ID: 1179882645

View in Genome Browser
Species Human (GRCh38)
Location 21:44299991-44300013
Sequence CGCCGGGGGCGGGCCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1472
Summary {0: 1, 1: 3, 2: 29, 3: 191, 4: 1248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179882629_1179882645 10 Left 1179882629 21:44299958-44299980 CCTGCTCCGTCCAGGGTCCGTCC 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG 0: 1
1: 3
2: 29
3: 191
4: 1248
1179882625_1179882645 26 Left 1179882625 21:44299942-44299964 CCGAGGGCGCAGGATCCCTGCTC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG 0: 1
1: 3
2: 29
3: 191
4: 1248
1179882635_1179882645 -7 Left 1179882635 21:44299975-44299997 CCGTCCTGCGAGGAGGCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG 0: 1
1: 3
2: 29
3: 191
4: 1248
1179882632_1179882645 0 Left 1179882632 21:44299968-44299990 CCAGGGTCCGTCCTGCGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG 0: 1
1: 3
2: 29
3: 191
4: 1248
1179882628_1179882645 11 Left 1179882628 21:44299957-44299979 CCCTGCTCCGTCCAGGGTCCGTC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG 0: 1
1: 3
2: 29
3: 191
4: 1248
1179882630_1179882645 4 Left 1179882630 21:44299964-44299986 CCGTCCAGGGTCCGTCCTGCGAG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG 0: 1
1: 3
2: 29
3: 191
4: 1248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179882645 Original CRISPR CGCCGGGGGCGGGCCCGGGG CGG Intergenic
900109286 1:998819-998841 GGCGTCGGGCGGGCCCGGGGGGG - Intergenic
900117117 1:1033623-1033645 CGCTGGGGCTGGGCCGGGGGTGG - Intronic
900117339 1:1034239-1034261 CGCTGGCGGCCAGCCCGGGGAGG + Intronic
900190079 1:1349516-1349538 GCGCGGGGGCGGGGCCGGGGCGG - Intergenic
900307727 1:2019277-2019299 GGGCTGGGGCGGGCTCGGGGCGG + Intergenic
900314523 1:2050354-2050376 CGGGGCGGGCGGTCCCGGGGCGG - Intergenic
900349481 1:2227947-2227969 CGCGGGGGGCGGGGCCGGCGCGG + Intergenic
900382600 1:2392139-2392161 CCTCGGGGTCGGGCCCGGGACGG + Intronic
900417281 1:2540926-2540948 CGGCGGCGGGGGGCGCGGGGGGG - Intergenic
900427341 1:2586689-2586711 TCTTGGGGGCGGGCCCGGGGCGG + Intronic
900513145 1:3069614-3069636 CGGAGGGGGAGGGCCGGGGGTGG + Intronic
900645255 1:3706114-3706136 AGGCGGAGGCGGGCCGGGGGCGG - Intronic
900658777 1:3772742-3772764 CGCAGGGGCCGGGCCTGGGCAGG - Intergenic
901019755 1:6249691-6249713 AGCGGGGGCCGGGCCCGGGGCGG + Exonic
901066598 1:6497342-6497364 CGCGGGGGGCGGGCGGCGGGCGG + Intronic
901084640 1:6603016-6603038 AGCCGGGGGCGGGCGCCGCGCGG - Intronic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
901199164 1:7457033-7457055 CGCAGGGGGCGGGGCGGGTGAGG - Intronic
901242864 1:7704952-7704974 CGGCGGGGGCGCGCGCGGGGCGG + Intronic
901381776 1:8878992-8879014 CTCCGGGGGATGGCCCGGGGCGG + Intronic
901433876 1:9234713-9234735 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
901433885 1:9234728-9234750 CGGCGGGGGCGCGCGCGGCGGGG - Intergenic
901433891 1:9234743-9234765 GGCCGGGGGCGCGCGCGGCGGGG - Intergenic
901434000 1:9235087-9235109 CGCCGGGGCCGGGGCGGCGGCGG - Intronic
901730016 1:11272952-11272974 GGGAGGGGGCGGGGCCGGGGCGG - Intergenic
901930787 1:12595386-12595408 GCCCAGGGGCGGGCGCGGGGCGG + Intronic
902214128 1:14924049-14924071 GGGCGGGGGCGGGGCGGGGGCGG + Intronic
902214305 1:14924627-14924649 CGCCGGGGCCGGGCGCGCGAGGG + Intronic
