGG - Intergenic
1149810891 17:59670434-59670456 AAGGGTGGAGGATGGGAGGAGGG - Intronic
1150161357 17:62900923-62900945 AAGGGGCAAGAAGGGGATGAGGG + Intergenic
1150196381 17:63304103-63304125 AAGGGCGCAGAACTGGATGAAGG - Intronic
1150459526 17:65336912-65336934 AAGAGAGAAGAAAGGAAGGAAGG - Intergenic
1150872828 17:68932328-68932350 AAGAGAGAGGAAAAGGATGAAGG - Exonic
1151116851 17:71745945-71745967 AAGGGGGAGGAAAGCAATGAAGG - Intergenic
1151209944 17:72537114-72537136 GAGGGTGAAGATGGTGATGAAGG - Intergenic
1151252510 17:72847466-72847488 AAGGGTCAAGAGGGGAATGAGGG + Intronic
1151304137 17:73252103-73252125 GAGTGGGAATAAAGGGATGAGGG + Intronic
1151338170 17:73452588-73452610 AGGTGTTAGGAAAGGGATGATGG + Intronic
1151552908 17:74832184-74832206 AAGGAGGAAGGAAGGGAGGAAGG - Intronic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1151849027 17:76678794-76678816 AAGGGTGAAGCAAAGGAATATGG - Intronic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1152992615 18:377080-377102 AAAGGGGAGGAAAGGGAAGAGGG + Intronic
1153625075 18:7015756-7015778 AAGTGTGAAGAATGTGAGGATGG - Exonic
1155446248 18:25915834-25915856 CAGGGTGAGGCAGGGGATGAGGG - Intergenic
1155684879 18:28536387-28536409 TAGGGAGAAGGAAGGGAGGATGG + Intergenic
1155712978 18:28905328-28905350 AAGGAAGAAAAAAGGAATGAAGG - Intergenic
1155823839 18:30413495-30413517 GAGGGAGGAGAAAGGGAGGATGG + Intergenic
1155829249 18:30492246-30492268 AGGGAGGAAGAAAGGGAGGAAGG + Intergenic
1156361651 18:36389250-36389272 AAGGGAGAAGAAAGGAAAAAAGG - Intronic
1156529863 18:37805240-37805262 AAGGGTGCAGAACTGGATGGAGG - Intergenic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156635188 18:39019554-39019576 AAGGATCAAGAAAGGCAGGAAGG - Intergenic
1156871620 18:41952049-41952071 AAGGGGGAAGGAAGGAAGGAAGG + Intergenic
1157093102 18:44659820-44659842 AGGGGTGAAAAGTGGGATGATGG + Intergenic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157347308 18:46851334-46851356 AAGGTTGAAGAAAGGAAGAAGGG - Intronic
1157372761 18:47132059-47132081 AAAGGGGAAGCAAGGGAAGAGGG - Intronic
1157392926 18:47317873-47317895 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1157774658 18:50383098-50383120 AAGGGGGAAGAGAGAGAGGATGG - Intronic
1158105520 18:53881840-53881862 AAGGGTGCAGAACTGGATGGAGG - Intergenic
1158281664 18:55834780-55834802 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1159041374 18:63325970-63325992 AAGGGAAAAGGAAGAGATGAGGG - Intergenic
1159155735 18:64579256-64579278 AAGCGTGCAGAACTGGATGAAGG + Intergenic
1159164275 18:64682687-64682709 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1159231527 18:65613351-65613373 AAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1159235166 18:65662115-65662137 AAGGGTGAAGAAGGAAATAAAGG + Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1159487448 18:69082495-69082517 AGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1159646276 18:70921794-70921816 AAGGGTGCAGAACTGGATGGAGG + Intergenic
1159985992 18:74841381-74841403 AGCGGTGAGCAAAGGGATGAAGG - Intronic
1159999543 18:75003516-75003538 AAGGAATAAGAAAGGGAAGAAGG - Intronic
1160105794 18:75974876-75974898 AAGGAAGGAGAGAGGGATGAAGG - Intergenic
1160313339 18:77818532-77818554 AAGAAGGAAGAAAGGGAAGATGG - Intergenic
1160526564 18:79542096-79542118 GTGGGTGAATAAATGGATGAAGG - Intergenic
1160676548 19:394245-394267 AAGGGTGATGGGAAGGATGATGG + Intergenic
1160676628 19:394619-394641 AAGGATGAAGGGAAGGATGATGG + Intergenic
1160676733 19:395088-395110 AAGGATGATGGGAGGGATGATGG + Intergenic
1160695252 19:480823-480845 AAGGATGATGGAAAGGATGATGG + Intergenic
1160695293 19:481051-481073 AAGGATGATGGAAAGGATGATGG + Intergenic
1160695323 19:481201-481223 AAGGATGATGAGAAGGATGATGG + Intergenic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1161445899 19:4318959-4318981 AGGGGAGAAGAAAGGGGAGAGGG + Intronic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1161833359 19:6626975-6626997 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
1161966048 19:7549787-7549809 AAGGGTTAAGAAAAATATGAAGG - Intronic
1162182638 19:8880566-8880588 AAGGGTGCAGAACTGGATGGAGG + Intronic
1162954938 19:14092303-14092325 AAGGGTGAAGACAGGTCTGTTGG + Exonic
1163040081 19:14595611-14595633 AAGGATGAGGAAGGAGATGATGG + Intronic
1163050149 19:14676887-14676909 GACGATGAAGGAAGGGATGATGG + Intronic
1163383555 19:16985318-16985340 AAGGGTGGATGAATGGATGAAGG + Intronic
1163383608 19:16985546-16985568 ATGGGTGGAGAAAGGAAGGAAGG + Intronic
1164508379 19:28877849-28877871 AGAGGTGAAGAAAAGGCTGAAGG - Intergenic
1164521310 19:28982248-28982270 AGGGGTAGAGAAAGGGACGACGG + Intergenic
1164588650 19:29494381-29494403 AAAGGGGAAGAAAGGAAGGAAGG + Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164818745 19:31227562-31227584 AAGGGGGAAGAAAGAGAGGATGG + Intergenic
1164849319 19:31468388-31468410 AAGGGAGCAGGAAGGGAGGAGGG + Intergenic
1164916718 19:32058063-32058085 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
1165497187 19:36160012-36160034 AACGGTGAAGAAGGGGTTGAGGG + Intergenic
1166274269 19:41741176-41741198 AAGGGAGAAGGAAGGGACAATGG - Intronic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1166966015 19:46529621-46529643 AAAGGGAAAGAAAGGGAGGAAGG + Intronic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1168709873 19:58493078-58493100 AAGGGTGCAGTGAGCGATGATGG + Intronic
1168725583 19:58579975-58579997 AAGAGGGAAGGAAGGGAGGAAGG - Intergenic
1202700502 1_KI270712v1_random:160479-160501 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
925062659 2:905144-905166 AAGGGCCAAGGAAGGGCTGATGG + Intergenic
925233052 2:2252818-2252840 AAGGGGGAAGAAAGAGGGGAAGG - Intronic
925447366 2:3939892-3939914 AAGGGCGCAGAACGGGATGGAGG - Intergenic
925692036 2:6535339-6535361 AAGGAAGAAGAAAGGAAAGAAGG - Intergenic
925816609 2:7757795-7757817 AATGTTTAAGAAAGTGATGATGG + Intergenic
925991850 2:9260644-9260666 AAGGGAGAAGAAAGGCAGGAAGG - Intronic
926279974 2:11438132-11438154 AAGGATGAAGAAGGAGAAGAAGG - Intergenic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
926667852 2:15544352-15544374 AATGGTGAAGGGAGGGAGGAAGG + Intronic
927269900 2:21195433-21195455 AAATCTGAAGAAAGGGAAGAAGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927969421 2:27295666-27295688 AAGGGTGCAGTGAGGGATGGAGG + Intronic
928285720 2:29988399-29988421 AGGGGAGAGGAAAGGGAGGAAGG + Intergenic
928498707 2:31863415-31863437 AAGGGAGGGGAAAGGGAGGAAGG + Intergenic
928774836 2:34748358-34748380 GAGGGTGAAGGGTGGGATGAGGG + Intergenic
928886393 2:36153506-36153528 AATGGGCAAGAAAGGAATGAAGG - Intergenic
928910694 2:36417936-36417958 AATGGAGAAGAAAGGCAGGAGGG + Intronic
928994844 2:37277892-37277914 AATGGTGAAGGAAGGGTGGATGG - Exonic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929255311 2:39804516-39804538 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
929447067 2:42010074-42010096 AAGAGAGAAGAAAGGAAGGAAGG + Intergenic
929456990 2:42073030-42073052 GAGGGTGCAGAAAGGGAAGTTGG + Intergenic
929617757 2:43325538-43325560 AAGGAAGAAGAAAGGAAGGAAGG + Intronic
930110547 2:47675321-47675343 AAGGGAGATGGAAGGGAGGAAGG - Intergenic
930581365 2:53216480-53216502 AAGGGTGCAGAATGGGATGGAGG - Intergenic
930648338 2:53936732-53936754 AGGGGGGAAGAAAGGGAAAAAGG + Intronic
930928544 2:56851689-56851711 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931425141 2:62164015-62164037 TAGGGTGGAGAAAGGTATGCTGG + Intergenic
931493076 2:62771010-62771032 AAGGGTGAAGGGTGGGAGGAGGG + Intronic
932363770 2:71132222-71132244 AAGGAAGGAGAAAGGGACGAGGG - Intronic
932464048 2:71902028-71902050 AAGAGTGAAGGAAGGGAGGGAGG - Intergenic
932482531 2:72054990-72055012 AAGGGTGGAGTGTGGGATGAGGG - Intergenic
932486805 2:72089139-72089161 AAGGAAGAAGAAAGGAACGAAGG + Intergenic
932672848 2:73753302-73753324 AAGATTGTAGAAAGGGATAATGG - Intergenic
933101577 2:78265644-78265666 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933180019 2:79216743-79216765 AAGGGTGAAGAAGGGGTTGGGGG + Intronic
