ID: 1179877010

View in Genome Browser
Species Human (GRCh38)
Location 21:44273698-44273720
Sequence AAGGGGTATTTCCAGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179877003_1179877010 5 Left 1179877003 21:44273670-44273692 CCAAGGAGCAGAGACCATTCAAT No data
Right 1179877010 21:44273698-44273720 AAGGGGTATTTCCAGTGCCAGGG No data
1179877008_1179877010 -9 Left 1179877008 21:44273684-44273706 CCATTCAATGGAGAAAGGGGTAT No data
Right 1179877010 21:44273698-44273720 AAGGGGTATTTCCAGTGCCAGGG No data
1179877002_1179877010 12 Left 1179877002 21:44273663-44273685 CCTTCGACCAAGGAGCAGAGACC No data
Right 1179877010 21:44273698-44273720 AAGGGGTATTTCCAGTGCCAGGG No data
1179877000_1179877010 27 Left 1179877000 21:44273648-44273670 CCTATGGACAGCTGGCCTTCGAC No data
Right 1179877010 21:44273698-44273720 AAGGGGTATTTCCAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179877010 Original CRISPR AAGGGGTATTTCCAGTGCCA GGG Intergenic
No off target data available for this crispr