ID: 1179881787

View in Genome Browser
Species Human (GRCh38)
Location 21:44296122-44296144
Sequence GTGGCCTCCTGGGGAAAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 178}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179881787_1179881801 20 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881801 21:44296165-44296187 GGGCCGTGGGCAGCTGGCCGTGG 0: 1
1: 0
2: 3
3: 43
4: 407
1179881787_1179881798 6 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881798 21:44296151-44296173 TGGAGGCTGTCTGGGGGCCGTGG 0: 1
1: 2
2: 7
3: 74
4: 591
1179881787_1179881796 -1 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881796 21:44296144-44296166 CACAGTGTGGAGGCTGTCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 452
1179881787_1179881795 -2 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881795 21:44296143-44296165 ACACAGTGTGGAGGCTGTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 285
1179881787_1179881794 -3 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881794 21:44296142-44296164 CACACAGTGTGGAGGCTGTCTGG 0: 1
1: 0
2: 1
3: 20
4: 210
1179881787_1179881800 14 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881800 21:44296159-44296181 GTCTGGGGGCCGTGGGCAGCTGG 0: 1
1: 0
2: 1
3: 43
4: 473
1179881787_1179881802 21 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881802 21:44296166-44296188 GGCCGTGGGCAGCTGGCCGTGGG 0: 1
1: 0
2: 0
3: 16
4: 232
1179881787_1179881797 0 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881797 21:44296145-44296167 ACAGTGTGGAGGCTGTCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 350
1179881787_1179881804 25 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881804 21:44296170-44296192 GTGGGCAGCTGGCCGTGGGCAGG 0: 1
1: 0
2: 4
3: 58
4: 426
1179881787_1179881799 7 Left 1179881787 21:44296122-44296144 CCTCGTTTTCCCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1179881799 21:44296152-44296174 GGAGGCTGTCTGGGGGCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179881787 Original CRISPR GTGGCCTCCTGGGGAAAACG AGG (reversed) Intronic
902619935 1:17644912-17644934 GTGGCCTCATGTAGAAAATGGGG - Intronic
903579415 1:24359611-24359633 GTGGCCTCTGGGGGCAAACCTGG + Intronic
904709421 1:32417510-32417532 GGGGTTTCATGGGGAAAACGAGG - Intergenic
905066528 1:35189344-35189366 GTGCCATGCTGGGCAAAACGAGG + Exonic
905486511 1:38301121-38301143 CTGGCCTCCTGGGAAACACTGGG - Intergenic
905893439 1:41530962-41530984 GTAGCCTGCTGGGGAACACGAGG + Intronic
906033353 1:42736710-42736732 GAGGCCTCCTGGAGAAAGCATGG - Intronic
907873365 1:58463442-58463464 GTGGCACCCTGGGGAGAAGGAGG + Intronic
908760313 1:67505539-67505561 GTGGCCTACTTGGGAAAACTGGG + Intergenic
910085095 1:83391841-83391863 GTGGCTTCCTGGAGAGAACTTGG + Intergenic
916591909 1:166199469-166199491 GAGGTCTCCTGGGCAAAAGGGGG + Intergenic
921159818 1:212464914-212464936 GTGGCCTCCTTGGGCAAGCCAGG - Intergenic
922586007 1:226735961-226735983 GTGCCCTCCTGGGGACAGGGTGG - Exonic
922885213 1:229014935-229014957 GTGGCCTCCCTGGGAAAACTTGG + Intergenic
1065187116 10:23179150-23179172 GTGGCCTCATGGTGAACACATGG - Intergenic