902896954 1:19485601-19485623 CGTGGGGGGCGGGCCCGGGCCGG - Intergenic
903072175 1:20731972-20731994 CGCCGGGAGCCGGGCAGGGGCGG - Intronic
903078109 1:20787344-20787366 CGCGGGAGGCGGGGCCGGCGGGG - Intergenic
903153294 1:21428255-21428277 CGCGGGGCGCGGGGCCTGGGAGG - Intergenic
903154969 1:21436880-21436902 GGGCGGGGACGGGTCCGGGGAGG + Intergenic
903164133 1:21509285-21509307 CGCGGGGCTCGGGCCGGGGGCGG + Intergenic
903190166 1:21651901-21651923 GGGCGGGGGCGGGGGCGGGGCGG - Intronic
903263449 1:22143176-22143198 CCGGGGGGGCGGGCCGGGGGCGG + Intronic
903263452 1:22143187-22143209 GGCCGGGGGCGGGCCGAGGATGG + Intronic
903398332 1:23019737-23019759 AGCCGAGGTCGGGCCGGGGGCGG + Exonic
903467150 1:23559570-23559592 CGGCGGGGGCAGGGCCGAGGCGG - Exonic
903468370 1:23568133-23568155 CGCCGGGCGCGGGGCGCGGGCGG - Intergenic
903501017 1:23800280-23800302 CGCCAGGCGCGGGGCGGGGGCGG - Intronic
903750583 1:25618052-25618074 CGCCCGGGGCCGGCGCGGCGGGG - Exonic
903879837 1:26501000-26501022 CACCGGGGGCGGGGCCTGGAAGG + Intergenic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
903925144 1:26826645-26826667 CGGTGGCGGCGGGCCGGGGGCGG + Intergenic
903945597 1:26960324-26960346 AGCCCGGCGCGGGCCCAGGGGGG - Intronic
904049718 1:27631898-27631920 GGCCGGGGGCAGGCCAGGGCTGG + Intronic
904199765 1:28812200-28812222 CGCCGGGGGCTGGGCCGGTGCGG + Exonic
904237369 1:29123944-29123966 GGCTGGAGGCGGGGCCGGGGCGG - Intergenic
904237390 1:29123983-29124005 CGGTGGGGCCGGGCCCGGCGCGG - Intergenic
904467819 1:30718593-30718615 GGGCAGGGGCGGGGCCGGGGGGG - Intronic
904483289 1:30807383-30807405 GGCCCGGGGCGGGGGCGGGGTGG - Intergenic
904483296 1:30807394-30807416 CGGCGGGCGGCGGCCCGGGGCGG - Intergenic
904500204 1:30908795-30908817 CGCTGGGGGCGGCCCGGCGGCGG - Intergenic
904563341 1:31413166-31413188 GGGCGGGGCCGGGGCCGGGGAGG + Intronic
904690827 1:32292235-32292257 CGGCGGGGGCGGGGCCAGGCCGG + Intronic
904701701 1:32361924-32361946 CCCAGGGGGCGGGCGCGAGGCGG - Intronic
904724981 1:32539953-32539975 CGCCGCGGGGGCGCGCGGGGAGG + Intronic
904775019 1:32901246-32901268 AGCCGGGGGCGGGACCAGCGCGG - Exonic
905031204 1:34885569-34885591 GGCTTGGGGCTGGCCCGGGGCGG + Exonic
905032904 1:34899709-34899731 CTCCGGGGGTGGATCCGGGGTGG + Exonic
905201816 1:36321247-36321269 CGCTGGGGGCGGGGCCTGCGCGG + Exonic
905390847 1:37634583-37634605 CGACGGGGGCAGGCCCGGGAGGG + Exonic
905442782 1:38005563-38005585 GGCCGGGGGCGGGGTCCGGGCGG - Intronic
905647198 1:39633019-39633041 CCCCGGGGGCGGGGCGGGCGAGG + Intronic
905648272 1:39639688-39639710 GGGCCGGGGCGGGGCCGGGGCGG - Exonic
905648281 1:39639699-39639721 CCCCCGAGGCGGGGCCGGGGCGG - Exonic
905741231 1:40373577-40373599 AGCGGGGGGCGGGCCTTGGGTGG - Intronic
905789867 1:40784132-40784154 CGCGGGGGGCGTCCCCGGGCGGG - Exonic
906062534 1:42958184-42958206 CGCCGGGGCCGGGGCCGGGCCGG + Intronic
906090291 1:43172669-43172691 GGCCGGGGGCGGGGTCGGAGCGG + Intronic
906140353 1:43530804-43530826 CGCCGGGGGCGCGCACGGCAGGG + Intronic
906140478 1:43531178-43531200 AGCTGGGGGCGGTCCCGGGGGGG + Intronic
906353936 1:45086618-45086640 CCCCGGGGGCTGTCGCGGGGTGG + Intronic
906637005 1:47416476-47416498 CGCCCGCGCCCGGCCCGGGGCGG + Exonic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
907430090 1:54406487-54406509 ACGCGGGGGCGGGCCCGGGCCGG + Intronic
907442568 1:54488256-54488278 CGCCTGGGGCGGCGCTGGGGGGG + Intergenic
