ID: 1179878178

View in Genome Browser
Species Human (GRCh38)
Location 21:44281958-44281980
Sequence TGATGTGTATAGAAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179878178_1179878183 5 Left 1179878178 21:44281958-44281980 CCTCCCAACTTCTATACACATCA No data
Right 1179878183 21:44281986-44282008 GCCGCGTCCCCCCACTTTGCAGG No data
1179878178_1179878191 30 Left 1179878178 21:44281958-44281980 CCTCCCAACTTCTATACACATCA No data
Right 1179878191 21:44282011-44282033 GAGAACATCTGACGTGACCTGGG No data
1179878178_1179878190 29 Left 1179878178 21:44281958-44281980 CCTCCCAACTTCTATACACATCA No data
Right 1179878190 21:44282010-44282032 TGAGAACATCTGACGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179878178 Original CRISPR TGATGTGTATAGAAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr