ID: 1179881112

View in Genome Browser
Species Human (GRCh38)
Location 21:44293698-44293720
Sequence GGTCCCAGGGGAGAGCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179881099_1179881112 3 Left 1179881099 21:44293672-44293694 CCTAGACCCGCCGTCCAGCCCTG 0: 1
1: 0
2: 3
3: 14
4: 236
Right 1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 207
1179881104_1179881112 -4 Left 1179881104 21:44293679-44293701 CCGCCGTCCAGCCCTGGGTGGTC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 207
1179881103_1179881112 -3 Left 1179881103 21:44293678-44293700 CCCGCCGTCCAGCCCTGGGTGGT 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 207
1179881097_1179881112 24 Left 1179881097 21:44293651-44293673 CCGTGAGGCTCCTCACTTGCGCC 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 207
1179881105_1179881112 -7 Left 1179881105 21:44293682-44293704 CCGTCCAGCCCTGGGTGGTCCCA 0: 1
1: 0
2: 6
3: 45
4: 359
Right 1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 207
1179881098_1179881112 14 Left 1179881098 21:44293661-44293683 CCTCACTTGCGCCTAGACCCGCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179881112 Original CRISPR GGTCCCAGGGGAGAGCGCAC AGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900328087 1:2120620-2120642 GGTCCCAGGGGAGAGAGAACAGG - Intronic
900481263 1:2900555-2900577 GGTCCCCTGGGAGAAGGCACAGG - Intergenic
900899900 1:5509287-5509309 GGTCACAGCTGAAAGCGCACCGG - Intergenic
902449349 1:16486658-16486680 GGTCCTTTGGGAGAGAGCACAGG + Intergenic
903810696 1:26033573-26033595 GGACTCAGGGGAGAGGGCGCGGG - Intronic
904988443 1:34572378-34572400 GACCCCAGGGGAGAGGGCAGTGG - Intergenic
905340183 1:37272745-37272767 GGTCCCAGGTGACAGCCCACAGG + Intergenic
915485386 1:156216679-156216701 GCCCGCAGCGGAGAGCGCACGGG - Intronic
916004071 1:160643397-160643419 GGTCCCTAGGTAGAGCGCCCAGG - Intronic
919775056 1:201189124-201189146 GGCCCCAGGGAAGAGCACATGGG + Intergenic
1062843568 10:689058-689080 GGCTCCAGCGCAGAGCGCACGGG + Intronic
1062930432 10:1348967-1348989 GGGCTCAGGGGAGAGGGCTCAGG + Intronic
1064215922 10:13400613-13400635 GGTCCCATGGGGAAGCGCACAGG + Intergenic
1067179212 10:43972229-43972251 GGGCCCAGGGGAGTGGGGACGGG + Intergenic
1067346506 10:45442251-45442273 GCCCCCATGGGAGAGGGCACAGG + Intronic
1067526680 10:47043478-47043500 TGTCCCAGGGAAGAGGGCATGGG - Intergenic
1067535284 10:47104965-47104987 GGTTCCAGGGGAGAGGTCATAGG - Intergenic
1068631493 10:59303183-59303205 GATCCCAGGGGAGAGCAGTCTGG - Intronic
1073599817 10:104835661-104835683 GGTGCCAGGTGAGAGAACACTGG + Intronic
1074695886 10:116049978-116050000 GGTCGCAGGGGAGAGCCCACAGG + Intergenic
1075344907 10:121674848-121674870 GGGGCCAGGGGAGAGCCCTCAGG + Intergenic
1076734941 10:132454618-132454640 CCTCTCAGGGGAGAGGGCACAGG + Intergenic
1076917916 10:133433596-133433618 TGTCCCCGGGGTGAGGGCACCGG - Intergenic