907477559 1:54715728-54715750 CGAGGAGGGCGGGCCGGGGGAGG + Intronic
910657411 1:89632997-89633019 CCCCGGGGCCGGGCGCTGGGCGG + Intergenic
911176139 1:94820314-94820336 AGCCGGGGCCGGGCCGGGGAGGG - Intergenic
912381322 1:109249662-109249684 CGCCGGGGCCGGGCCGGGGTCGG + Intergenic
912413624 1:109494026-109494048 TGCCGGCGGCGTCCCCGGGGAGG + Intergenic
912514668 1:110210406-110210428 GGCAGGGGGCGGGCGCGAGGTGG - Intergenic
913144514 1:115976485-115976507 CGCTGGCGGCGGGGCCGGGGCGG - Exonic
913518329 1:119623573-119623595 CGCGGGGGCCGGGCCAGCGGGGG + Exonic
914197345 1:145454443-145454465 GGCGGAGAGCGGGCCCGGGGCGG - Intergenic
914702904 1:150150232-150150254 CAGCGGGCGCGGGCGCGGGGCGG - Exonic
914993094 1:152515457-152515479 CGCCGGGGTGGGCGCCGGGGCGG - Exonic
915246281 1:154558454-154558476 GGCCGGGGGCGGCCCAGGGGGGG - Exonic
915325268 1:155078767-155078789 TGTCGGGGGCGCGCCAGGGGCGG + Intergenic
915348337 1:155209179-155209201 GGCGGGGGGCGGGCCCAGGCAGG + Exonic
915469164 1:156115400-156115422 CGCTGGGGGCAGTTCCGGGGAGG - Intronic
915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG + Exonic
915552246 1:156642035-156642057 GGGCGGGGGCGGCCCCGGGGAGG + Exonic
915557499 1:156668681-156668703 TGGCGGGGGCGGGCGGGGGGTGG - Intergenic
915586910 1:156848893-156848915 TGCCGGGGGCGGGGCCGGAGCGG - Intronic
915967840 1:160327459-160327481 CCCGGGGGGCGGGGCTGGGGGGG + Intronic
915972928 1:160366891-160366913 GGGCGGGGGCTGGCCCTGGGTGG - Intergenic
916048896 1:161021176-161021198 CGCGGAGGGCGGGGCCGGGCGGG - Exonic
916694470 1:167221539-167221561 CCCCGGGAGCGGGCCCGGGCGGG + Intronic
916890254 1:169106609-169106631 CGGCGGCGGCGGGGCGGGGGCGG - Exonic
917291600 1:173477228-173477250 CGCTGGGGGCCGGGCCGCGGGGG - Intergenic
917869464 1:179229180-179229202 GGCCGGGGGTGGGGTCGGGGCGG - Intronic
918042293 1:180920703-180920725 GGCTGGGGGCGGGCTGGGGGCGG + Intronic
919328331 1:196137416-196137438 GGCTGGGGGCGGGGCGGGGGGGG + Intergenic
919820546 1:201469265-201469287 CCCCGGGGGCGGGGCCGCAGCGG + Intergenic
919829620 1:201531400-201531422 TGTCGGGGGCAGGCCCGGGCAGG - Intergenic
920017718 1:202927111-202927133 GGCTGGGGACGGGCCCGGTGCGG - Exonic
920022656 1:202967286-202967308 GGCCGGGGGCGGGGCCGGGCAGG + Intergenic
920522213 1:206635910-206635932 AGGTGGGGGCGGTCCCGGGGAGG - Intronic
920528482 1:206685273-206685295 CTGCGGCGGCGGGGCCGGGGCGG - Exonic
920886864 1:209938107-209938129 CGCCGCGGGCGGGGCGAGGGAGG - Intergenic
921060448 1:211579667-211579689 CGGCGGGGGAGGGGCCGGAGGGG + Intergenic
922116313 1:222617935-222617957 GGGCGGGGGCGGGGACGGGGCGG - Intergenic
922116366 1:222618025-222618047 GGACGGGGGCGGGGACGGGGCGG - Intergenic
922134837 1:222814902-222814924 CGCCGGCGGCGGGCGACGGGCGG - Intergenic
922134862 1:222814964-222814986 GGCCGGGAGCGGGCCGGGAGCGG + Intergenic
922134868 1:222814975-222814997 GGCCGGGAGCGGGCGAGGGGCGG + Intergenic
922250638 1:223845996-223846018 CGCCGCGGGCGGGGTCGGCGCGG - Intergenic
922315056 1:224434619-224434641 CGCCGGGGGGCGCCGCGGGGCGG + Intronic
922526494 1:226308678-226308700 GGCCGGGGGAGGGCTCGGGCTGG - Intronic
922526714 1:226309455-226309477 CGCCGGGAGCGGGGCCCGGGCGG - Exonic
922730727 1:227947735-227947757 CGGGGGCGGCGGGGCCGGGGCGG - Intronic
922739364 1:228006869-228006891 CGCCGGGGCCGGGGCCCGGGCGG - Intergenic
922753748 1:228082889-228082911 CGACAGGGCCGGGCCGGGGGCGG + Intronic