933303870 2:80573518-80573540 GAGGGTGGAGCAAGGGAAGATGG - Intronic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933355400 2:81203654-81203676 AAGGGAGAAGTCAGGGATGATGG - Intergenic
934171430 2:89543952-89543974 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934281739 2:91618270-91618292 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934612809 2:95753403-95753425 CAGAGAGAAGAAAGGGATGTGGG + Intergenic
935063286 2:99626527-99626549 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
935100283 2:99988111-99988133 AAGAAGGAACAAAGGGATGAAGG + Intronic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
935501533 2:103846776-103846798 GAGGGAGAAGAAAGGGAGAATGG + Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935665585 2:105509515-105509537 AAGGGTGGAGACAGGAGTGAGGG + Intergenic
935806267 2:106750927-106750949 GAGGGTGAAGCATGGGAGGAGGG + Intergenic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937243963 2:120480382-120480404 ATCGGTGCAGAGAGGGATGACGG + Intergenic
937369724 2:121288847-121288869 TGGGGTGAAGAAAGGAATGCCGG - Intergenic
937378679 2:121355793-121355815 AAGGATTTAGAAAGGGGTGAGGG + Intronic
937501582 2:122484859-122484881 AACGGTACAGAAAGGGAGGAAGG - Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938671209 2:133588458-133588480 AAGGAGGAAGGAAGGGAGGAAGG - Intergenic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
938807408 2:134819171-134819193 GGAGGGGAAGAAAGGGATGAAGG + Intergenic
938811257 2:134855052-134855074 AAGGGAGAGGAGAGGGGTGATGG - Intronic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939167822 2:138658293-138658315 AAGGAAGAAGAAAGGAAAGAAGG - Intergenic
939183637 2:138833679-138833701 AAGGATAAAGAAATGGAAGAAGG - Intergenic
939280459 2:140057874-140057896 AAGAGAGAAAAAAGGAATGAAGG + Intergenic
939633495 2:144552984-144553006 AAGGGAAAAGAAAGGAAGGAAGG + Intergenic
939734379 2:145825908-145825930 AAGGTTGCAGAAAGCGAAGATGG - Intergenic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
939809100 2:146809002-146809024 AAGGGTGCAGAATTGGATGCAGG + Intergenic
939892119 2:147748835-147748857 AAAGATGAAGGAAGGGATGAAGG + Intergenic
939988815 2:148858389-148858411 GAGGGTGGAGAATGGGAGGAAGG + Intergenic
940638599 2:156326644-156326666 AAAGGAAAAGAAAGGGAGGAAGG - Intronic
941125282 2:161576978-161577000 AAAGGAGAGGAAAGGGATGGAGG - Intronic
941235926 2:162973823-162973845 AAGAAGGAAGAAAGGGAGGAAGG + Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941521049 2:166543522-166543544 AAGGGGGAAGGAAGGAAGGAAGG + Intergenic
941621151 2:167781249-167781271 AAGGGTGAAAAAGAGAATGATGG + Intergenic
941749297 2:169118553-169118575 AAGGGTGAAGATGGGCAGGAAGG - Intergenic
941808744 2:169734573-169734595 AAATGCCAAGAAAGGGATGATGG - Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942038073 2:172030540-172030562 AAGGCTGAAGATAGGGTTCATGG - Intronic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
942727731 2:179027872-179027894 TTGGGTGAACAATGGGATGAGGG - Intronic
942793176 2:179784316-179784338 TAGGGGGAAGAATGGGAAGAGGG + Intronic
942826151 2:180179327-180179349 AAAGATGAAGACAGGCATGATGG - Intergenic
943760814 2:191606725-191606747 AAGGATGAAGGAAGGAAAGAAGG - Intergenic
943821644 2:192330509-192330531 AAGGGGGAAGAAAGGAGGGAAGG + Intergenic
945012828 2:205482912-205482934 AAGTCTGAAGAAAGGGGTGGAGG - Intronic
945041277 2:205745670-205745692 AAGGGGAAGGAAAGGGAAGAAGG + Intronic
945155841 2:206836289-206836311 AAGGGTGCAGAAGGGAAAGAAGG + Intergenic
945705526 2:213226689-213226711 AAAGGTGAAGAAAGCTATTAGGG + Intergenic
946053042 2:216880040-216880062 AAGGGGAAAGGAAGGGAAGAGGG + Intergenic
946086128 2:217173875-217173897 AAAGTGGAAGAAAGGGATAAGGG - Intergenic
946135126 2:217639674-217639696 AAAGGAGAAGGAAGGGAAGACGG + Intronic
946228832 2:218279291-218279313 AAAGGTGAAGATAGCAATGATGG + Exonic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946547835 2:220765056-220765078 AAGAGTGAGGAAATGGAGGAAGG - Intergenic
946784721 2:223230922-223230944 AAGGAGGAAGGAAGGGATGGAGG - Intergenic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
946996457 2:225397859-225397881 AGGGATGAAGCAAGGAATGAAGG + Intergenic
947390444 2:229634285-229634307 AAGCTTGGAGAAAGGAATGAAGG - Intronic
947642940 2:231717116-231717138 AAGGGTGAAGGAATGGCTGCTGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947679476 2:232016941-232016963 AAAGGTGAAGGAAGGAAGGAAGG - Intronic
947742144 2:232489567-232489589 GAGGGAGGAGGAAGGGATGAGGG - Intergenic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947796388 2:232896566-232896588 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796460 2:232896736-232896758 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796478 2:232896790-232896812 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796489 2:232896820-232896842 AAGGGTGAGGGTAGGGTTGAGGG + Intronic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948222156 2:236279160-236279182 AAGGGTCAATAAGGGGAAGAGGG - Intergenic
948255690 2:236566986-236567008 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
948361430 2:237423205-237423227 AAGAGGGAAGGAAGGGAGGAAGG + Intronic
1168765323 20:378445-378467 AGGGGTGAAGAAAGGTGGGAGGG - Intronic
1168868601 20:1109830-1109852 ATGAGTGAAAAAAGGCATGAAGG + Intergenic
1169638356 20:7720362-7720384 AAGGGTTAAGAAAGGGCAGCAGG + Intergenic
1169709728 20:8548081-8548103 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1169709755 20:8548238-8548260 AAGGGTGAAAAAGAGGAAGAGGG - Intronic
1169763001 20:9117244-9117266 AAAGGTGAAAAAATGTATGAAGG - Intronic
1170539575 20:17374482-17374504 AAAGGTGAAGAAAAGGCTGGTGG + Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170664425 20:18374543-18374565 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1170680587 20:18522074-18522096 AAGGGAGAAGAAGGGAATGGAGG + Intronic
1170881003 20:20296351-20296373 AGGGATGAAGAAAGGAAAGAAGG - Intronic
1171539816 20:25940055-25940077 AAGGGTGGAGAAAGAAATGGTGG - Intergenic
1171816585 20:29790815-29790837 AGGGATGAAGAAAGGAAGGAAGG - Intergenic
1171842736 20:30235274-30235296 AAGGGTGGAGAAAGAAATGGTGG - Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172274791 20:33673705-33673727 AACGGTGGAGAAAGGGCTCAGGG + Intronic
1172632269 20:36386397-36386419 AAGGAGGAAGGAAGGGAGGAAGG + Intronic
1172778492 20:37422037-37422059 AAGGGTGGAGAAGAGGAGGAAGG - Intergenic
1173138405 20:40460225-40460247 AAGGATGAAGGAAGGAAGGAAGG + Intergenic
1173201693 20:40959633-40959655 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1173297372 20:41771708-41771730 GAGGCTGAAGAAAGGGAAGCAGG + Intergenic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1173618005 20:44415417-44415439 TAGGGGGAAGAAAGGGTTGAAGG + Intronic
1173624460 20:44462084-44462106 AAGGCTGAAGACAGGCAGGAGGG + Exonic
1173717848 20:45225431-45225453 AAGGGAGGAAAAAGGAATGAAGG + Intergenic
1173757645 20:45532067-45532089 AAGGGAGAAGAAAGGGGTGAAGG - Intergenic
1173761555 20:45565030-45565052 AAGGAAGAAGAAAGGAAGGAAGG + Intronic
1174015017 20:47480902-47480924 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1174205808 20:48837667-48837689 GAGGGTGAAGATTGGGAGGAGGG + Intergenic
1174256695 20:49261550-49261572 AAGGGTGGAGGATGGGAGGAGGG + Intronic
1174562657 20:51442617-51442639 ATCAGTGAAGAAAGGCATGAAGG - Intronic
1175070629 20:56330646-56330668 AAGGGAGAAGCAAGGCATGAAGG + Intergenic
1175171810 20:57086165-57086187 AGGGGTGAGGAAAGGTCTGATGG - Intergenic
1175345072 20:58267051-58267073 GAGGGAGAAGAATGGGATGGAGG + Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175986681 20:62767665-62767687 AAGGTTGAAGGAAGGAAGGAAGG + Intergenic
1176266732 20:64213174-64213196 AAGGGAGAGGAAGGGGGTGAGGG + Intronic
1176870115 21:14077230-14077252 AAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1177144976 21:17397734-17397756 AAGGAGAAAGGAAGGGATGAAGG + Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177521401 21:22232652-22232674 AAGAGGGAAGGAAGGGAGGAAGG + Intergenic
1177729837 21:25014647-25014669 AAGTGTGAAGAAATTGAAGAGGG - Intergenic
1177737096 21:25104632-25104654 AAGAGGGAAGGAAGGGAGGAAGG - Intergenic