1076937914 10:133577673-133577695 TGTCCCCGGGGTGAGGGCACCGG - Intergenic
1078438650 11:11345820-11345842 GGTCGCAGGGAACAGGGCACAGG + Intronic
1080757956 11:35220213-35220235 TGTCCCAAGGGAGAGCACAGGGG + Intronic
1083662234 11:64256788-64256810 GGTCACAGGGCAGAGGTCACGGG - Intronic
1083883280 11:65558589-65558611 GGTCCCAGGTGAGGGCCCTCTGG - Intronic
1084170259 11:67397497-67397519 GGGCCCTGGGGGGAGCGTACAGG - Exonic
1084301663 11:68256459-68256481 GGTCCCAGGGGACAGCGGCGGGG - Intergenic
1084360886 11:68667822-68667844 GGTCCAAGTGGAGAGGGCAGGGG - Intergenic
1084972921 11:72781393-72781415 GGCCCCAGGGAAGGGCGGACGGG + Intronic
1090703545 11:129316535-129316557 GGCCCCAGGGGGGAGCTCAGAGG - Intergenic
1091402504 12:189408-189430 GGTCCAAGGAGCGAGGGCACAGG + Intergenic
1093272821 12:17085652-17085674 GTTACCAGGGGAGAGCACAGTGG + Intergenic
1102602677 12:114043963-114043985 AGTCCCTGGGGATAGGGCACAGG + Intergenic
1103703881 12:122861247-122861269 GGACCCAGGAGAGAGCTCCCTGG + Intronic
1103847227 12:123909855-123909877 GGTCCCTGGGGAGTGGGCATGGG + Intronic
1104420175 12:128628345-128628367 GGCCCCAGGGCAGAGCGCATGGG - Intronic
1104633757 12:130425212-130425234 GGTGCCAGGGGAGACTGCCCGGG + Intronic
1104940311 12:132392044-132392066 GGTCCCTGGGGAGAGCGGGGTGG - Intergenic
1104940324 12:132392073-132392095 GGTCCCTGGGGAGAGCGGGGTGG - Intergenic
1104940336 12:132392101-132392123 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1104940363 12:132392158-132392180 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1104940389 12:132392215-132392237 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1104940416 12:132392272-132392294 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1104940443 12:132392329-132392351 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1104940470 12:132392386-132392408 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1104940497 12:132392443-132392465 GGTCCCGGGGGAGAGCGGGGTGG - Intergenic
1107436311 13:40383362-40383384 AGTCCCACAGGAGAGCCCACTGG + Intergenic
1110148226 13:72220655-72220677 GGACCCAGGGAAGAGTACACTGG + Intergenic
1113634998 13:111913358-111913380 GGGCCCTGGGAAGAGTGCACAGG + Intergenic
1113653908 13:112056420-112056442 GGACGCAGGGGAGAGGGGACTGG + Intergenic
1114141995 14:19922773-19922795 GATCACAGGGGAGACAGCACAGG - Intergenic
1119797200 14:77409381-77409403 GGTGGCAGGAGAGAGCACACAGG - Intronic
1121407735 14:93729098-93729120 AGGCCCAGGGGAAGGCGCACTGG + Intronic
1121619102 14:95333808-95333830 GGTCCCAGGGGAGAAGGCAGGGG + Intergenic
1122986179 14:105212687-105212709 GGGCCCAGGGGAGAGGACGCAGG + Intronic
1123049175 14:105532381-105532403 GTTCCCAGGGGAGATCACAGAGG - Intergenic
1123180273 14:106463134-106463156 GGTCCCAGGGGCGGGTGCAGGGG - Intergenic
1123478533 15:20610588-20610610 GGCCCCAGAGGAGGGTGCACTGG - Intergenic
1123639480 15:22389797-22389819 GGCCCCAGAGGAGGGTGCACTGG + Intergenic