922821255 1:228487360-228487382 CGCCGGGGACGCGCACGGGGCGG - Exonic
923372454 1:233327632-233327654 GCCTAGGGGCGGGCCCGGGGGGG + Intergenic
923631162 1:235650112-235650134 CGGGGGGCGCGGGCCCGGGCTGG - Intronic
923859974 1:237883650-237883672 GGGCGGGGGAGGGCCGGGGGAGG + Intronic
924042612 1:239998064-239998086 CCCCGGGGACCGGCCCGGGTCGG - Intergenic
924383407 1:243483163-243483185 CGCAGGTGGAGGGCACGGGGCGG + Intronic
924415089 1:243850100-243850122 AGCCGGGGGGGGGCGGGGGGAGG + Intronic
924502801 1:244652995-244653017 CCCCGGGGGCGGGGCCGGCCCGG - Exonic
1062760150 10:11693-11715 CGCCGGGCCCGAGCCCGGCGTGG - Intergenic
1062795823 10:344385-344407 GGGCGGGGGCGGGGCGGGGGGGG + Intronic
1062843679 10:689385-689407 GGCGGGGGCCGGGCCCGGAGGGG - Intronic
1063418277 10:5890425-5890447 CGGGGGGTCCGGGCCCGGGGTGG + Intronic
1063450020 10:6144973-6144995 CGCCGGGGGCGCTCCCCGCGGGG - Intronic
1063663484 10:8048934-8048956 GGCCGGGGCCGGGCTGGGGGCGG + Intergenic
1064011852 10:11742292-11742314 AGCCGGGGGCGGGCCTCGTGGGG + Intergenic
1064274231 10:13891872-13891894 GGCCGGGCGCGGGCGAGGGGCGG - Intronic
1065100376 10:22325589-22325611 CCGCGGGGGCGGGGCCGGCGCGG - Intronic
1065367870 10:24952707-24952729 TCCCGCCGGCGGGCCCGGGGCGG - Intergenic
1065573966 10:27100230-27100252 AGGCGGGGGCGAGCCGGGGGAGG - Exonic
1066370416 10:34814847-34814869 GGCCGGGGGCGCGGGCGGGGAGG - Intronic
1067060779 10:43076996-43077018 GGGCGGGGGCGGTCCAGGGGTGG - Intergenic
1067462138 10:46465845-46465867 GGCCGGGGGCGGGGCCGAGTGGG - Exonic
1067625057 10:47918753-47918775 GGCCGGGGGCGGGGCCGAGTGGG + Intergenic
1067769812 10:49115310-49115332 CTCCGGGCGCGGGCGGGGGGCGG - Intronic
1067769911 10:49115574-49115596 CCCAAGGGGCGGGCCGGGGGCGG - Intergenic
1067841009 10:49679588-49679610 CGCGCCGGGCGGGGCCGGGGTGG - Intergenic
1069557741 10:69408792-69408814 GGACGGGGGCGGGACGGGGGCGG - Intronic
1069564003 10:69451360-69451382 GGGAGGGGGCGGGCCAGGGGCGG - Intergenic
1069988130 10:72297967-72297989 CGCCTCGGGCGGGGCTGGGGAGG - Intergenic
1070103896 10:73414061-73414083 AGCCGGGGGCGGGCCCAGGGTGG + Exonic
1070148787 10:73792777-73792799 GGCCGAGGGCGGGGCTGGGGAGG + Exonic
1070162547 10:73874656-73874678 GGCCGGGGGCCGGGCGGGGGGGG - Intergenic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070800751 10:79243268-79243290 GGCCGGGGGCGCGCGGGGGGCGG - Intronic
1070931636 10:80265000-80265022 GGTCCGGGGCGGGCCTGGGGCGG + Intergenic
1071291860 10:84194619-84194641 CGGCGGGAGGGGGCACGGGGCGG - Intergenic
1071847509 10:89535652-89535674 CGGCGGGGCCGGGCTGGGGGCGG - Intronic
1071997675 10:91163316-91163338 CGGCGGGGCCGGGCGCCGGGCGG + Intronic
1072453866 10:95560070-95560092 CGCGGGGGGCTGGGCGGGGGGGG + Intronic
1072656595 10:97334369-97334391 CCCCGGGGGCGCGCACGGCGAGG + Exonic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1072784005 10:98268272-98268294 CGCCCGGGGCGGGGCCTGCGGGG - Intergenic
1073207422 10:101776282-101776304 AGCCCGGGGCGGGGGCGGGGCGG + Intronic
1073241962 10:102065195-102065217 CGCCGAGAGCGTGCCCGGGCGGG + Intergenic
1073325804 10:102643571-102643593 CGAAGGGGGAGGGCCGGGGGAGG + Intergenic
1073432141 10:103493807-103493829 CGGCGCGGGCGGGACCGCGGCGG + Intergenic
1073470781 10:103720886-103720908 AGACAGGGCCGGGCCCGGGGAGG + Intronic
1074086181 10:110210159-110210181 CGCGCGGGGCGGGCCCGTGGCGG + Intronic
1074086230 10:110210348-110210370 CGCCGGGAGCCGGCCGGAGGAGG - Intronic