1067800917 10:49359309-49359331 GTGCACTCCTGGTGAAAACAGGG + Intergenic
1068342301 10:55721135-55721157 GTCGCATCCTGTGGAAAAGGAGG + Intergenic
1068532882 10:58209241-58209263 GTGGAGTCCTGGGGAGAACAAGG + Intronic
1070549999 10:77483492-77483514 GTCGCCTCCTGGGAAAACTGGGG + Intronic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1075102516 10:119516398-119516420 GTGTCCTCATGGGGAAAGTGGGG - Intronic
1075787880 10:125062153-125062175 GGTGCCTACAGGGGAAAACGGGG + Intronic
1076657096 10:132031928-132031950 GTGCCCTCCAGGGGGAAATGGGG - Intergenic
1077454713 11:2671639-2671661 GTGCCCTGCTGGGGAAACTGAGG + Intronic
1078557575 11:12342733-12342755 GTCTCCTCCTGTGGAAAATGGGG - Intronic
1078902038 11:15650707-15650729 GTGAGCGCCTGGGGATAACGGGG + Intergenic
1079284562 11:19117234-19117256 GTGGGCTCCTGGGGAGATGGAGG + Exonic
1079436042 11:20451742-20451764 TTTGCCTGCTGGGGAACACGTGG - Intronic
1079852739 11:25557845-25557867 GTGGACTCAAGGGGAAAACTGGG - Intergenic
1083460918 11:62811198-62811220 GTGGCCTCTTGGTGAAACCCTGG - Intronic
1083724156 11:64619656-64619678 GTGGTCTCCTGGGGAATATTAGG - Intronic
1084036535 11:66514743-66514765 CTGGGCTCCTGGGAAGAACGTGG + Intronic
1084085637 11:66853880-66853902 GGGGCCTCCTGGGGAGCATGTGG - Intronic
1085030285 11:73266879-73266901 GAGCCCTCCTGGGGAGAAGGAGG + Intronic
1085400857 11:76234702-76234724 ATGCCCCCCTGGTGAAAACGGGG - Intergenic
1087146076 11:94813039-94813061 GTGACCTCCTGCGGAGAATGGGG - Intronic
1089125069 11:116171024-116171046 GTTGCCTCCTGGTGCTAACGAGG - Intergenic
1089604200 11:119632261-119632283 GGGCCCTGCTGGGGAAAACCTGG + Intronic
1090225637 11:125070688-125070710 GAGGGCTCCTGGGGAGAACCTGG + Intronic
1090348709 11:126092369-126092391 ATGATCTCCTGGAGAAAACGAGG - Intergenic
1094223796 12:28023798-28023820 GAGGCCACCTGGGAAAAATGGGG + Intergenic
1095572504 12:43699476-43699498 GAGGCTTGCTGGGGAGAACGTGG + Intergenic
1101051557 12:100868989-100869011 GTGGCATCCTGTGGAGAAGGGGG - Intronic
1101616640 12:106344215-106344237 GTGGCAGCCAGGGGAAAATGGGG - Intronic
1103704339 12:122863179-122863201 TTGGCCTCCTGTGTAAAAGGAGG - Intergenic
1104747034 12:131216993-131217015 GTGGCTGCCTGGGGAATCCGGGG - Intergenic
1104785584 12:131446192-131446214 GTGGCTGCCTGGGGAATCCGGGG + Intergenic
1106600029 13:31179683-31179705 GTGGCCTCCAGGGAAAAATAGGG - Intergenic
1107302878 13:38984323-38984345 GAGGCCTGCTGAGGAAAATGTGG - Intronic
1111847031 13:93523938-93523960 GTGGCAACCTGGGAAAAACAGGG + Intronic
1115645837 14:35367988-35368010 GGGTCCTCCTGGGGAAGAGGTGG - Intergenic
1115789034 14:36858127-36858149 GGGACCTCCTAGGGAAAAAGAGG - Intronic
1116916530 14:50531818-50531840 GTTGCCTCTTGGGGAGAAAGCGG - Intronic
1120949288 14:90026296-90026318 GTGGCCTCCTGGGAAACCCTGGG - Intronic
1121338003 14:93088985-93089007 GTGACTTCCTGGGGAGAAAGGGG + Intronic
1121467968 14:94128201-94128223 GTGGCCTCCTGTGTAAAGTGAGG - Intronic
1121720328 14:96104655-96104677 GGAACCTCCTGGGGGAAACGAGG + Intergenic
1122195156 14:100079156-100079178 GTGGGCTCCTGTGCAAAGCGAGG - Intronic
1122395349 14:101424558-101424580 GTGGCCTTCTGGGAGAAACCTGG - Intergenic
1122858174 14:104570014-104570036 GTGGGCTCCTGGGGAAGCCCAGG + Intronic