1123997311 15:25727949-25727971 GGCCCCAGGGGCCAGAGCACAGG + Intronic
1124414863 15:29466567-29466589 GCCCCCAGGGGAGAGCCCAGGGG + Intronic
1124414923 15:29466702-29466724 GGCCCCAGGGGAGGGCCCAGGGG + Intronic
1124415049 15:29467007-29467029 GGCCCCAGGGGAGGGCCCAGGGG + Intronic
1124415064 15:29467041-29467063 GGCCCCAGGGGAGGGCCCAGGGG + Intronic
1124415079 15:29467075-29467097 GGCCCCAGGGGAGGGCCCAGGGG + Intronic
1124526794 15:30461699-30461721 GATCCCAGGGCAGGGCGCAGTGG + Intergenic
1124771860 15:32545984-32546006 GATCCCAGGGCAGGGCGCAGTGG - Intergenic
1126023737 15:44426829-44426851 GGTCGCAGGTGGGAGCCCACTGG + Intergenic
1128582668 15:68820102-68820124 GGCCCCCGGGGAGAGCGCGTGGG - Intronic
1129113083 15:73349592-73349614 GGTGCCATGGAAGAGAGCACAGG - Intronic
1131257019 15:90869729-90869751 GGCCCCAGGGGAGCCCGCAGTGG - Intronic
1132551953 16:557193-557215 GGTGCCAGGGGAGAACGGAGGGG - Intergenic
1133075604 16:3278522-3278544 GGACACAGGGGAGACCACACTGG - Intronic
1134183561 16:12066052-12066074 GGTCCCAGGTGATTGCCCACGGG - Intronic
1136479130 16:30530786-30530808 GGTGACAGGTGAGGGCGCACAGG + Intronic
1137267949 16:46884291-46884313 GGGCCCAGGAGGCAGCGCACAGG + Intergenic
1138442361 16:57042646-57042668 GAGCCCAGGGGAGAGGTCACAGG + Intronic
1140481219 16:75263931-75263953 GGTCCCAGGAGAGAGAGCCACGG + Intronic
1140481647 16:75265675-75265697 GGCCCCGGGGGAGAGCGCACCGG - Intronic
1140793204 16:78411878-78411900 GTTCCCAGAGGAGAGCGGAGAGG + Intronic
1141444271 16:84047938-84047960 GGTGCCAGGGCTGAGCCCACAGG + Intergenic
1142349849 16:89575103-89575125 GGTCCCGGGGGAGGGAGCAGCGG - Intergenic
1142958405 17:3536092-3536114 GGTCCCAGGTTAGAGAGCTCTGG - Intronic
1143135615 17:4710805-4710827 GGTCCCAGACGAGGGCGCAGCGG + Intronic
1143164942 17:4893000-4893022 ATTCCCAGGGGAGAGCACAGGGG - Exonic
1146074060 17:29711756-29711778 GGTCCCAGGGGAGAGTTTCCAGG - Intronic
1146937131 17:36818906-36818928 GGTGCCAGGGCTGAGCTCACAGG - Intergenic
1147186604 17:38716586-38716608 GTCCCCAGGGGAGGGCGCCCGGG - Exonic
1147863266 17:43536394-43536416 GGTCCCTGGGGAGAGGGTATAGG - Intronic
1148157298 17:45431583-45431605 GGTCCAAGGGGAGGGGGCGCCGG - Intronic
1148454918 17:47806069-47806091 GGCCCCAGGGGCGAGGGCAGCGG + Intergenic
1149269606 17:54963407-54963429 GGTGCCAGGAGAGACTGCACTGG - Exonic
1151460959 17:74253661-74253683 GGTCCCATGGGTGAGCACATGGG - Intronic
1151659615 17:75511980-75512002 GGTCCCAGGGGAGGGCCCTAAGG - Intronic
1151663281 17:75531088-75531110 GGTGGCAGGGCAGAGAGCACAGG + Intronic
1152436663 17:80280491-80280513 GGTCCCAGGCTGGAGCGCAGTGG + Intronic
1152554640 17:81046778-81046800 GGCTCCAGGGAAGGGCGCACGGG - Intronic
1152926776 17:83091000-83091022 GCCCCCATAGGAGAGCGCACCGG + Intronic
1159928699 18:74291508-74291530 GCTCCCAGGTGTGAGCGCGCAGG + Intronic
1160277566 18:77451752-77451774 GCTCCCAGGGGAGAGCCCAGGGG + Intergenic