1074111210 10:110423854-110423876 GGCCAGGGGCAGGCCCTGGGTGG + Intergenic
1074169714 10:110919942-110919964 GGCCGGGGCCGGGCCTGCGGCGG + Intronic
1074546362 10:114404615-114404637 CGCTGGGGGCGAGCCCTGGCGGG - Intronic
1074772428 10:116742623-116742645 GGCCGGGGCGGGGCCCGGGGAGG - Intergenic
1074801609 10:117005654-117005676 CCACAGGGGCGGGCCCAGGGTGG + Intronic
1075031900 10:119029632-119029654 CGCAGGGGGCAGGGCCGCGGCGG + Intergenic
1075144568 10:119872493-119872515 CGCCGGGGGGCGGGCCGGGCGGG - Intronic
1075802306 10:125160796-125160818 GGCGCGGGGCGGGCCCGGGCCGG - Intronic
1075871305 10:125774097-125774119 CGCCTGGAGCGGGCTCTGGGGGG + Exonic
1076035417 10:127195805-127195827 AGCCGGGAGCGGACCCGGTGCGG - Intronic
1076370989 10:129953615-129953637 CGCTGGGAGCGGGCTCGGCGGGG - Intronic
1076542619 10:131223831-131223853 GGCAGGGGGAGGGCCAGGGGAGG - Intronic
1076576866 10:131475217-131475239 CGCCCGGGGCAGGCCTGGGTGGG - Intergenic
1076678025 10:132158088-132158110 TGCCGGGGGCGGGGCGGGGCGGG - Intronic
1076683512 10:132186870-132186892 TGCCGGGGGCGGAGCCGGGGTGG + Intergenic
1076707091 10:132307982-132308004 CGCTGGGGGCGGGGCAGGGGCGG + Intronic
1076707141 10:132308115-132308137 AGCCGGGGGCGGGGCAGGGGCGG + Intronic
1076722098 10:132397185-132397207 CGGCGGCGGCGGGGCGGGGGCGG + Exonic
1076749992 10:132537747-132537769 AGCCCGGGGCGGGGCCTGGGCGG - Intergenic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1076821192 10:132940540-132940562 CCCTGGGGGTGCGCCCGGGGAGG + Intronic
1076879103 10:133231216-133231238 CGACGGGGGCGCGGCCGGAGGGG - Exonic
1076993825 11:289069-289091 AGGCGGGGGCGGTCCCTGGGCGG - Intergenic
1076998659 11:311332-311354 GGCCGGGGACGTGCCCGAGGGGG - Intronic
1077000084 11:318427-318449 GGCCGGGGACGTGCCCGAGGGGG + Intergenic
1077008400 11:369605-369627 CCTCGGCCGCGGGCCCGGGGTGG - Intergenic
1077008516 11:369979-370001 CGCGGGGGGCGGGGGCGGCGCGG + Intronic
1077043728 11:535447-535469 GGCCGGGGCCGAGGCCGGGGCGG + Exonic
1077076908 11:706158-706180 CGGCGGGGCCGGGCCGGGGCGGG - Exonic
1077090745 11:777255-777277 CGCCGGGCAGGGGCCGGGGGAGG - Intronic
1077090837 11:777540-777562 GGCCGGGGGCGGAGCCGGGTGGG + Intergenic
1077103658 11:832889-832911 AGGCCGGGGCGGGGCCGGGGCGG + Exonic
1077105897 11:842561-842583 CGCCCGGGGCGGGGCCTGGGGGG - Intergenic
1077121505 11:910947-910969 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
1077360419 11:2138185-2138207 GGCCGGGGCCGGGGCTGGGGCGG - Intronic
1077360816 11:2139504-2139526 TTGCGGGGGCGGGCCGGGGGCGG - Intronic
1077404652 11:2377626-2377648 CGCCGGGGGCCGGGGCGGGAGGG + Intronic
1077409124 11:2395342-2395364 CGCCTGGGGCGGGGCGGGGTGGG + Intronic
1077419812 11:2444941-2444963 CGCTCGGGGCGGGGCCGGAGGGG - Intronic
1077464883 11:2729067-2729089 CGCCTGGGGCAGGCGGGGGGTGG - Intronic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1077495476 11:2884839-2884861 GTCCGGGGCCGGGGCCGGGGCGG + Exonic
1077495894 11:2886262-2886284 CGCCGGGGTCCGGACCGGGCCGG - Intergenic
1077582090 11:3423153-3423175 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1077635886 11:3841060-3841082 GGCTGGGGGCGGGCCGGGGCTGG - Intergenic
1077637839 11:3855627-3855649 GGCGCGGGGCGGGCCCGGGGCGG - Intronic
1078139668 11:8682950-8682972 TGGCCGGCGCGGGCCCGGGGCGG + Intronic
1078190846 11:9091625-9091647 GGGCGGGGCCGGGCCGGGGGTGG - Intronic