1177760089 21:25393245-25393267 AAGAAAGAAGAAAGGGAGGAAGG + Intergenic
1177944910 21:27455922-27455944 AAGAAGGAAGAAAGGGAGGAAGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178210247 21:30522558-30522580 GAAGGTGAAGAATGGGAGGAGGG + Intergenic
1178761659 21:35408797-35408819 AAGGAGGAAAAAAGGAATGAAGG - Intronic
1178791599 21:35705221-35705243 AAAGGGGAAGAAAGGAAGGAAGG + Intronic
1179255906 21:39715018-39715040 AAGGGAGAAAAAAGGAAGGAAGG - Intergenic
1179286700 21:39983804-39983826 AAGGGGGAAGGAAGGAAGGAAGG - Intergenic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180104262 21:45607597-45607619 AAGGGAGGTGAAAGGGAGGAGGG + Intergenic
1180104272 21:45607627-45607649 AATGGAGGAGAAAGGGAGGAGGG + Intergenic
1180301475 22:11039903-11039925 AAGGGTGAAGGTTGGGAGGAGGG - Intergenic
1181090542 22:20469486-20469508 CAGGGTGGAGAATTGGATGAGGG + Intronic
1181487628 22:23241543-23241565 AAGGGGCAAGACAGGGAAGATGG - Intronic
1181997583 22:26894850-26894872 GAGGGAGAAGAAAGAGATGGGGG + Intergenic
1182039062 22:27222259-27222281 ATGGGTGAATGAATGGATGATGG + Intergenic
1182103245 22:27671927-27671949 AAGGAGGAAGGAAGGGAGGAAGG + Intergenic
1182240970 22:28915959-28915981 AAGTATGAAGGAAGGGAGGAAGG - Intronic
1182542039 22:31048859-31048881 AAATGAGAAGAAAGGGGTGATGG + Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1182722156 22:32411922-32411944 AGGGGAGAAGGACGGGATGAGGG + Intronic
1182732065 22:32503722-32503744 AAGGGTGAAGAAGAGGTTGAGGG - Intergenic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183625342 22:38998037-38998059 AAGGGTGAAGGAAGGAAGGGAGG - Intergenic
1183625492 22:38999145-38999167 AAGGGTCAAGGAAGGGAGGGAGG - Intergenic
1184001172 22:41674708-41674730 AAGGGAGGATAAAAGGATGAAGG + Exonic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184312148 22:43653082-43653104 AAGAGTGAAGAGAGGCATGTGGG + Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184942830 22:47781511-47781533 TGGGGTGAAGAACGCGATGAGGG + Intergenic
1185135775 22:49071271-49071293 AAGGAAGAAGAAAGGAAGGAAGG - Intergenic
1185352949 22:50347483-50347505 CAGGCTGAAGGAAGAGATGATGG - Intronic
1185358184 22:50387725-50387747 AAGAGGGAAGAGAGGTATGAGGG + Intronic
949457096 3:4250274-4250296 AAGGGGGAAGGAAGGGAAGAGGG + Intronic
949516382 3:4810943-4810965 AAGGGAGAGGAAAGTGATGAGGG - Intronic
949563965 3:5228371-5228393 AAGGAGGAAGAAAGGGAAAAAGG - Intergenic
949572184 3:5304089-5304111 AAGGCTGAAGGAGGGGATGGGGG + Intergenic
950284231 3:11732283-11732305 AAGAAAGAAGAAAGGGAGGAAGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950563575 3:13750286-13750308 AAAGGTGAAGCAAGGAGTGAGGG + Intergenic
950853503 3:16084644-16084666 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
951305921 3:21062225-21062247 AAATGTGAAGTAAGAGATGAAGG + Intergenic
951708664 3:25568498-25568520 AAGGGGGAAGAAAGGAAAAAAGG - Intronic
951843620 3:27061892-27061914 AAAGGTGAGGCCAGGGATGAGGG - Intergenic
952020475 3:29012939-29012961 AGGGAAGAAGAAAGGGAGGAAGG + Intergenic
952546362 3:34423962-34423984 AACAGTGAAGACAGGGATGATGG - Intergenic
952674687 3:36013400-36013422 AAGAGAGAAGAAAGGGAAGAAGG + Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953125156 3:40085733-40085755 AAGGAAGAAGAAAGGAAGGAAGG + Intronic
953223262 3:40993185-40993207 AAGAATGAAGAAAGGAAGGAAGG - Intergenic
953312186 3:41890841-41890863 AGGGGGGAAGGAAGGGATGCGGG + Intronic
953357398 3:42266561-42266583 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
953571604 3:44076018-44076040 CAGGGTGAAGGAGGGGATAAGGG + Intergenic
953611183 3:44448912-44448934 AAGGGAGAAGAAAAGCAAGATGG + Intronic
953624143 3:44556939-44556961 AGGGTTGGAGAAAGGGGTGATGG - Exonic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953708155 3:45246625-45246647 AAGGGTGAAGGCACAGATGAAGG + Intergenic
953811594 3:46117318-46117340 AAGGGGCAACAAAGGGATTAGGG - Intergenic
954072235 3:48151409-48151431 AAAGGGGAAAAAAGGGAAGAGGG - Intergenic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954630058 3:52043224-52043246 AAGAGGGAAGGAAGGGAGGAAGG + Intergenic
954725408 3:52604626-52604648 AAGGGTGCAGTAAGTTATGATGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
954987565 3:54809267-54809289 AAGAGAGAAGAAAGAGATAAAGG - Intronic
955483673 3:59414497-59414519 AAGGGTGAAGAAGGGGGTTAAGG - Intergenic
955695580 3:61632789-61632811 GAGGGGGATGAAGGGGATGAAGG - Intronic
955889247 3:63632385-63632407 AAGAAGGAAGAAAGGGAAGAAGG + Intergenic
956327266 3:68067746-68067768 AAGAGGGAAGAAAGGAAGGAAGG - Intronic
956665420 3:71637561-71637583 AAGGGAGAAGGAAGGAAGGAAGG + Intergenic
956729353 3:72182666-72182688 AAGGAAGATGAAAGAGATGAAGG + Intergenic
956873820 3:73442974-73442996 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
957141592 3:76365983-76366005 AAGGGAGAGGAAGGTGATGAGGG - Intronic
957164592 3:76655767-76655789 AAGAAGGAAGGAAGGGATGAAGG + Intronic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957268756 3:78002541-78002563 AAGGGTGCAGAACTGGATGGAGG - Intergenic
957561932 3:81833049-81833071 AAGGGCGAAGGAAGGAAGGAAGG - Intergenic
957794186 3:84981655-84981677 AAGGAGGAAGAAAGGAAAGAAGG - Intronic
957884998 3:86275447-86275469 AAGGAAGAAGAAAGGGAGAAAGG - Intergenic
959030964 3:101299410-101299432 AAGGGTGAAGAACTGGATGGAGG - Intronic
959106871 3:102074843-102074865 GAGGGTGAAGAAAGAGATTTTGG - Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
960051888 3:113247157-113247179 AGGGAGGAAGAAAGGGAAGAAGG - Intronic
960375008 3:116890080-116890102 AAGGGTGCAGAAACGGATCCAGG - Intronic
960413857 3:117359850-117359872 AAGGGTGCAGAACTGGATGGAGG + Intergenic
960442814 3:117710214-117710236 AGGAGTGGAGAAAGGGAGGACGG - Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
961167698 3:124774929-124774951 AAAGGTGAAGCAATGGTTGATGG + Intronic
961340182 3:126212492-126212514 AAGAGGGAAGGAAGGGAGGAAGG + Intergenic
961660261 3:128464894-128464916 AAGGAAGGAGAAAGGGAGGAAGG - Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962074967 3:132072017-132072039 AAGGATGAAGACGGGGCTGATGG - Intronic
962319288 3:134377428-134377450 AGGGGAGGAGAAAGGGGTGAAGG - Intergenic
962520871 3:136196351-136196373 AAGGGAGAGGAAAGGGGGGAGGG - Intronic
962679088 3:137780377-137780399 GGGGGAGAAGAAAGAGATGACGG - Intergenic
962695685 3:137945121-137945143 AGGGATGAAGAAAAGGATAAAGG - Intergenic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
963180914 3:142355077-142355099 ATGGGGGAAGATAGGGAGGAGGG + Intronic
963263554 3:143216717-143216739 AATGATGAAGGAAGGGAGGAGGG - Intergenic
963350402 3:144144557-144144579 AAGGGAGAAGAATGGGATTGGGG - Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963632097 3:147746242-147746264 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
963638163 3:147825413-147825435 AGGGGGGAAGGAAGGGAGGAAGG - Intergenic
963772899 3:149407101-149407123 AAGAAGGAAGAAAGGGAAGAAGG + Intergenic
964053376 3:152422221-152422243 AAGGGAAAATAAAGGGATGGAGG + Intronic
964330142 3:155593165-155593187 AAAGGTGAAGAAGGGAATCAAGG + Intronic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
964926915 3:161970196-161970218 TAGGAAAAAGAAAGGGATGAAGG - Intergenic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965280740 3:166748854-166748876 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
965463608 3:168999963-168999985 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
965929341 3:174023455-174023477 AAGGGTGAAGAATGGGATATGGG + Intronic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966263692 3:178011906-178011928 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
966492961 3:180549867-180549889 AAGGAACAAAAAAGGGATGATGG + Intergenic
966640761 3:182187191-182187213 AAGGGAGAAGGAAGGAAGGAAGG + Intergenic
966746150 3:183279516-183279538 CAGGGTGAAGGAAGGGAAAAAGG - Intronic
966869164 3:184278715-184278737 AAAGGGGAAGAAAGGGAGGGAGG - Intronic
967076193 3:186004708-186004730 AAGGGTGAAGGTTGGGAGGAGGG - Intergenic
967410444 3:189161611-189161633 AAGAGTGAAAAAATGGATAAAGG - Intronic
967605359 3:191438541-191438563 AAGAGAGAAGAAAGGAAGGAAGG - Intergenic