1161493524 19:4575508-4575530 GGTCCCAGGGGAAAGGCCCCGGG + Intergenic
1162363230 19:10231638-10231660 GGTCCCAGGGGTAAGCCCAGAGG - Intergenic
1163084820 19:14971722-14971744 GGTCACAGGTGAGAGAGCCCAGG - Exonic
1165559474 19:36666870-36666892 AGTCCGAGGGGAGAGCGCCTGGG + Intergenic
1165791025 19:38492648-38492670 GGTCACTGGGGAGAGGGCAGGGG + Intronic
1168076399 19:53982764-53982786 GGTCCCGGGGGCGGGCGCAGAGG - Exonic
926272085 2:11374556-11374578 GGCCCCAGGGGCGAGGGCAGGGG - Intergenic
926707588 2:15847520-15847542 GCTCCCAGGGTACAGCGCTCAGG - Intergenic
927638326 2:24831840-24831862 GGGGCCAGGGGACAGCGGACAGG + Intronic
930044290 2:47155321-47155343 GGTCCCAGGCGCGCGCGCTCGGG - Exonic
934028723 2:88022251-88022273 GGGCCCAGGAGGGAGCGCAGTGG + Intergenic
934513024 2:94963354-94963376 AGTCCCAGGGATGAGCACACAGG + Intergenic
936012394 2:108933415-108933437 GGTCCCAGGGGAGATCCCAGAGG + Intronic
936144338 2:109969649-109969671 TGTCCCAGGGGAGCGAGGACAGG - Intergenic
936181021 2:110267609-110267631 TGTCCCAGGGGAGCGAGGACAGG - Intergenic
936200350 2:110401820-110401842 TGTCCCAGGGGAGCGAGGACAGG + Intergenic
937264572 2:120607808-120607830 GGACACAGGGGAGAGGGCAGGGG - Intergenic
941735952 2:168977757-168977779 GGTGGCAGGAGAGAGCGCATAGG + Intronic
943766683 2:191670583-191670605 GGGACCAGGGGAGAGGGCAGGGG - Intergenic
946235154 2:218319955-218319977 GTTCCAAGGGGAGAGAGCATAGG + Intronic
947634146 2:231671683-231671705 GGTTCCAGGACAGAGCCCACCGG + Intergenic
948874476 2:240819599-240819621 GGCCCGAGGGGAGAGCGCGCAGG - Intronic
1168877190 20:1180084-1180106 GGTCTCAGGGAAGAGCTCCCTGG - Intronic
1173584456 20:44171666-44171688 GGTGACAGGGGAGGCCGCACAGG - Intronic
1176026958 20:62990685-62990707 GGTCCCAGCGGGGAGTGCGCCGG + Intergenic
1176546933 21:8206227-8206249 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1176554838 21:8250436-8250458 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1176565884 21:8389274-8389296 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1176573759 21:8433461-8433483 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1178875155 21:36408520-36408542 GGTCCCCGGGGATTGCCCACAGG + Intronic
1179802820 21:43819491-43819513 AGTCCCAGGGGAGAGAGGAGGGG + Intergenic
1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG + Intronic
1180918675 22:19506984-19507006 GGTCCCAGTGGAGGGCTCTCCGG + Intronic
1182734537 22:32522454-32522476 GGTCCCAGGGCAGAGGGGAAAGG + Intronic
1184644859 22:45890155-45890177 GTTCCCAGGGGAGAGGGGAAGGG - Intergenic
1185182240 22:49370040-49370062 GCAGGCAGGGGAGAGCGCACAGG + Intergenic
1203251808 22_KI270733v1_random:122512-122534 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1203259859 22_KI270733v1_random:167595-167617 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
950032638 3:9862676-9862698 GGACCCAGCGGAGAGGGCTCGGG + Intergenic