1124048616 15:26174789-26174811 GAGGCCACCTGAGGAAAACTTGG + Intergenic
1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG + Intronic
1128231882 15:66040931-66040953 GTGGCCTCTTTGTGAAAACCGGG - Intronic
1128890793 15:71330136-71330158 GTGCCCTCCTGGGCCAAACGAGG + Intronic
1129030136 15:72611914-72611936 GTGACCTCCTGGGGAGCAGGGGG + Intergenic
1130907865 15:88252755-88252777 TTGGCCTCCTGGGCAGAAAGGGG + Intronic
1132331476 15:101015078-101015100 GTGGCCTTCTGCAGATAACGGGG - Intronic
1132585629 16:704893-704915 GTGTCCTCCTGGGGATTAGGTGG - Intronic
1133302009 16:4788099-4788121 GTGTCCCCCTGGGGAAAGTGGGG - Intronic
1134881543 16:17748661-17748683 ATGGCCTCCTGGGGACCACAAGG + Intergenic
1135461153 16:22644141-22644163 GTGTCCTCATGGGGAAAAACAGG + Intergenic
1138492208 16:57383180-57383202 CTGGCCTCCTGGGGAATGCCTGG - Exonic
1138781828 16:59797774-59797796 GTGTGCTCCTGGTGAAAATGTGG + Intergenic
1141646321 16:85369956-85369978 GTCCCCTCCTTGGGAACACGGGG + Intergenic
1141733804 16:85839446-85839468 GGGACCTCCTCTGGAAAACGTGG - Intergenic
1142413222 16:89926469-89926491 TTGGGGTCCTGGGGAAAGCGGGG - Intronic
1142752601 17:1997927-1997949 CAGGCCTTCTGGGGAAAGCGTGG + Intronic
1142804492 17:2364258-2364280 TTGGCCTCCTGGAGCAAGCGGGG - Intronic
1144048191 17:11472097-11472119 GTGGTTGCCAGGGGAAAACGGGG - Intronic
1146943624 17:36860014-36860036 GAGGCCTTCTGGGGGAAACTTGG - Intergenic
1149046879 17:52256155-52256177 TTGGCCTCCTGGGGAATGCAAGG + Intergenic
1149618173 17:58019620-58019642 GTAGCCTCCTGGGGACAGGGTGG - Intergenic
1151062988 17:71118206-71118228 ATGGTCACCTGGGGAAAACATGG - Intergenic
1151481324 17:74371560-74371582 GTGGCCTTCTGGGCAAAGTGGGG + Intronic
1152531522 17:80922075-80922097 GTGGCCTCCTGAAGCACACGGGG + Intronic
1152574528 17:81134218-81134240 GGGGCCACCTGGGGACCACGTGG - Intronic
1152667641 17:81580513-81580535 GTGGCCTGCTGGGGTAGAGGTGG - Intronic
1154014687 18:10605648-10605670 GTGGGCTCCTGGGGACAGTGGGG - Intergenic
1154190800 18:12229927-12229949 GTGGGCTCCTGGGGACAGTGGGG + Intergenic
1156722174 18:40083670-40083692 GTGGCCTCTTGGGAAAAGTGTGG + Intergenic
1160150195 18:76392551-76392573 GTGGCCACGTGGGGGAAAGGTGG + Intronic
1160498026 18:79386540-79386562 GTGCCCTCCTGGGGAAGATGTGG - Intergenic
1160831290 19:1105945-1105967 GTGGCCTCCTGGGGGTAAGATGG + Intronic
1160831312 19:1106019-1106041 GTGGCCTCCTGGGGACAGGATGG + Intronic
1161318984 19:3632421-3632443 GTGGCAGCCTGGGGAAGAGGAGG + Exonic
1161701992 19:5800686-5800708 GTGGCCTCCTGGGGAGGGCAGGG + Intergenic
1161874241 19:6895289-6895311 GTGGCCACCTGGTGAAAATCTGG - Intronic
1162399994 19:10439834-10439856 GTGGCATCCTGGAGAGAAGGTGG + Intronic
1163138088 19:15327848-15327870 GTGGCTTCCAGGGGCAAAAGTGG + Intronic
1164723687 19:30451188-30451210 GTGGCCGCCAGGGGAAGACACGG - Intronic
1165258453 19:34594065-34594087 GTGGCTTCCTGCTTAAAACGTGG + Intronic
1165419771 19:35717160-35717182 GCTGCCTCCTGGGGAGGACGGGG - Intergenic
1165470971 19:36004402-36004424 GTGGGGTCCTGGGGATAAGGAGG - Intronic
1166351987 19:42203610-42203632 GTGGCCTCCTGTGTAAAACAAGG + Intronic
1166415864 19:42594688-42594710 GGGGTCTCCTGGGGAGGACGGGG - Intronic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1166805737 19:45485837-45485859 GTGGGCATCTGGGGACAACGGGG + Intronic
1167559119 19:50214960-50214982 GTTTCCTCCTTGGGAAACCGAGG - Intronic
1168019836 19:53601238-53601260 GTGGCTTCCTGGAAAAAAAGAGG - Intronic
1168147997 19:54430290-54430312 TTGGCCCCCTGGAGAAAACTGGG + Intronic
925068605 2:950075-950097 GTGCCCTCCTGGGGCGCACGGGG - Intergenic
926203918 2:10821435-10821457 GAGGCCTCCTGGGTAAATCGGGG - Intronic
928754270 2:34505400-34505422 GTTTCCTCCTGGGTAAAATGAGG - Intergenic
929945810 2:46370961-46370983 GTGGGCTCCTTGGGAACAAGGGG + Intronic
933392597 2:81690832-81690854 ATGGCTTCCTGGGGAAAAGATGG - Intergenic
941765458 2:169291724-169291746 GAGGCCACCTTGGGAACACGTGG - Intronic
942975109 2:182007645-182007667 GTTGCCTAATGGGGAAAACATGG - Intronic
943515373 2:188879558-188879580 GTGGACTCCTTGAGAAAATGAGG + Intergenic
946007399 2:216537298-216537320 GGGGCCTCCTGAAGCAAACGAGG - Intronic
947665738 2:231904360-231904382 GTGGCCTCCTGTGGAAGGGGTGG + Intergenic
1169205973 20:3740572-3740594 GTGAGCTCCTGGGGAAAGCATGG + Intronic
1170803297 20:19608115-19608137 GTGTCCACCTGGGGAAACCAGGG - Intronic
1171277616 20:23871448-23871470 GTGAGCTCCTGGGGAAAAGAGGG - Intergenic
1172778096 20:37419871-37419893 GTGGCCTCCTGGGAAACATGGGG - Intergenic
1172853109 20:37980990-37981012 GTGCCCTCCTGGGGGTAACAAGG + Intergenic
1177807378 21:25887421-25887443 GTTACCTCCTTGGGAAAGCGTGG + Intronic
1179881787 21:44296122-44296144 GTGGCCTCCTGGGGAAAACGAGG - Intronic
1179906242 21:44424688-44424710 GTGGCTGCCTGGGGAGGACGTGG + Intronic
1180902548 22:19385301-19385323 CTGGGCTCCTGGGGATAAGGAGG + Intronic
1180915381 22:19482465-19482487 GCGTGCTCCTGGGGAAAACTGGG + Intronic
1181623955 22:24109673-24109695 CTGGCCTCTTGGGGAACACAAGG - Intronic
1181763297 22:25072811-25072833 GTGGCCTCCTGGGAAGCAGGAGG - Intronic
1183091548 22:35525638-35525660 AAGGCCCCCAGGGGAAAACGAGG + Intergenic
1183486012 22:38088165-38088187 CTGTCCTGCAGGGGAAAACGGGG - Intronic
1184310539 22:43638457-43638479 GTGACCTCCTGGGGAAGAGTCGG - Intronic
952885574 3:38009424-38009446 TTGTCCTCCTGGGGAACACGGGG + Exonic
952947244 3:38486595-38486617 GTGGCAGACTGGGGAAAATGGGG + Exonic
953805268 3:46062727-46062749 GTTGCCTCCTGGGGAAAGGATGG - Intergenic
954198105 3:49007984-49008006 GTGGCCTCTTGGGGAAGGCGGGG + Intronic
954386512 3:50246702-50246724 GTGGGCTCCGTGGGAACACGTGG - Intronic
954807347 3:53228246-53228268 GTGGGCTCCTGGGGCATGCGAGG + Intronic
963607093 3:147421052-147421074 TTGGCCTTTTGGGGAAGACGCGG - Intronic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969494458 4:7518594-7518616 GTTGGTTCCTGGGGACAACGTGG + Intronic
969656453 4:8501461-8501483 GTTTCCTCCTGGGAAAAATGGGG + Intergenic
981026569 4:140082707-140082729 GTTGCCTTCTGGGGAAAGCCTGG - Intronic
985676319 5:1233040-1233062 GTGTGCTCCTGGGGAGACCGAGG - Intronic
985697498 5:1349020-1349042 GTGGGCTCCTGGAGAAAGAGGGG + Intergenic
985890360 5:2710531-2710553 CTGGCCACCTGGGGAAGACATGG + Intergenic
987865941 5:23538753-23538775 GTGTCCTCCTGGGGACAAGATGG - Intergenic
992007427 5:72491550-72491572 GTTTCCTCCTGTGGAAAATGGGG + Intronic
