ID: 1179882218

View in Genome Browser
Species Human (GRCh38)
Location 21:44297649-44297671
Sequence TGCCATCGAAGGTGTGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179882218_1179882226 13 Left 1179882218 21:44297649-44297671 CCCGCAGCACACCTTCGATGGCA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1179882226 21:44297685-44297707 CATCCAGAGCATGGCCCGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 70
1179882218_1179882228 16 Left 1179882218 21:44297649-44297671 CCCGCAGCACACCTTCGATGGCA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1179882228 21:44297688-44297710 CCAGAGCATGGCCCGTCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1179882218_1179882224 4 Left 1179882218 21:44297649-44297671 CCCGCAGCACACCTTCGATGGCA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1179882224 21:44297676-44297698 GCAGTGGGCCATCCAGAGCATGG 0: 1
1: 0
2: 2
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179882218 Original CRISPR TGCCATCGAAGGTGTGCTGC GGG (reversed) Exonic
900106534 1:983855-983877 TGCCACCCAGGATGTGCTGCTGG - Intergenic
901758653 1:11456561-11456583 GGCCATCCTAGGGGTGCTGCTGG + Intergenic
902295062 1:15461566-15461588 TGCCATTGGAGCTGTACTGCAGG - Exonic
902616245 1:17625082-17625104 TGGCATCTAACCTGTGCTGCCGG - Intronic
904170872 1:28591643-28591665 TGGCATCGAAGGGGTGATGAAGG + Intronic
907583184 1:55590444-55590466 TGCCATGGAAGGTGGAATGCTGG + Intergenic
911747474 1:101455315-101455337 TGCCCTGGCAGGTGTGCAGCTGG - Intergenic
916615604 1:166435881-166435903 TGCCATTGCAGTTGTGCTTCAGG - Intergenic
917924045 1:179774280-179774302 TACCAGCTGAGGTGTGCTGCAGG + Intronic
1065642117 10:27793901-27793923 GGACATCCAAGGTGTGCTCCTGG - Intergenic
1071252615 10:83836423-83836445 TACCATGGAGGGTGTTCTGCTGG + Intergenic
1074253074 10:111772977-111772999 TGCCAATGAAGCTGTGTTGCAGG - Intergenic
1084499281 11:69525254-69525276 GGCCACCGCAGGTGTGCGGCAGG - Intergenic
1085219682 11:74863096-74863118 TGCCATCCACTGTGTGCAGCAGG + Intronic
1085517302 11:77119023-77119045 TGACTTCGAAGATGTACTGCAGG - Exonic
1087925519 11:103914227-103914249 TGCCCTAGAAGGTTTGCTGAGGG - Intronic
1091393202 12:138521-138543 TGCCTGCGAAGGTGGGCGGCAGG - Exonic
1094318654 12:29160332-29160354 AGCCATGGAAGGTGTTATGCAGG - Intronic
1095220592 12:39608895-39608917 TGCCATGTATGGGGTGCTGCTGG - Intronic
1096156384 12:49343598-49343620 TGACAGCTGAGGTGTGCTGCTGG + Intergenic
1096195036 12:49644314-49644336 TGCCAACAATGGTGTGCTGGGGG - Exonic
1102065030 12:109967784-109967806 GGCCATGGAAAGTGTGCTGAGGG + Intronic
1102245600 12:111353775-111353797 AGCCATGGAAGGTGTGAGGCAGG + Intergenic
1102765206 12:115426937-115426959 TGCCTTGGAAGATGTGCTGATGG - Intergenic
1104146650 12:126040499-126040521 TGTCATCCTGGGTGTGCTGCAGG - Intergenic
1105881931 13:24613279-24613301 GGCCATGGAATGTGTGCTTCTGG - Intergenic
1110274028 13:73622468-73622490 TGTAATCGAAGGAGTTCTGCTGG + Intergenic
1110332713 13:74291176-74291198 TGCCATTAAATGTGTGCTTCAGG + Intergenic
1121863884 14:97344295-97344317 TGCCATAGACAGTGTGATGCTGG - Intergenic
1128558077 15:68645222-68645244 TCCCATCGAAGCAGTGCTCCCGG - Exonic
1128674408 15:69598058-69598080 AGCCATCAAAGGTGTGAAGCAGG + Intergenic
1131178567 15:90225141-90225163 GGACATCGTAGGTGTGGTGCAGG - Exonic
1132773884 16:1581141-1581163 TGTCATAGATGCTGTGCTGCTGG - Intronic
1134345953 16:13392046-13392068 TGCCAGCTGAGGTGTGCAGCAGG + Intergenic
1137016709 16:35384299-35384321 TGGCATAGAAGGTCTGCTCCTGG + Intergenic
1139307336 16:65998370-65998392 TTCCATGGATGGTGGGCTGCAGG + Intergenic
1139512756 16:67436754-67436776 TGCCATCACAGATGCGCTGCTGG + Exonic
1140877094 16:79162762-79162784 TGCCCTGGAAGCTGTGCTGGGGG + Intronic
1142110474 16:88328463-88328485 TACCGTCGAAGCTCTGCTGCTGG + Intergenic
1145211467 17:21016398-21016420 TGGGATGGAAGGTGTGCTGCTGG - Intronic
1148162162 17:45456558-45456580 TGCCAGCGAAGCTGTGCTTCAGG - Intronic
1148440480 17:47709245-47709267 TGCCCTCGAAGGCGCGCCGCGGG - Exonic
1150393396 17:64803206-64803228 TGCCAGCGAAGCTGTGCTTCAGG - Intergenic
1152465490 17:80464061-80464083 TGCCAGCGAGAGGGTGCTGCTGG + Intergenic
1157949578 18:52019561-52019583 TGCCATGGTGGCTGTGCTGCAGG - Intergenic
1161765411 19:6205164-6205186 TCCCATAGAAGGTGGGCTGGTGG - Intergenic
1164729079 19:30488296-30488318 GGCCCTCTAAGGTGTTCTGCAGG + Intronic
1165071109 19:33255318-33255340 AGCCATCCAAGGTCTGGTGCAGG + Intergenic
925047601 2:785889-785911 TGGCATTGCAGGTGTGCTGAAGG + Intergenic
925113806 2:1360438-1360460 TTCCTTCTAAGCTGTGCTGCTGG - Intronic
930731125 2:54728963-54728985 TGCCATTGGAGGGGTGCGGCTGG - Intronic
934967885 2:98738653-98738675 TGCCATGGAAGCTGTGCAGGAGG + Intergenic
936259563 2:110947402-110947424 TGTCATGGAAGGGGAGCTGCTGG + Intronic
945590573 2:211725107-211725129 TGCCATCGAGAATGTGCTGGAGG - Exonic
947236803 2:227949746-227949768 TGGCTTCAGAGGTGTGCTGCAGG + Intergenic
948059912 2:235035110-235035132 TGACATCAAAGGTGAGCTTCTGG + Exonic
948510249 2:238459109-238459131 TGGCAAGGAAGGTGTGCTCCTGG + Intergenic
1170891051 20:20375747-20375769 TGCCTTTGAATGTGTCCTGCTGG - Intergenic
1170973350 20:21137649-21137671 AGCCATTGAAAGTCTGCTGCAGG + Intronic
1172998479 20:39088701-39088723 TGCAATGGCAGGCGTGCTGCAGG + Intergenic
1179247461 21:39646107-39646129 TGCGACCGAAGGTCTCCTGCTGG + Intronic
1179882218 21:44297649-44297671 TGCCATCGAAGGTGTGCTGCGGG - Exonic
1181795220 22:25303210-25303232 TGCCCTCCAATGTGTGCTGTGGG + Intergenic
1181835761 22:25606730-25606752 TGCCCTCCAATGTGTGCTGTAGG + Intronic
1182100497 22:27654455-27654477 TGCCATCCGAGGTCTGCAGCAGG + Intergenic
952140290 3:30471330-30471352 TGCCATGGAATGTGTGGTTCAGG + Intergenic
954682487 3:52353213-52353235 TGCCATCGATGCTGAGCAGCTGG + Exonic
961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG + Intronic
970174911 4:13329897-13329919 TGCCACCAAAGATGTGCTGAAGG - Intergenic
976405599 4:84658076-84658098 TGCCAGCAAAAGTTTGCTGCAGG - Intergenic
979671693 4:123366350-123366372 TGCCATTGAAGGTGACCTGAGGG - Intergenic
981050292 4:140303197-140303219 TGCCATCCAAGATGTACTGCTGG - Intronic
982688539 4:158522436-158522458 TGCTATCATAGGTGTGCTTCTGG + Intronic
986662504 5:10071949-10071971 TGCCATATGAAGTGTGCTGCAGG + Intergenic
992989835 5:82273143-82273165 TGCCATCCAAAGAGTGCTCCTGG - Intronic
999248329 5:150167127-150167149 TGCCAGCGAAGCTGGGCTGGCGG - Exonic
1004927257 6:20427737-20427759 TGGCATGGAAGGTGTGTGGCAGG - Intronic
1005866848 6:29943335-29943357 TGCCGTCGTAGGCGTCCTGCCGG - Exonic
1007254287 6:40517754-40517776 TGCCATCAAGTGTGTGTTGCTGG - Intronic
1018313767 6:162536601-162536623 TGCCATCGATGCTGTGATACCGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1034549485 7:151811179-151811201 TGCTTTGGAAGGTGTTCTGCTGG + Intronic
1048803631 8:138218683-138218705 TGCCTTCTAAGGTTTGCTACAGG + Intronic
1050697797 9:8298346-8298368 TATCATCGTGGGTGTGCTGCCGG + Intergenic
1059989948 9:119855490-119855512 TGCCATAGGAGGTGTGATGATGG + Intergenic
1060421965 9:123475675-123475697 TGCCATCGCAGGTGTGGGGAAGG + Intronic
1062665980 9:137672123-137672145 TGCCATAGAGGGCGTGCAGCAGG + Intronic
1187692452 X:21883363-21883385 TGACATCCACGGTGAGCTGCAGG + Exonic
1196763731 X:119224038-119224060 TGGCATTGAAGGAGTGATGCAGG + Intergenic
1199866306 X:151853124-151853146 TCCAGTCCAAGGTGTGCTGCAGG + Intergenic