950282572 3:11720072-11720094 GCTCCCGGGGGACAGCGCACGGG + Intronic
950415883 3:12868941-12868963 GGACCCAGTGGAGAGGGCCCGGG + Intronic
950417328 3:12876056-12876078 GGACCCAGCGGAGAGGGCCCGGG + Intergenic
950689139 3:14641788-14641810 GGTCCCAGGTGAAAGCACCCAGG - Intergenic
956117261 3:65931070-65931092 TGTCCCAGGGTAGAGTGCAGTGG + Intronic
956621654 3:71226947-71226969 GATGACAGGGCAGAGCGCACAGG + Intronic
957465609 3:80586336-80586358 GTTCCCAGTGGAGAGGGAACAGG - Intergenic
958814444 3:98901093-98901115 GGTCCCAGGGGAGTGAGCGGCGG - Intronic
961200835 3:125043916-125043938 GCTCCCAGGGGTGTGCACACTGG + Intronic
962384977 3:134925554-134925576 GGTCACCGGGGAGAGAGCACTGG + Intronic
964406264 3:156352198-156352220 GGTCCCCGGGAGGAGCCCACAGG - Intronic
965437563 3:168671418-168671440 GGCCCCAAGGAAGAGTGCACAGG - Intergenic
968757837 4:2426072-2426094 GGGCCCACGGCAGAGAGCACAGG - Intronic
968997583 4:3955487-3955509 GGGCCCAGGGTAGTGCGCAGGGG + Intergenic
969059773 4:4425506-4425528 GATCCCAGGGGAGAGCGGGTAGG - Intronic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
978914333 4:114105219-114105241 GGACCCAGGGAACAGGGCACAGG + Intergenic
986271262 5:6232972-6232994 GGTACCAGGTGAGAGTGCCCAGG + Intergenic
986772992 5:10990214-10990236 GGTTCCAGGGGAGAGGACAAAGG + Intronic
987050540 5:14144002-14144024 GGTCCCAGGCGAGAGCCTGCGGG - Intronic
987137949 5:14917405-14917427 TGTACCAGGGGAGAGCAGACAGG + Intergenic
987440685 5:17952142-17952164 GGTCCTTGGGGAGGGCTCACAGG - Intergenic
992077143 5:73202145-73202167 GGTCCCATTGGAGAGGGCTCTGG - Intergenic
993915584 5:93740677-93740699 AGTCCCAGGTGAAAGCACACTGG + Exonic
996414558 5:123196125-123196147 TGTCCCAGGGAAGGGCACACTGG - Intergenic
996497316 5:124174692-124174714 GGTAGCAGGAGAGAGAGCACAGG + Intergenic
997673667 5:135696557-135696579 GGGCCCAGCAGAGAGAGCACAGG - Intergenic
998446985 5:142206013-142206035 GGGACCAGGGGAGTGCGCAGGGG + Intergenic
1002291475 5:178203911-178203933 GGTGCCAGGGGACAGAGAACCGG + Intergenic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1004871207 6:19906254-19906276 AGTCCTAGGGCAGAGAGCACAGG + Intergenic
1006815321 6:36845907-36845929 GGACCCAGGGGAGAGTGGTCCGG - Intergenic
1007117107 6:39350576-39350598 GTTCCCAAGGGAGACAGCACTGG - Intronic
1011216845 6:85014415-85014437 AGTCCTAGGGGAGATGGCACAGG + Intergenic
1013039427 6:106418873-106418895 GGTCCCATGGTAAAGTGCACGGG + Intergenic
1017731673 6:157323062-157323084 GGTCCCAGGGGAGAGGGGAAGGG - Intronic
1018212664 6:161497111-161497133 GTTCCCAGGGGTCAGCCCACAGG + Intronic
1018449419 6:163893267-163893289 GGTATCCGTGGAGAGCGCACAGG + Intergenic
1018580143 6:165301524-165301546 GGTCTCAGGGAAGAGCTCTCAGG - Intronic
1019341927 7:512492-512514 AGGCCCAGGGCACAGCGCACGGG - Intronic
1019550009 7:1597516-1597538 GGTCCCAGGGGTCAGCGCTTGGG + Intergenic
1020570316 7:9851747-9851769 GGTGCCAGTGGAGACCACACAGG - Intergenic