968159984 3:196418284-196418306 AAGAGAGAAGGAAGGAATGACGG + Intronic
968598469 4:1497552-1497574 ATGGATGAAGATATGGATGATGG + Intergenic
968914198 4:3490065-3490087 GGGGGTGAAGAAAGGAATGGGGG - Intronic
969508773 4:7605230-7605252 AGGGGTGAAGAAAGGCATGGTGG + Intronic
969571697 4:8012577-8012599 ATGGGTGAAGAATGGGTGGATGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969709005 4:8831997-8832019 AAGGGTGCAGGAAGGGAAAACGG + Intergenic
969920060 4:10530026-10530048 AAGGTGAAAGAAAGGGAGGAAGG - Intronic
969996139 4:11315232-11315254 AAAGGAAAAGAAAGGAATGAAGG + Intergenic
970125954 4:12811520-12811542 AAGAGTGAAGAAGGGGAACAAGG - Intergenic
970148150 4:13058769-13058791 AAGGGTGAAGGAAGGCAGAAAGG - Intergenic
970234227 4:13942282-13942304 ATGGGAGAAGAATGGGATTAGGG + Intergenic
970369620 4:15393961-15393983 AAGGGGGAAGTAAGGGCAGAGGG + Intronic
970396270 4:15670451-15670473 AAGGATGAAAAAAGATATGATGG - Intronic
970476063 4:16424608-16424630 AATGGTTAAGAAAGAAATGAAGG - Intergenic
970689969 4:18611596-18611618 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
970689998 4:18611691-18611713 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
970690076 4:18611913-18611935 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
970690133 4:18612056-18612078 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
970690162 4:18612151-18612173 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
970690219 4:18612294-18612316 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
970690248 4:18612389-18612411 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
971472647 4:27043379-27043401 AAGGGTGAAGGACTGGATCAGGG - Intergenic
971596834 4:28540281-28540303 AAGGGGAAAGAAAGGTAGGAGGG - Intergenic
971865166 4:32160501-32160523 AAGGAGGAAGGAAGGGATGTAGG - Intergenic
972103205 4:35447732-35447754 AAGAGGGAAGGAAGGAATGAAGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972438694 4:39061941-39061963 AAGGGAGAAGATAGAGGTGAAGG + Intronic
972491089 4:39587768-39587790 AAGGAAGAAGAAAGGAAAGAGGG + Intronic
972896956 4:43634270-43634292 AATTGAGAAAAAAGGGATGAGGG + Intergenic
972924235 4:43983882-43983904 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
973105761 4:46335154-46335176 AAGGGAAAAGAAAGGAATGGAGG + Intronic
973553214 4:52056138-52056160 AAGAGTGAGGAGAGGGCTGAGGG - Intronic
973555441 4:52077196-52077218 AAGGAGGAAGAAAGGGAAGGAGG - Intronic
973567603 4:52204007-52204029 AAGGGAGGATAAAGGGAAGAAGG - Intergenic
973632561 4:52833122-52833144 AAGAGTGAAGGAAGGAATCAAGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
974183342 4:58412141-58412163 AAGGGAGAAGAAAGAGAAGAAGG - Intergenic
974247611 4:59340740-59340762 AAGGGAGAAGGGAGGGAGGAAGG + Intergenic
974552649 4:63398142-63398164 AAGGGTGGAGAATGGGAGGGGGG - Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
975088037 4:70366779-70366801 TAGGGTGGAGAAAGGGGTGGTGG - Exonic
975708392 4:77134110-77134132 AAGGATGAAGAAAGAGAAGGAGG + Intergenic
976122935 4:81802815-81802837 AATGATGAATAAACGGATGAAGG - Intronic
976279777 4:83315878-83315900 AAGAATGAAGAAATGGAGGAAGG - Intronic
976738280 4:88332899-88332921 AAGAGAGAAGGAAGGAATGAAGG - Intergenic
976784495 4:88802681-88802703 AGGGGAGAAGAAAGGGATGCAGG - Intronic
976821754 4:89214669-89214691 AAGCCTAAAGAAAGGGAGGAAGG - Intergenic
977175286 4:93812661-93812683 AGGGGTGAGGGAAGGGTTGATGG - Intergenic
977872439 4:102108076-102108098 GAGGGTGGAGGATGGGATGAGGG - Intergenic
977899423 4:102402275-102402297 ATGGATGAAGAAAGGAAGGAAGG + Intronic
978399110 4:108312343-108312365 AAGAGTGAAGGAAGGAAGGAGGG + Intergenic
978592883 4:110345199-110345221 AAGGGGGAAGAAAGGAAAGAAGG - Intergenic
978782386 4:112569538-112569560 AAGAGTAAGGAAAGGGATCAGGG + Intronic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979502173 4:121453236-121453258 AAGGAAAAAGAAAGGGAAGAAGG + Intergenic
979710357 4:123772098-123772120 AGGAATGAAGAAAGGAATGAAGG - Intergenic
979871435 4:125828075-125828097 AAGGGGGAAGGAAGGAAGGAAGG + Intergenic
980273981 4:130623807-130623829 AAGGGTGGAGGGTGGGATGAGGG + Intergenic
980690551 4:136290861-136290883 AAGGGAGGAGAGAGGAATGATGG + Intergenic
980846264 4:138329277-138329299 AAGGGAAAGGAAAGGAATGAAGG + Intergenic
980940344 4:139268132-139268154 AAGGGGGAAGGAAGGGAGGGTGG + Intronic
981099965 4:140818735-140818757 AAGGTTGGAGAAAGGGGAGAAGG + Intergenic
981183241 4:141770084-141770106 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
981351314 4:143733188-143733210 GAGGGTGGAGAATGGGAGGAAGG - Intergenic
981713191 4:147728957-147728979 TGGGCTGAAGAGAGGGATGAGGG - Intergenic
981939792 4:150270572-150270594 AAGGGTCTGGAAATGGATGATGG + Intronic
981992832 4:150943766-150943788 ACTGGTTCAGAAAGGGATGAGGG - Intronic
982286358 4:153739937-153739959 AAAGGAGAAGAAAGAGATAATGG - Intronic
982396931 4:154923587-154923609 AAGGGTGAAGAAGGGGTTGGGGG + Intergenic
982670479 4:158314260-158314282 AAGGGTGAGTAAAGGGACTAGGG - Intergenic
982787753 4:159556198-159556220 AAGGGGGAAAGAAGGAATGAAGG - Intergenic
982979002 4:162106589-162106611 TAGTGAGAAGAAAGGGATAATGG + Intronic
983012541 4:162564887-162564909 AAGGGAGAAGGAAGGAAGGAAGG + Intergenic
983136970 4:164096415-164096437 AAGGAGGAAGAAAGGAAGGAGGG + Intronic
983295462 4:165862161-165862183 AAAGATGAAGAAAGGGAGAAAGG + Intergenic
983500940 4:168499241-168499263 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
983575426 4:169256280-169256302 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
983795156 4:171853347-171853369 AAGGGGAAAGAAGGGGAGGAAGG - Intronic
984201839 4:176731776-176731798 AACTGTTAAGAAAGGGATGATGG + Intronic
984212184 4:176863453-176863475 AAGTGTGAAGGGTGGGATGAGGG + Intergenic
984215876 4:176911781-176911803 AAGGGTGTAGAACTGGATGGAGG + Intergenic
984486693 4:180379162-180379184 AAGGATGAAGGAAGGAAGGAAGG - Intergenic
984817333 4:183850846-183850868 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817343 4:183850906-183850928 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817346 4:183850918-183850940 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817349 4:183850930-183850952 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817401 4:183851295-183851317 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817404 4:183851307-183851329 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817407 4:183851319-183851341 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817432 4:183851483-183851505 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817448 4:183851579-183851601 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817455 4:183851615-183851637 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817473 4:183851723-183851745 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817486 4:183851807-183851829 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817498 4:183851867-183851889 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817509 4:183851927-183851949 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817523 4:183851999-183852021 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817526 4:183852011-183852033 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817536 4:183852071-183852093 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817539 4:183852083-183852105 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817542 4:183852095-183852117 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817545 4:183852107-183852129 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817554 4:183852155-183852177 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817557 4:183852167-183852189 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817560 4:183852179-183852201 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817567 4:183852215-183852237 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817570 4:183852227-183852249 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817573 4:183852239-183852261 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817588 4:183852323-183852345 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817599 4:183852395-183852417 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817613 4:183852479-183852501 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817616 4:183852491-183852513 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817619 4:183852503-183852525 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817622 4:183852515-183852537 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817625 4:183852527-183852549 AAGGATGAGGGAAAGGATGAGGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