1078594451 11:12674570-12674592 GGCGGGGCCCGGGCCCGGGGCGG + Exonic
1079122514 11:17695906-17695928 GGCCGGGGCCGGGGCCGGGCCGG + Intergenic
1079135759 11:17775290-17775312 CACTGGGGGCTGGCCTGGGGGGG - Intronic
1079250145 11:18781143-18781165 GGGCCGGGGCGGGGCCGGGGGGG - Intronic
1079284500 11:19116984-19117006 CGGCACGGGCGGGCCGGGGGTGG + Intergenic
1079350117 11:19685116-19685138 CGCTGGAGGCTGGCCCAGGGTGG - Intronic
1081705610 11:45180755-45180777 CGGCCGGGGCGGGCGCGGGCGGG - Intronic
1081804960 11:45885556-45885578 CTCCGGGGGCGGGGCTGGCGGGG + Intergenic
1081807873 11:45900094-45900116 GTCAGGGGGCGGGGCCGGGGCGG - Intronic
1081870734 11:46381570-46381592 CGCCGGGGTCGGGGGCGGTGCGG + Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083329660 11:61891611-61891633 GGCCGGGGCCTGGCCGGGGGCGG - Intronic
1083448507 11:62726991-62727013 CGGCGGGGCCGGGCCCGGCGGGG - Exonic
1083572704 11:63768775-63768797 CGGCGCGGGCTGGACCGGGGTGG + Exonic
1083651806 11:64208539-64208561 GGCCAGGGACTGGCCCGGGGCGG - Intronic
1083684719 11:64369364-64369386 GGCCGGGGGCGGGGCCTGGGTGG + Intronic
1083686643 11:64380492-64380514 AGCCGCGGGCAGGCACGGGGCGG + Intergenic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1083753865 11:64778564-64778586 CCGCGGGGGCGGGCCGGGGGCGG + Intronic
1083952089 11:65962112-65962134 CGCAGGGGGCGGGTCGGGCGGGG + Intronic
1084000258 11:66292105-66292127 GGCCGGAGCCGGGCCTGGGGCGG + Intronic
1084109219 11:67002732-67002754 CCCGGGGGCAGGGCCCGGGGAGG - Intergenic
1084146171 11:67266496-67266518 AGCCGGGGCCGGGCCCGAGCCGG + Exonic
1084239008 11:67805970-67805992 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1084276216 11:68052219-68052241 GGCCAGGGCCGGGCCCAGGGTGG + Intergenic
1084364075 11:68686233-68686255 GGGCGGGGGCGGACACGGGGAGG - Intronic
1084387950 11:68855697-68855719 GGCCGGGGGCGGGTCCGCCGGGG - Intergenic
1084833424 11:71786870-71786892 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1084936621 11:72590322-72590344 AGCCGGCGGCGGGCCCGGCGCGG - Intronic
1084946678 11:72642463-72642485 GGGCCGGGGCGGGGCCGGGGCGG - Intronic
1084946683 11:72642473-72642495 GGCGGGGGGCGGGCCGGGGCGGG - Intronic
1084946690 11:72642484-72642506 GGCCGGGGGCGGGCGGGGGGCGG - Intronic
1084946698 11:72642495-72642517 GGGCCGGGGCGGGCCGGGGGCGG - Intronic
1084973066 11:72781790-72781812 CGCGGGGCTGGGGCCCGGGGCGG - Intronic
1085094372 11:73747438-73747460 GGCCGGGGGCGGGGCGGGGGGGG - Intronic
1085123616 11:73982877-73982899 CTCGGGGGCGGGGCCCGGGGTGG + Exonic
1085321553 11:75577324-75577346 GGGCGGGGGCGGGGGCGGGGGGG - Intergenic
1085332915 11:75668067-75668089 AGCCGGCGGCGGGCCCCGGCCGG - Exonic
1085456926 11:76670685-76670707 CCCCGGGGTCTGGCGCGGGGTGG - Intronic
1087175189 11:95089748-95089770 CGGCGGGGGCGGGTCCGCGTCGG - Intergenic
1088172845 11:107017864-107017886 AGCCGGGGTCGGGGCCGGGGCGG + Exonic
1088259124 11:107928353-107928375 GGACGGGGGCGGGGCGGGGGCGG - Intergenic
1088406040 11:109480267-109480289 AGCGGGGGGCGGGGGCGGGGGGG - Intergenic
1088522267 11:110712471-110712493 CGGAGGGGGCGGGCCCGAGGCGG - Intronic
1088527372 11:110771662-110771684 TGTCGGGGGCGGGCAGGGGGTGG + Intergenic
1088823490 11:113475305-113475327 GGGCGGGGCCGGGCGCGGGGCGG + Exonic
1089208919 11:116787910-116787932 GGCAGGCGGCGGGGCCGGGGCGG + Exonic
1089533848 11:119149209-119149231 GGGCCGGGGCGGGGCCGGGGCGG - Exonic
1089692990 11:120198151-120198173 CGCTGGAGGCAGGCCTGGGGAGG + Intergenic
1090178605 11:124673755-124673777 CGGCAGGGGCGGGGCCTGGGCGG + Exonic
1090788398 11:130069686-130069708 GGCCGGGGGCGGGGCCGGGCGGG + Intergenic
1091286753 11:134412276-134412298 GGGCGGGGGCGGGGCGGGGGCGG - Intergenic
1092159869 12:6310443-6310465 CGCGGGGGTCTGGCCCGGAGTGG + Intronic
1092204418 12:6606748-6606770 CGGCGCGGGGGGGCCAGGGGAGG + Intronic
1092409696 12:8243599-8243621 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1092849279 12:12612118-12612140 AGCCGGGGGAGGGCTCCGGGAGG + Exonic
1093464844 12:19439374-19439396 CGCCGGGGCGGGGGCGGGGGCGG + Intronic
1094588678 12:31800989-31801011 CGGCGGGGGCGGGGGCGGGAGGG + Intergenic
1094703935 12:32896839-32896861 CGCGGGGGGCGGGCCAGGGGCGG - Intronic
1095440799 12:42237798-42237820 GGCGGGGGGCGGGGCGGGGGCGG - Intronic
1095949276 12:47773168-47773190 CGCTGGGGGCGGGCCGGGGGCGG + Intronic
1096078486 12:48818878-48818900 CGCCGGGGGCGGGAGCGGCCCGG - Exonic
1096143800 12:49264589-49264611 GACCGGGGGCGAGGCCGGGGCGG + Intronic
1096178373 12:49538031-49538053 GGGCGGAGCCGGGCCCGGGGCGG - Intergenic
1096241337 12:49961809-49961831 GGCCGGGCGCGGGGCCGGCGCGG - Intergenic
1096260230 12:50085575-50085597 GGCCGGGGGCGGGGCCGAGCGGG + Intronic
1096466229 12:51848791-51848813 CCCTGGGGGCGGGCGAGGGGAGG - Intergenic
1096482484 12:51951806-51951828 CGGCGGGTCCGGGCCCCGGGGGG + Exonic
1096634320 12:52948971-52948993 CGCGGGGGTGGGGCCCGGGGCGG + Exonic
1096796757 12:54082596-54082618 GGCCGGGGCCGGGGCCGGGCTGG + Intergenic
1096796762 12:54082602-54082624 GGCCGGGGCCGGGCTGGGGGAGG + Intergenic
1097019184 12:56007786-56007808 AGCCGGGGGCGGGGCCTGAGGGG + Intronic
1097190387 12:57216775-57216797 CGCTGGGGGCGGGGCGCGGGCGG - Exonic
1097193732 12:57232655-57232677 AGCCTGGGGAGGGCCCGGAGAGG - Intronic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1097675989 12:62603108-62603130 CGCCGAGAGCGGGCCGGCGGCGG + Exonic
1097925438 12:65121611-65121633 CCCCGGGGGCGGGGCCGCGAGGG + Intergenic
1098024709 12:66189439-66189461 CGGCGGGGACCGGCCGGGGGCGG + Intronic
1098320531 12:69239492-69239514 CGACAGGGGCCGGCCGGGGGCGG - Intergenic
1098426112 12:70366680-70366702 CGCCGGGGGCGGGAGGGGGCGGG + Exonic
1100553752 12:95672203-95672225 TGCGGGGGGCGGGCGGGGGGAGG + Intronic
1101150223 12:101877212-101877234 CGCCGGCGGCGGGACCTCGGAGG + Intergenic
1101371715 12:104137578-104137600 CGTTGGGCGCGGGGCCGGGGCGG - Intronic
1101371958 12:104138335-104138357 GGCCGGGGGCGGGGCGGGGCGGG - Intergenic
1101371970 12:104138352-104138374 GGCCGGGGGCGGGGCGGGGCCGG - Intergenic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1102253993 12:111405852-111405874 CGACAGGGGCGGGGCAGGGGCGG - Intergenic
1102300336 12:111766860-111766882 AGGCGGGGGCGGGCCGGGGGCGG - Intronic
1102471396 12:113161792-113161814 GGGCGGGGGCGGGGGCGGGGAGG - Intronic
1103074206 12:117969093-117969115 CGCCGGGGCCGGGGCCCGGCTGG - Intergenic
1103488233 12:121296875-121296897 CGGCGGGGGCGCGCAGGGGGCGG - Intronic
1103509857 12:121466999-121467021 GGCCGGGGCCGGGCCCGAGCGGG - Intronic
1103883289 12:124182921-124182943 AGCCGGGGGAGGGGCGGGGGTGG - Intronic
1103905984 12:124327377-124327399 AGACGGGGGCGGGGCGGGGGTGG + Intronic
1104001636 12:124863975-124863997 GGCCCGGGGCGGGGTCGGGGCGG + Intronic