1022028178 7:26467796-26467818 GGACCCAGAGGAGACCGCCCAGG - Intergenic
1022097093 7:27147910-27147932 GGTCCCCGGGGAGCGGGCTCCGG - Intronic
1022101690 7:27173058-27173080 GGCCACAGGAAAGAGCGCACAGG + Intronic
1024242034 7:47443117-47443139 GGACCCAGGGCTGAGCTCACCGG - Intronic
1026036415 7:66833201-66833223 GGTCCCTGGAGACAGGGCACGGG - Intergenic
1026173682 7:67976984-67977006 GTTCCCAGGGTAGAGGGCAGTGG + Intergenic
1027214182 7:76173539-76173561 GGTCCCTGGAGATAGCGCATGGG + Intergenic
1028103459 7:86849300-86849322 GGTCCCAAGGTGGAGAGCACTGG + Intronic
1029467260 7:100734129-100734151 GCTCCCAGGGGAGAGGGGAAGGG - Exonic
1034076060 7:148232132-148232154 GGTCCCAGGGTAGATGGGACAGG - Intronic
1035685843 8:1523089-1523111 GGTCCCAGGAGATGCCGCACGGG - Intronic
1036691039 8:10944931-10944953 GGTCCCAGGGGACATGGCAGAGG + Intronic
1037521503 8:19684567-19684589 GGTCCCAGGGGAGTGAGGAGGGG - Intronic
1037762214 8:21749019-21749041 GCTCCCAGAGGAGAGAGCACAGG - Intronic
1038111687 8:24506628-24506650 GGTTCCAGGGGAGAGCCCTCTGG - Intronic
1044173810 8:89091267-89091289 GGGCTCAGGGGAGAGGGCAGTGG + Intergenic
1049148144 8:141017177-141017199 GGGACCAGGGGAGTGGGCACTGG - Intergenic
1049256046 8:141614433-141614455 GGTCACAGCGGAGAGGTCACAGG - Intergenic
1049300742 8:141868095-141868117 GGGCACAGGGGAGAGAGGACAGG - Intergenic
1049538569 8:143194592-143194614 GGGGCCAGGGGAGAGGACACAGG + Intergenic
1049604798 8:143524310-143524332 GGCCCTAGGGGAGAGCTCCCTGG + Intronic
1051841424 9:21402563-21402585 GGACCCTGGGGCGAGCGGACGGG - Intergenic
1053005847 9:34603939-34603961 GGTCCCAAGGGAGTGCTCAGAGG + Intergenic
1057631103 9:96719814-96719836 CGCCCCAGGGGAGAGCGCGGGGG + Intergenic
1059145764 9:111897449-111897471 GGTCCGAGGGGCGAGGGAACGGG - Intronic
1059434525 9:114267999-114268021 GGGCCCAGGGGAGCCCGCAGAGG + Intronic
1060404429 9:123366209-123366231 GGAACCTGGGGAGGGCGCACCGG - Exonic
1060819167 9:126651623-126651645 GGGCCCAGGGGAGAGGGGTCAGG - Intronic
1061160414 9:128890694-128890716 GATCCCAGGGGAGTGGGCACTGG - Intronic
1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG + Intergenic
1061764904 9:132875459-132875481 GGCCCCAGGGGAGAGAGCCCTGG - Intronic
1061901268 9:133673326-133673348 GGTCCCAGGGCTGAGCACTCAGG - Intronic
1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG + Intronic
1203468210 Un_GL000220v1:105663-105685 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1203476031 Un_GL000220v1:149635-149657 GCCCGCAGCGGAGAGCGCACGGG - Intergenic
1188614035 X:32135441-32135463 GTTCACAGGGGTGAGTGCACTGG + Intronic
1189069319 X:37847339-37847361 GGGCCCAGGGGAGAGGACCCGGG + Intronic
1193085546 X:77445978-77446000 GGTTCCAGGGGAGTGAGCTCAGG + Intergenic
1195741887 X:108073078-108073100 GGTCCCAGGTGAGTTAGCACTGG + Intronic
1198975591 X:142332638-142332660 GATCCCAGGGAAGAGCATACCGG + Intergenic