985819924 5:2152847-2152869 AAGGAAGAAGAAAGGGATGGAGG - Intergenic
986313611 5:6571827-6571849 AAGGAGGAAGAAAGGGAGGGAGG + Intergenic
986321647 5:6636690-6636712 AAAGGTGAAGGAAGGGATAGAGG + Intronic
986581197 5:9267645-9267667 AAGAGTGAAGAAAGAGACCAGGG - Intronic
986987155 5:13513006-13513028 TAGGGAGAAGAAAGTAATGAGGG + Intergenic
987008733 5:13738170-13738192 ATGGGTGATTAAAGGGATGCTGG - Intronic
987182231 5:15379838-15379860 AAGGAAGAAGAAAGGAAGGAAGG + Intergenic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987620283 5:20331325-20331347 AAGAAAGAAGAAAGGAATGAAGG - Intronic
987661695 5:20886415-20886437 GAGGGTGAAGGATGGGAGGAAGG + Intergenic
987856045 5:23422221-23422243 AAGGGGAAAGAAAGTGATGAGGG + Intergenic
987946527 5:24616432-24616454 AAAGGTAAAAAAAGGAATGAAGG + Intronic
988030297 5:25755279-25755301 AGGTGTGAAGAAAGTTATGAAGG - Intergenic
988659709 5:33252163-33252185 AGGGAGGAAGAAAGGGAAGAAGG + Intergenic
988671394 5:33385574-33385596 ATGTGTGAAGAAAGGAATGAAGG - Intergenic
988978837 5:36543413-36543435 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989133037 5:38126257-38126279 AGGGGTAAGGAAAGGGAAGAGGG + Intergenic
989180329 5:38569908-38569930 AAGGGGGAATAAAATGATGAGGG - Intronic
989290852 5:39763528-39763550 GAGAGTGAAGAGTGGGATGAGGG - Intergenic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989753654 5:44925089-44925111 GAGGGTGAAGAATGTGATCAAGG + Intergenic
989788760 5:45365337-45365359 AAGGGTGGAGAATGGGAGGTGGG - Intronic
990539216 5:56755675-56755697 GAGGGTGAAGGATGGGAAGAGGG + Intergenic
990691381 5:58368025-58368047 CAGTGTGAATAATGGGATGATGG + Intergenic
990848430 5:60172611-60172633 AAGTTTAAAGAAAGGGTTGAGGG + Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991036765 5:62135207-62135229 AAGGGTGAAGCCAGGGAAGCGGG + Intergenic
991177144 5:63702302-63702324 AAGGGTGAAGGACTGGAGGAGGG + Intergenic
991252915 5:64583493-64583515 GAGGGAGAAGAAAGAGAGGAGGG + Intronic
991302180 5:65139602-65139624 AAGGGTGGAGGAAGGGAGGAAGG - Intergenic
992116242 5:73540890-73540912 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
992141575 5:73802300-73802322 AAGTGTACAGAATGGGATGAAGG + Intronic
992321709 5:75619813-75619835 AAGGAAGAAGGAAGGGAGGAAGG - Intronic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
992523816 5:77585818-77585840 TGGGGGGAAGAAAGGGAGGAGGG + Intronic
993146815 5:84104228-84104250 GAGGGTGAAGGATGGGAGGAGGG + Intronic
993360130 5:86964735-86964757 AAGGATGAAAGAAGGGAAGAGGG + Intergenic
993481757 5:88432250-88432272 AAGGATAAAGAAATGGATGAAGG - Intergenic
993540046 5:89138124-89138146 AAGGGGGAAGGATGGGAGGAGGG - Intergenic
994030471 5:95136158-95136180 AAGGTTGAAGAGAGGGAGAAGGG - Intronic
994043307 5:95283337-95283359 AAGGTTTAAGAAAGGGGTGCCGG + Intronic
994048438 5:95335225-95335247 AAGGGAGAAGGAAGGAAGGAAGG - Intergenic
994203851 5:97010175-97010197 AGGGAGGAAGAAAGGGAAGAGGG - Intronic
994573210 5:101540037-101540059 AAGGGTGAAGAGTGAGAGGAGGG + Intergenic
994574711 5:101563342-101563364 AGGGGTAAAGAAAAGTATGACGG + Intergenic
995549753 5:113269084-113269106 GATGGAGAAGACAGGGATGAAGG + Intronic
995701115 5:114937071-114937093 AAGGCTGAGAAAAGGGAAGAAGG + Intergenic
995745503 5:115398421-115398443 AAGGGTGGAGAGTGGGAAGAGGG - Intergenic
995955891 5:117776010-117776032 AAGGGTTAGGAAGGGGGTGAAGG + Intergenic
996189014 5:120515489-120515511 ACTGGTGAAGAAAGGGATGATGG + Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
996372835 5:122771558-122771580 AAGGGTGTAGAAAGTTGTGATGG - Intergenic
996393324 5:122987158-122987180 GAGGGTGGAGGAAGGGATGAGGG + Intronic
996498884 5:124194068-124194090 AAGGGTCTGGAAAGAGATGACGG - Intergenic
996686506 5:126287371-126287393 AAGGGTTGAGAATAGGATGAGGG + Intergenic
996781310 5:127189689-127189711 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
996938706 5:128977501-128977523 AAGGGAGAAGATGGAGATGAGGG + Intronic
997181735 5:131836041-131836063 AAGGGTGGAGAGTGGGAGGAGGG - Intronic
997242198 5:132315615-132315637 CAGGGTGAAGAAGGGTAAGAGGG + Intronic
997407159 5:133659897-133659919 TAGAGAGAAGAAAGGGATTAAGG + Intergenic
997667286 5:135641821-135641843 CATGGTGATGAAGGGGATGATGG - Intergenic
997725144 5:136114043-136114065 AAGGGTGAGGGCAGGGATGGAGG - Intergenic
997746195 5:136302317-136302339 AAGGGTGAAGAAGGGATTGAGGG - Intronic
997746213 5:136302378-136302400 AAGGGTGAAGAAGGGGTTGAGGG - Intronic
997981182 5:138468087-138468109 AAGGGGAAAGAAAGGGAAAAGGG + Exonic
998444416 5:142187603-142187625 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
998644733 5:144049209-144049231 AAGGGCTCAGAAATGGATGAAGG + Intergenic
998787234 5:145726207-145726229 AAGAGAGAAGAAAGGAAGGAAGG + Intronic
999310820 5:150550792-150550814 AAGGCTGAAGAGATGGATGTGGG - Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999691418 5:154149073-154149095 AAGGAGGAAGAAAGGAAGGAAGG + Intronic
999751647 5:154632124-154632146 AAGGTTTAAGAAAGGGAGGGAGG - Intergenic
999803926 5:155064484-155064506 AAGGGTGGAGCAAGCGATGCTGG - Intergenic
999892700 5:155996270-155996292 GAGGGTGAAGGATGGGAGGAGGG - Intronic
999945474 5:156590850-156590872 AAGGGGAAGGAAAGGGATAAAGG - Intronic
1000023292 5:157337526-157337548 AAGTGTGCAGAAATGGTTGAAGG - Intronic
1000147592 5:158468364-158468386 AAGGGGGAAGTAAGGCAGGAAGG - Intergenic
1000209833 5:159098794-159098816 AAGGGGGGAGAAAGGAAAGAAGG + Intronic
1000240280 5:159402604-159402626 AAGGATGAAGAAAAGCATGAAGG - Intergenic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000473632 5:161677605-161677627 AATGGTAAAGAATGGGATCAGGG - Intronic
1000606433 5:163332405-163332427 AATGGGGGAGAAAGGTATGAAGG - Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000812096 5:165875732-165875754 AAGGAGGTAGAAAGGGTTGAGGG - Intergenic
1000906854 5:166974772-166974794 ACCGGTTAAGAAAGGCATGAAGG - Intergenic
1000914591 5:167064896-167064918 GAGAGTAACGAAAGGGATGAAGG + Intergenic
1000932965 5:167274158-167274180 CAGGGTTAAGAAGGGTATGATGG - Intergenic
1000974984 5:167754892-167754914 AAGGGAGCAGAAAGGGAGGAGGG + Intronic
1001000780 5:168004948-168004970 GAGGGTGGAGATGGGGATGAGGG - Intronic
1001355773 5:171021789-171021811 AAGGGTGCAGAACTGGATGAAGG - Intronic
1001415250 5:171541092-171541114 AAGGGGGAAGAAAGAAAAGAAGG + Intergenic
1001420040 5:171579290-171579312 AAGGGTCAGGAAGGGGAAGAGGG - Intergenic
1001938786 5:175726812-175726834 AAGGTGGAAGACAGGGAGGAGGG + Intergenic
1002021777 5:176368227-176368249 AAGGGAAAAGAAGGGGATGGGGG + Intronic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1003279278 6:4677752-4677774 AAGGGGGAAGACAGGAATGGAGG + Intergenic
1003513906 6:6803008-6803030 AAGGGTGAGGAAGGTGAGGACGG + Intergenic
1003745769 6:9000304-9000326 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1004001482 6:11600813-11600835 AAGGAAGAAGAATGGGAAGAAGG - Intergenic
1004114298 6:12750550-12750572 AGGGGGGAAGGAAGGGAGGAGGG + Intronic
1004305543 6:14498657-14498679 AAGTGGGAAGGAAGGGAGGAAGG - Intergenic
1004337303 6:14775912-14775934 AAGGGTCAGGAAAGGGATTCTGG - Intergenic
1004345374 6:14844385-14844407 AACGGTGATAAAAGGGGTGAGGG - Intergenic
1004422779 6:15486683-15486705 AGAGATGAAGAAAGGGATGATGG - Intronic
1004516975 6:16328509-16328531 AAGGGAGGAGAAAGGGAAGGAGG + Intronic
1004528870 6:16435462-16435484 GAGGGGCCAGAAAGGGATGATGG + Intronic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004682119 6:17906383-17906405 AAGGGGGAAGAAAGGAAGGCAGG - Intronic
1004751465 6:18566148-18566170 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
1004867297 6:19866712-19866734 TAAGGTGAAGAAAGCGAAGAAGG + Intergenic
1005024023 6:21445704-21445726 AAGGGGAAAGAAAGGAAGGAGGG - Intergenic
1005170744 6:22981428-22981450 AAGGGTGCAGAACTGGATGGAGG + Intergenic
1005410371 6:25539025-25539047 TAGGGTGAAGTAAGGGGTCAGGG - Intronic
1005437670 6:25832427-25832449 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
1005500609 6:26426104-26426126 AAGGAAGAAGAAAAGGATGAGGG - Intergenic
1005505137 6:26463094-26463116 AAGGAAGAAAAAAAGGATGAGGG - Intronic
1005528172 6:26673190-26673212 AAGGAGGAAAAAAGGGAAGAAGG - Intergenic
1005542623 6:26828449-26828471 AAGGAGGAAAAAAGGGAAGAAGG + Intergenic
1005868764 6:29957709-29957731 ATGGGTAAGGAAGGGGATGAGGG + Intergenic
1005943276 6:30577413-30577435 AGTGGTGAAGAAAGGGAAGAAGG + Exonic
1006088968 6:31616600-31616622 AAGGATGGAAGAAGGGATGATGG - Intronic
1006253680 6:32812497-32812519 AAGGGGGAAAAAAAGGCTGATGG + Intergenic
1006591132 6:35158585-35158607 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1007133777 6:39501081-39501103 AAGAATGAAGAAAAGGGTGACGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007377435 6:41466515-41466537 AAAGGGGAAGAAAGGAAGGAAGG + Intergenic
1007781687 6:44258024-44258046 AAGGATGAGTAAAGGGATGGGGG - Intergenic
1007791936 6:44314493-44314515 AAGGGAGAAAAAGGGGATCATGG - Intronic
1008327141 6:50196280-50196302 AAAAGTGGAGCAAGGGATGAGGG + Intergenic
1008330608 6:50240439-50240461 AAGGGTGAGCAAAGCGAAGAGGG + Intergenic
1008333513 6:50271934-50271956 AAGAGGGAAGGAAGGGAGGAAGG + Intergenic
1008395983 6:51007348-51007370 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1008419711 6:51284017-51284039 GAGGGAGAAGGGAGGGATGAAGG + Intergenic
1008863190 6:56176642-56176664 AAGGAGGAAGAAAGGAAGGAAGG + Intronic
1009013438 6:57870566-57870588 AAGGAGGAAAAAAGGGAAGAAGG + Intergenic
1009213802 6:60894986-60895008 AAGGATGAAGAGAGAGATGGGGG + Intergenic
1009735183 6:67667467-67667489 AAGTGTTAAGAAAGTGGTGATGG - Intergenic
1010089315 6:71961348-71961370 TAGGGTGAGGAAGGGGAAGACGG - Intronic
1010192693 6:73209907-73209929 AATGGAGAAGACAAGGATGAAGG + Exonic
1010192698 6:73209919-73209941 AAGGATGAAGGAGGGGATGTGGG + Exonic
1010196239 6:73242369-73242391 AAGGATGAAGAAGGGGACGTGGG + Intronic
1010201800 6:73288719-73288741 AAGGCTGTAGAAGGGTATGATGG + Intronic
1010385691 6:75277051-75277073 AAGAATGAAGGAAGGGTTGATGG - Intronic
1010403478 6:75475435-75475457 AATGGTGGAACAAGGGATGATGG - Intronic
1010467083 6:76180732-76180754 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1010743125 6:79530356-79530378 AAGGGTGAAGGGTGGGATGAGGG + Intronic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1011346555 6:86375902-86375924 AAAGGTGAAGGAAGGGGTGCTGG - Intergenic
1011417422 6:87137278-87137300 AAGGGGGAAGGAGGGGACGAGGG - Intergenic
1011602297 6:89070867-89070889 AAGAAGGAAGAAAGGGAGGAAGG + Intergenic
1011870244 6:91884241-91884263 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1012123096 6:95391489-95391511 ATGGGTGAGTGAAGGGATGAAGG + Intergenic
1012398059 6:98822516-98822538 AAGAGTGAGGAAAGGGCTGGAGG + Intergenic
1012733322 6:102909070-102909092 AAAGGTGAGGAAATGGTTGAAGG - Intergenic
1012840526 6:104323874-104323896 GAGGGTAAAGAACGGGAGGAGGG + Intergenic
1012875805 6:104724300-104724322 AAGGCTCAAGAAAGGGGTGTTGG - Intergenic
1012943158 6:105438527-105438549 AAGGGTGAAGAAGGGTGAGAGGG - Intergenic
1013176973 6:107686161-107686183 AAAGGTGAAGGAAGTGAAGATGG + Intergenic
1013461097 6:110376304-110376326 AAAGGAGAAGGAAGGGAGGAGGG + Intergenic
1013885250 6:114957049-114957071 AAGGAAGAAGAAAGGAAGGAAGG - Intergenic
1013964990 6:115944868-115944890 GAGGGTGAAGGTAGGGAGGAAGG - Intronic
1014395784 6:120925781-120925803 AAGGGTGAAGAAGGGGTTGGGGG - Intergenic
1014471531 6:121821178-121821200 AAAAATGAAGAAAGGGAAGAGGG - Intergenic
1014567220 6:122964355-122964377 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1014745284 6:125193317-125193339 GAGGGAGAAGGAAAGGATGAGGG - Intronic
1014760677 6:125353381-125353403 AAGGGTGAGGAAAAGGAAGAAGG + Intergenic
1015048731 6:128813002-128813024 AAAGGTGATGATAGGTATGATGG - Intergenic
1015086868 6:129305282-129305304 AAGGGAGATGAAATAGATGATGG - Intronic
1015414648 6:132934557-132934579 AGGGGAGAAGACAGGGAAGAAGG + Intergenic
1015424395 6:133049261-133049283 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1016317689 6:142808438-142808460 AGAGATGAAGAAAGGGATGGAGG + Intronic
1016437824 6:144056064-144056086 TGGGATGGAGAAAGGGATGAGGG - Intronic
1016616400 6:146053570-146053592 AAGGATGAATAAAGGACTGATGG + Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016853047 6:148640714-148640736 AAGGGTGAAGAAGGGGTTGGGGG - Intergenic
1017254488 6:152317518-152317540 GAGGGTGAAGGAAGGGATAGAGG - Intronic
1017586394 6:155929782-155929804 ATGGGAGAAGAAAGGGAAAAAGG - Intergenic
1017795496 6:157840451-157840473 AAGGGAGAAGGAAGGAAGGAAGG - Intronic
1018192485 6:161322292-161322314 AAGGGTGCAGTAAGCCATGATGG + Intergenic
1019059829 6:169248997-169249019 AAGGGTGACGTAGGGGAAGAGGG + Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019483495 7:1277054-1277076 GAGGGAGAAGGAAGGGAAGAGGG - Intergenic
1019860140 7:3650709-3650731 AGGGCTTAAGAAGGGGATGAGGG - Intronic
1020026837 7:4905424-4905446 GAAGGGGAAGAAAGGGAAGAAGG + Intergenic
1020459445 7:8412459-8412481 AAGGATGAAGCAAGGGAAAAGGG + Intergenic
1020741341 7:12022726-12022748 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1020986333 7:15139505-15139527 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021015609 7:15527435-15527457 ATGAGGGATGAAAGGGATGAGGG + Intronic
1021397652 7:20170022-20170044 AAGGGTGAAGAATAGGATACAGG - Intronic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021450554 7:20779593-20779615 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1021470871 7:21001339-21001361 AGGGGAGAAGAAAGGGAAGAAGG + Intergenic
1021483450 7:21143597-21143619 AAGGATAAAGAAAGAGAAGAAGG + Intergenic
1021779932 7:24094076-24094098 AAGGGTGAAGAATGGGAGAAAGG - Intergenic
1021818127 7:24468083-24468105 AAGGATGGAGGAAGGGAAGAAGG - Intergenic
1021822765 7:24514768-24514790 AAGAATGAAGAAATGAATGAGGG - Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021906256 7:25336785-25336807 GAGGGAGAAGACAGGGATGCGGG + Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1021971102 7:25966768-25966790 AAGGAAGAAGAAAGGGATGGAGG + Intergenic
1022330234 7:29371789-29371811 AATGGAGGAGAAAGGGGTGAGGG - Intronic
1022600915 7:31758802-31758824 AATGGTGTAGAAAGGGGAGAGGG + Intronic
1022903276 7:34831469-34831491 AGGGGGGAAGAAAGGGAGGGAGG + Intronic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023234720 7:38072812-38072834 AAGGGTGGAGATTGGGAGGAGGG - Intergenic
1023470779 7:40516004-40516026 AAGAAAGAAGAAAGGGAAGAAGG - Intronic
1023565735 7:41522140-41522162 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1024041329 7:45558327-45558349 AAAGGTTAAGAAAGGGAAGAGGG - Intergenic
1024217502 7:47259787-47259809 AAGGAAGAAGGAAGGGAGGAAGG - Intergenic
1024233085 7:47377710-47377732 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1024471093 7:49769474-49769496 AGGATTGAAGAAAGGGAAGAAGG - Intergenic
1024845216 7:53634554-53634576 AAGGGTGGAGGATGGGAGGAGGG + Intergenic
1025198843 7:56949844-56949866 TAGGGAGGAGAAAGGGAGGAGGG - Intergenic
1025673103 7:63627089-63627111 TAGGGAGGAGAAAGGGAGGAGGG + Intergenic
1025814688 7:64900575-64900597 AATGGTGAGGAAAGGGAGGATGG - Intronic
1025913402 7:65846377-65846399 AAGGAAGAAGGAAGGGAGGAAGG - Intergenic
1026340538 7:69430440-69430462 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1026800599 7:73397737-73397759 AAGGGGGAAGAAAAGGAGAAGGG + Intergenic
1026865055 7:73818532-73818554 AAGGAGGGAGGAAGGGATGAAGG - Intronic
1026871030 7:73852018-73852040 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1027159776 7:75793818-75793840 AAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1027371569 7:77511304-77511326 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1027460575 7:78447910-78447932 AAGGGTGCAGAGAGGTATGTAGG - Intronic