992015378 5:72569978-72570000 GGGGCCTGCTGGGGGACACGGGG - Intergenic
997337145 5:133116454-133116476 TTCTCCTCCTGGTGAAAACGTGG + Intergenic
997662394 5:135599564-135599586 GTGGGCTGCTGGGGAAACCGAGG + Intergenic
999885383 5:155917304-155917326 GTGGCCTCCTGTGTTAAACGAGG + Intronic
1004942860 6:20579580-20579602 GTATCCTCATGGGGAAAACAGGG - Intronic
1006574836 6:35037539-35037561 GTGGCCTGCTGGGGAACTCTGGG + Intronic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1007743771 6:44029758-44029780 GTGGCTTCCTGTGGAAAAGTAGG - Intergenic
1012004234 6:93692584-93692606 GTGGCTCCCTGGGCAAAAGGAGG - Intergenic
1012957721 6:105589192-105589214 GTTGTCTCCTGGGGAAAATGAGG + Intergenic
1019333492 7:471746-471768 ATGGGCTGCTGGGGAAGACGGGG - Intergenic
1022386665 7:29905776-29905798 GTGGCCTCCTGGGGATTTCAAGG + Intronic
1023534021 7:41188801-41188823 GGGGTCTCCTGGGGATAAAGGGG - Intergenic
1027301966 7:76848311-76848333 GTGGCTTCCTGGAGAGAACTTGG + Intergenic
1027367885 7:77477445-77477467 GTGCTCTCCTGGGGACAAAGAGG + Intergenic
1027558157 7:79692414-79692436 TTGGCATTCTGGGGAAAACTTGG - Intergenic
1029962705 7:104705764-104705786 GAGGCCTCTTGGGGAACAGGTGG + Intronic
1030832938 7:114249366-114249388 GGGGCCTACTGGGGGGAACGGGG - Intronic
1033025144 7:137764913-137764935 GTAGCCTCTTGGGTAAAATGTGG - Intronic
1033349068 7:140547049-140547071 TTGGCCTCATGGGGAAAGCAGGG - Intronic
1035756039 8:2033811-2033833 CTGGCCTCCTGGGGAAACTGGGG + Intergenic
1035788610 8:2283183-2283205 GTGGACTCGTTTGGAAAACGAGG + Intergenic
1035804195 8:2438522-2438544 GTGGACTCGTTTGGAAAACGAGG - Intergenic
1036803868 8:11813912-11813934 CTGGGTTTCTGGGGAAAACGTGG + Intronic
1036815468 8:11899300-11899322 GTGGCTGCCTGGGGCAAACGTGG - Intergenic
1036867920 8:12416847-12416869 CCTGTCTCCTGGGGAAAACGAGG - Intergenic
1037053660 8:14408473-14408495 GTGGCCACCTGGGTAAATGGAGG - Intronic
1039834788 8:41247858-41247880 GTGGCCTGCAGGGGAAGCCGTGG - Intergenic
1040661816 8:49583145-49583167 ATGGGCTCCTGGGCAAAAGGGGG + Intergenic
1049022232 8:139965342-139965364 GTGTCATCCTGGGGAAAAGGTGG - Intronic
1049127448 8:140804813-140804835 GTGGCCTCCCGGGGAAAGGCAGG - Intronic
1049468567 8:142764856-142764878 GGGCCCTCCTGGGGCAGACGTGG + Intronic
1049710153 8:144059783-144059805 CCGGCCTCCTGGGGACCACGTGG + Exonic
1050542389 9:6681518-6681540 TTGGGCTCTTGGGGAGAACGTGG + Intergenic
1055552710 9:77446042-77446064 GGGCCCTGCTGGGGAAAAGGCGG + Intronic
1058602356 9:106683753-106683775 GTGGCCTCCTGGGAAAGTGGAGG + Intergenic
1060531187 9:124347845-124347867 GTGGCCTCCTGGGGCTGGCGAGG - Intronic
1061076419 9:128344126-128344148 AAGGCCTCCTGGAGAAAAAGCGG + Intronic
1061938725 9:133872674-133872696 GTGGCCTCCTGGAGCACAGGAGG + Intronic
1062725345 9:138070201-138070223 GAGGCCACCTGGGCAAAGCGGGG - Intronic
1186016551 X:5201390-5201412 GTGGCCTCCTGTCAAAAACCAGG + Intergenic
1189717628 X:43882184-43882206 GTGGCTGCCTGGGGGAGACGCGG - Intronic
1189767225 X:44384217-44384239 GTTGCTTCCTGGGGAAAACAAGG + Intergenic
1196274317 X:113749051-113749073 GTGCCCTCCTAGGGAAAGAGAGG - Intergenic
1197343274 X:125300300-125300322 GTTGCATCCTGGGAAAAAGGAGG - Intergenic