1027512445 7:79099618-79099640 AAGGGTGAAGGGAGAGAGGAGGG - Intronic
1027541939 7:79477778-79477800 AAGAGGGAAGGAAGAGATGATGG + Intergenic
1027583635 7:80028769-80028791 AAGGGTGAAGAAAGGAAATGGGG + Intergenic
1027787876 7:82602979-82603001 GAGAGTCAAGAAAGTGATGATGG - Intergenic
1027885146 7:83894551-83894573 AAGGGAGAAGGAAGGAAGGAAGG + Intergenic
1028031065 7:85913442-85913464 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1028337779 7:89678847-89678869 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1028460928 7:91091680-91091702 AAGGGAGAAGGAAGGAAGGAAGG + Intronic
1028607598 7:92671988-92672010 GAGGGTAGAGAAAGGGGTGAAGG + Intronic
1029035990 7:97522456-97522478 AAGGGTGATGCCAGGGATGAGGG - Intergenic
1029064002 7:97829816-97829838 AAGGGTGGAGGATGGGAGGAGGG + Intergenic
1029204184 7:98859012-98859034 AAGGGGGAAGGAAGGAAGGAAGG + Intronic
1029260482 7:99299310-99299332 AAGGTGCAAGACAGGGATGAGGG - Intergenic
1029280591 7:99433051-99433073 AAGGGAAAAGAAAGGGAACATGG + Intronic
1029363606 7:100103538-100103560 GAGGGTGAGGAAAGAGAAGAGGG + Intronic
1029514170 7:101015729-101015751 GAGGGTGAAGAAAGGCAGGGCGG + Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1029977957 7:104851940-104851962 AAGGGAGGAGGAAGGAATGATGG - Intronic
1030013259 7:105192197-105192219 AAAGGGTAGGAAAGGGATGAGGG - Intronic
1030777945 7:113559307-113559329 AAGGGTGATGACAGGGTTAAAGG - Intergenic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1031346539 7:120673860-120673882 AAGGCTGGAAAAAGGCATGAAGG - Intronic
1031422660 7:121568697-121568719 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1031783033 7:125994190-125994212 AAGAGGGAAGGAAGGGAGGAAGG - Intergenic
1031800986 7:126245227-126245249 AAGGTTGGAGAATGGGATGAGGG - Intergenic
1032231649 7:130079857-130079879 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231659 7:130079885-130079907 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231678 7:130079945-130079967 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1032842567 7:135725978-135726000 AAGTTTGATGAAAGGGGTGACGG + Intronic
1032875641 7:136035209-136035231 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1033039779 7:137907415-137907437 AAAGGTGAAGAAAGAGTGGAAGG + Intronic
1033096244 7:138433868-138433890 AAGAAAGAAGAAAGGGAGGAAGG + Intergenic
1033263639 7:139865770-139865792 AAGGAAGAAGGAAGGGAGGAAGG + Intronic
1033362042 7:140644701-140644723 AAGGTTGAAGAATGGGAGGCAGG + Intronic
1033386186 7:140878596-140878618 AAGGAGGGAGAAAGGGATAAAGG + Intronic
1033390955 7:140926710-140926732 AAGGGTGATGAAAGGGGAAAAGG - Intergenic
1033438375 7:141355102-141355124 GGGGGTGATGGAAGGGATGAAGG + Intronic
1033732005 7:144189249-144189271 AAGTGAGAAGAAAGGCAGGAAGG - Intronic
1033742854 7:144287832-144287854 AAGTGAGAAGAAAGGCAGGAAGG - Intergenic
1033751048 7:144361782-144361804 AAGTGAGAAGAAAGGCAGGAAGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034004368 7:147452938-147452960 GAGGGAGAAGAAAGGGAGGGAGG + Intronic
1034855785 7:154545428-154545450 AAGGATGAAGAAAAGGAGGGAGG - Intronic
1035776301 8:2191278-2191300 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1035776347 8:2191393-2191415 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1035776536 8:2191760-2191782 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1035776567 8:2191823-2191845 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1036423267 8:8617961-8617983 AGGGGTGAAGCTGGGGATGAGGG - Intergenic
1036597155 8:10224321-10224343 GAGTGTGAAGAATGGCATGAGGG + Intronic
1036718066 8:11144993-11145015 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
1037223214 8:16551613-16551635 AAATGTGAAGAAAGTGAGGAGGG + Intronic
1037476938 8:19267195-19267217 AAGGGAGAAGAGTGGGAGGAGGG + Intergenic
1037659131 8:20912124-20912146 AAAGAAGAAGAAAGGGATAAAGG - Intergenic
1037807895 8:22068640-22068662 AAGAGGGAAGGAAGGGAGGAAGG + Intronic
1038382661 8:27111363-27111385 AAAGGATAGGAAAGGGATGAGGG - Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1039061968 8:33579221-33579243 AAGAATGAAGAAAGGAAGGAAGG - Intergenic
1039182694 8:34883870-34883892 AAATGAGAAGAAAGGAATGAAGG + Intergenic
1039205205 8:35145122-35145144 AAGGGAGAAGGAATGGAAGATGG - Intergenic
1039270125 8:35870838-35870860 AGGAGGGAAGAAAGGAATGATGG - Intergenic
1039321237 8:36434393-36434415 AAGGAGGAAGAAAGGGAGGGTGG + Intergenic
1039716409 8:40114394-40114416 AAGGAAGAAGAAAGGAAGGAAGG - Intergenic
1039716415 8:40114425-40114447 AAGGAAGAAGAAAGGAAGGAAGG - Intergenic
1039724567 8:40202057-40202079 AATGGTGAGGACAGGGAGGACGG + Intergenic
1040826828 8:51631279-51631301 TAGGGTGAGGAATGGGAGGAGGG + Intronic
1041387273 8:57318001-57318023 AAGGGAGAAGAGAGGCAGGAAGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041601838 8:59727627-59727649 AAGAAGGAAGAAAGGAATGAAGG + Intergenic
1041881598 8:62757815-62757837 AAGGTTGAAGATAATGATGAAGG + Intronic
1042130417 8:65582437-65582459 AGAGGAGAAGAAAGGGAAGAAGG + Intergenic
1042525372 8:69759136-69759158 AAGGGAGAAGGAAGGAAGGAAGG - Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043058139 8:75466620-75466642 AAGGGAGAAGGAAGGAAGGAAGG - Intronic
1043215925 8:77587900-77587922 AAGGATGAAGAGTAGGATGATGG - Intergenic
1043223723 8:77698715-77698737 AAGGGTGCAGAACTGGATGGAGG - Intergenic
1043822814 8:84889538-84889560 CAGGGTGTAGAAAGAGAAGATGG - Intronic
1044190665 8:89313069-89313091 ATGAGTGGAGAAAGGGATGTAGG - Intergenic
1044381515 8:91539621-91539643 AAGGGGGAAAAGAGAGATGAGGG - Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1044417671 8:91954460-91954482 AAGGGGTCAGAAAGGGAAGATGG - Intergenic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1044764733 8:95559479-95559501 AAAGAGGAAGAAAGGAATGATGG - Intergenic
1044946047 8:97391103-97391125 AAGGGTGCAGGAAGGTAGGATGG - Intergenic
1045190855 8:99881676-99881698 AAGAGTGAGGAAAGAAATGAGGG + Intronic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045978861 8:108160760-108160782 AAGTGTGTAGAAAGGAAGGATGG + Intergenic
1046220793 8:111211584-111211606 AAGGAGAAAGAAAGGGAAGAGGG - Intergenic
1046320186 8:112564314-112564336 AGGGGAGAAGGAAGGGAAGAAGG - Intronic
1046364354 8:113206611-113206633 AAGGCTGAGGAAAAGGTTGAAGG - Intronic
1046571271 8:115969211-115969233 AAAGGAGAAGAAAGGAAGGAAGG - Intergenic
1046611164 8:116427078-116427100 AAGAGTGAACAAAGGGTTAAGGG - Intergenic
1046644435 8:116769370-116769392 ATGGGTGAAGAAGGGCAGGAAGG + Intronic
1047251934 8:123187210-123187232 AAGGGTGAAGACAGGAATAGAGG + Intronic
1047595989 8:126378390-126378412 AAGAGGGAAGGAAGGAATGAAGG - Intergenic
1048007661 8:130432085-130432107 AAGGGGGAGGAAAGGGAAGAGGG + Intronic
1048363126 8:133715200-133715222 AAGAGGGAAGAAAGGAAGGAAGG - Intergenic
1048438598 8:134441634-134441656 GAGGGTGAAGCATGGGAGGAGGG + Intergenic
1048556772 8:135485711-135485733 AAGGGTGATGACGGTGATGATGG + Intronic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048720792 8:137322004-137322026 AAGGGAGAAGAGAGGCATTAGGG + Intergenic
1049468928 8:142766717-142766739 AAGGGTGAGGACAGGGAGGGAGG - Intronic
1049521875 8:143095450-143095472 GAGGGTGAGGAAAGCGAGGAAGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050667334 9:7955042-7955064 AAGGAGGAAGCAAGGAATGAAGG + Intergenic
1050982452 9:12036955-12036977 AAGGGTGCAGAACTGGATAAGGG + Intergenic
1051336468 9:16070527-16070549 AAGGCTGGAGAAGGGGTTGAGGG + Intergenic
1051359481 9:16269305-16269327 AAGATGGAAGAAAGGGAGGAAGG + Intronic
1051668913 9:19491147-19491169 AAAGGAGAAGAAAGGAATAAAGG - Intergenic
1051688816 9:19687128-19687150 AAGGGTGGAGAATGAGAGGAGGG + Intronic
1051711169 9:19932895-19932917 AAGGGTGAAACCAGTGATGACGG - Intergenic
1052151003 9:25115612-25115634 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1052410968 9:28120574-28120596 TGGGGTGAAGAAAGGGAGGCGGG - Intronic
1052434592 9:28409922-28409944 AAGGGAGAAGGAAAGGAAGAGGG + Intronic
1052434607 9:28409982-28410004 AAGGGAGAAGGAAAGGAAGAGGG + Intronic
1052474478 9:28941051-28941073 AAGGAGGAAGAAAGAAATGAAGG + Intergenic
1052682165 9:31707271-31707293 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1052917301 9:33933212-33933234 GAGGGTGAAGACAGGTAGGAGGG + Intronic
1053192512 9:36084699-36084721 AAGAAGGAAGGAAGGGATGAAGG + Intronic
1053599316 9:39594053-39594075 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1053857021 9:42348239-42348261 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1054254208 9:62748333-62748355 AGGGTGGAAGAAAGGGAGGAAGG + Intergenic
1054568274 9:66782515-66782537 AAAGTGGAAGAAAGGGAGGAAGG + Intergenic
1054716140 9:68559521-68559543 AAGAGGGAGGAAAGGAATGAGGG - Intergenic
1054746125 9:68855677-68855699 AAGGGTGATGAACGAGAGGATGG - Intronic
1054761949 9:69012248-69012270 AAGGGTGAAGAAAAGTCTGCTGG + Intergenic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1054874223 9:70078491-70078513 AAAGGTGAAGAAAGGGGACACGG + Intronic
1054989001 9:71299498-71299520 AAAGATGAAGGAAGGGAGGAAGG + Intronic
1055500334 9:76896604-76896626 AAAGGGGAAGAAAGGAAAGAAGG - Intronic
1055845893 9:80563393-80563415 AAGAAGGAAGGAAGGGATGAAGG + Intergenic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056545156 9:87606817-87606839 AAGGGGGGAGAAAGGGAGGAAGG - Intronic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057165475 9:92921784-92921806 AAGGAGGAAGACAGGGAGGAAGG - Intergenic
1057181132 9:93031081-93031103 ATGGGTGGATGAAGGGATGATGG + Intronic
1057741909 9:97719422-97719444 AAAGATGAAGAAAGGCATCATGG + Intergenic
1057894390 9:98895840-98895862 AAGAGTGAGGAAAGTGGTGAAGG - Intergenic
1058108058 9:100997456-100997478 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058823425 9:108753782-108753804 ACGGATGAAGATAGTGATGATGG - Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059363428 9:113766276-113766298 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1059619745 9:115990503-115990525 AAGGAGGAAGGAAGGGATGGAGG - Intergenic
1059669665 9:116480103-116480125 ATGGGTGAAGAAAGGAAGGAAGG + Intronic
1059912590 9:119062408-119062430 AAGGGTGAAGGTTGGGAGGAGGG - Intergenic
1059918231 9:119128147-119128169 TAGGGAGGAGAAAAGGATGAAGG - Intergenic
1060006803 9:120007812-120007834 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
1060341422 9:122780095-122780117 AAGGGAGAAGGAAGGAAGGAAGG - Intergenic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1061287673 9:129633375-129633397 AAGGGTGCAGAGAGGGAACATGG - Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1061726362 9:132584116-132584138 AAGGGAGAAGGAAGGAAGGAAGG + Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062654869 9:137598584-137598606 AAGGGTGTCGGAAGGAATGAGGG + Intergenic
1062701717 9:137909352-137909374 AAGGCTGAAGGAAGGGAAGTGGG - Intronic
1203773844 EBV:62164-62186 GAGGGTGAAGAAAGCGGTGGTGG - Intergenic
1203453177 Un_GL000219v1:140038-140060 AAGAGTGAGGAAAGGAAAGAAGG - Intergenic
1185497446 X:566124-566146 ATGGGTGAATTAATGGATGATGG + Intergenic
1185695770 X:2193308-2193330 ATGGGTGAAGGAAGGAAGGAGGG - Intergenic
1185698436 X:2213329-2213351 AAGGAGGAAGGAAGGGAGGAAGG + Intergenic
1185698537 X:2213680-2213702 AAGGAGGAAGGAAGGGAGGAAGG + Intergenic
1185698613 X:2213941-2213963 AAGGAGGAAGGAAGGGAGGAAGG + Intergenic
1185698656 X:2214083-2214105 AAGGAGGAAGGAAGGGAGGAAGG + Intergenic
1185834044 X:3328882-3328904 AAGGAAGAAGGAAGGAATGAAGG + Intronic
1185933312 X:4227722-4227744 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1186019184 X:5235069-5235091 AAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1186059374 X:5687299-5687321 AAGGGGGAAGGAAGGAAGGAAGG + Intergenic
1186107138 X:6219620-6219642 AAGGAAGAAGGAAGGGATGGAGG - Intronic
1186210541 X:7245852-7245874 AAGGCTGAAGAATGAGAGGAGGG - Intronic
1186402589 X:9273567-9273589 AAGGATGAAGAAAAGGAAGAAGG + Intergenic
1186790725 X:12995698-12995720 AAGGGTGGAGGATGGGAGGAGGG + Intergenic
1186828788 X:13369163-13369185 AAGGGAGAAGGAAGGAAGGAAGG - Intergenic
1186878588 X:13841606-13841628 GAGGCTGAAGAAAGGGGTGAGGG - Intronic
1186923881 X:14310737-14310759 ATGAGTGAAGAAAGAAATGAAGG + Intergenic
1187266052 X:17734888-17734910 AAGTGTGAAGAAAGGTATGTGGG + Exonic
1187570499 X:20496162-20496184 AGGGGTGAAGAGAGGGAAGTGGG - Intergenic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1187772148 X:22711512-22711534 GAAGGGGAAGAGAGGGATGAGGG + Intergenic
1188002935 X:24999052-24999074 AGGGCTGGAGAAAGGGGTGATGG - Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189176285 X:38960607-38960629 AGGGATGGAGAGAGGGATGAAGG - Intergenic
1189462060 X:41250861-41250883 AAGGGTGAGGGAAGGTATGCAGG + Intergenic
1189591766 X:42520103-42520125 CAAGTTGAAGAAAGGGAAGAAGG - Intergenic
1189749773 X:44208487-44208509 AAAGGGGGAGAAAGGGAGGAAGG + Intronic
1190048618 X:47132567-47132589 GAGGAGGAAGAAAGGGAGGAAGG - Intergenic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1190456935 X:50635790-50635812 AAGGGGGAAGAAAGGGAAACAGG + Intronic
1190469983 X:50769190-50769212 AGGAGTGAAGAAAGGGAGGGAGG + Intronic
1190802467 X:53804225-53804247 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1191108188 X:56785275-56785297 AAGGGAGAAGAAAAGAATGCAGG + Intergenic
1191837853 X:65484201-65484223 GAGGGTGGAGAATGGGAGGAGGG + Intronic
1192137739 X:68620262-68620284 AAGGGAGAAGGAAGGAAGGAAGG - Intergenic
1192263934 X:69525706-69525728 AAGGGTTAAGAGTGGGGTGAGGG - Intronic
1192316764 X:70058379-70058401 AAGGAGCAAGAAAGAGATGAGGG + Intergenic
1192433104 X:71125859-71125881 GAGGGTCAAGGAAGGGATGGGGG - Intronic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1192930142 X:75798493-75798515 AAGGGTGTAGAACTGGATGGAGG - Intergenic
1193091228 X:77495285-77495307 AAGGGTGCAGAACTGGATGGAGG + Intergenic
1193288353 X:79740153-79740175 AAGGGTGGAGGAAGGGACCAAGG + Intergenic
1193501791 X:82285381-82285403 AAGGGGGAAAGAAGGAATGAAGG + Intergenic
1193718810 X:84964246-84964268 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1194100713 X:89700265-89700287 AAGGAAGAAGAAAGGGGAGAGGG - Intergenic
1194914382 X:99686862-99686884 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1195422680 X:104693286-104693308 AAGATAGAAGAATGGGATGAAGG - Intronic
1195548979 X:106144951-106144973 GAGGGTGGAGAATGGGAGGAAGG + Intergenic
1195717436 X:107830232-107830254 AAGGGTGAAGACAGGGCTGTGGG + Intronic
1195860003 X:109373529-109373551 AAGGGTGAAAATAAGTATGAAGG - Intronic
1196066968 X:111474392-111474414 AAAGGTGCAGAAAGGGAAGTGGG - Intergenic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196541586 X:116916879-116916901 AAGGGTGGAGAAAGGGAGAAGGG - Intergenic
1196653298 X:118190524-118190546 AAGGGAAAAGAAAGAGAGGAAGG + Intergenic
1196904129 X:120415650-120415672 AGGGGGGAAGAAAGGAAGGAAGG - Intergenic
1197193371 X:123673604-123673626 AAGGATGTGGAAAGGTATGATGG - Intronic
1197815995 X:130499381-130499403 AAGGCAGAAGGAAGGGAGGAGGG - Intergenic
1198368415 X:135967052-135967074 AGGGGGGAAGAAAGGGAGCAAGG + Intronic
1198399040 X:136251660-136251682 AAAGGTGAAGAAAGGAATGTTGG - Intronic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1199324587 X:146482459-146482481 ATTGGTGAAGAAAAGGATGTAGG - Intergenic
1199595766 X:149504835-149504857 AAGAGGGAAGGGAGGGATGAAGG + Intronic
1199599885 X:149535568-149535590 AAAGGAGAGGAGAGGGATGAGGG - Intergenic
1199650755 X:149944683-149944705 AAAGGAGAGGAGAGGGATGAGGG + Intergenic
1199899906 X:152162844-152162866 AAGGGTGAAGAGAGGCTTCAAGG + Intergenic
1200374712 X:155767573-155767595 AAGGAGGAAGAAGGGGAGGAGGG + Intergenic
1200453666 Y:3361341-3361363 AAGGAAGAAGAAAGGGGAGAGGG - Intergenic
1200788544 Y:7279764-7279786 AAAGGAGAAGAAAGAGATGCAGG + Intergenic
1200812257 Y:7498461-7498483 GAGGGTGCAGGAAGGGAGGAGGG + Intergenic
1201341140 Y:12935611-12935633 AAGGATGAAGGAAGGAAGGAAGG - Intergenic
1201690547 Y:16760123-16760145 AAGGAAGAAGGAAGGGATGAAGG - Intergenic
1201693659 Y:16799012-16799034 AAGGCTGAAGAAAATGATAATGG + Intergenic
1201712686 Y:17009931-17009953 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1202196291 Y:22301130-22301152 AAGGCTGAAGGAAGGAAAGAAGG + Intergenic