1104376174 12:128267084-128267106 CGGCGGGGGCGGGGCCCGGGCGG + Intergenic
1104449039 12:128854242-128854264 AGCCCGGCGGGGGCCCGGGGAGG + Intronic
1104697155 12:130872196-130872218 AGCCGGGGCCAGGGCCGGGGCGG + Intronic
1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG + Intronic
1104874107 12:132021211-132021233 GGGCGGGGGCTGGCCTGGGGTGG - Exonic
1104901094 12:132189884-132189906 GGCCGGGGGAGGCGCCGGGGAGG - Intergenic
1104930965 12:132339297-132339319 CGCCGGAGGCTGGCCCAGGTGGG - Intergenic
1104941374 12:132397138-132397160 GGCCAGGAGGGGGCCCGGGGAGG - Intergenic
1104963214 12:132497937-132497959 CTCCTGGGGTGGGGCCGGGGAGG - Intronic
1104980576 12:132571550-132571572 GGGCGGGGGCGGGCGTGGGGCGG + Intronic
1105012030 12:132762130-132762152 GGGCGGGGCCGGGCGCGGGGCGG + Intergenic
1105389045 13:19958688-19958710 CGGCGCGGCCGAGCCCGGGGAGG - Exonic
1105440925 13:20415115-20415137 GGCCGGGTGCGGGCGAGGGGAGG - Intronic
1105943405 13:25170683-25170705 CGCCGAGCCGGGGCCCGGGGAGG - Exonic
1106157520 13:27171852-27171874 CGCCGGGGCGGAGCCGGGGGCGG - Exonic
1107250033 13:38349472-38349494 GGCCGGGGGCGGGGCTGGGGCGG - Intergenic
1107467637 13:40665126-40665148 CGGCGGGGGAGGGCGCGGCGAGG - Intronic
1107603999 13:42040727-42040749 GGCCGGTGGCTGGCCCCGGGCGG + Intronic
1108350349 13:49585656-49585678 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1108577774 13:51804157-51804179 CCCGGGGGGCGGGACCAGGGCGG - Intronic
1108643637 13:52406175-52406197 CGTCGGGGGCGGGCCCCGCGGGG - Intronic
1110356754 13:74575889-74575911 GGCCTGGGGCCGGGCCGGGGCGG - Intergenic
1111396066 13:87671795-87671817 CGGCGGCGGCGGGCTCGGCGCGG + Intergenic
1111672465 13:91348067-91348089 CGGCGGCGGCGTGGCCGGGGCGG + Intergenic
1111812002 13:93102794-93102816 CGGCGGGGGCGGGGCGGAGGGGG + Intergenic
1112271948 13:97976604-97976626 GGGCGGGGGCGGGCCCAGCGCGG - Intronic
1112290647 13:98142520-98142542 GGACGTGGGCGGGCGCGGGGTGG + Intergenic
1112344286 13:98577149-98577171 CGCGGGGGCCGGGCCGGGGCGGG - Intronic
1112344383 13:98577353-98577375 CGGCTGGGGCGGGCGCCGGGAGG + Intronic
1112580863 13:100675109-100675131 AGGCGGAGGCGGGGCCGGGGCGG + Intergenic
1112692892 13:101916651-101916673 CCCCGGGAACGGGTCCGGGGAGG + Intronic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113517697 13:110915496-110915518 GGCCGGGGGCGGGGCCTGGCTGG + Intergenic
1113543076 13:111123868-111123890 GGCAGGGGGCGGGGCCGGGGGGG - Intronic
1113546376 13:111154031-111154053 AGACGGGGTTGGGCCCGGGGTGG + Intronic
1113759648 13:112838487-112838509 CGGCAGGGGCGGCTCCGGGGTGG - Intronic
1113768302 13:112894248-112894270 GCCCGGGGGCGGGGGCGGGGCGG - Intergenic
1113768322 13:112894285-112894307 GGGCGGGGGCGGGCCGGAGGGGG - Intergenic
1113825700 13:113251528-113251550 TGCTGGGGGAGGGCCCGGGTGGG + Intronic
1113841649 13:113364358-113364380 GGGCGGGGGAGGGCCGGGGGAGG + Intergenic
1114070086 14:19098958-19098980 CGCCTGGGGTCGGCCCGGCGGGG + Intergenic
1114259145 14:21025104-21025126 GGGCTGGGGCGGGCCGGGGGCGG - Intronic
1114270643 14:21098249-21098271 GGCCGGGGGCGGGGGCCGGGTGG + Intronic
1114270713 14:21098434-21098456 GGCGGGGGCCGGGCCGGGGGCGG - Exonic
1114516170 14:23301628-23301650 CGGCGGGGGCGGGGCCGGACCGG + Exonic
1114674238 14:24430206-24430228 CGCGGTGGGCGGGCCCGGCCCGG + Intronic
1115120065 14:29927866-29927888 CGCCGGGCGGGGGCCGGGGCGGG + Intronic
1115490203 14:33951133-33951155 TCCCGGAGGCGGTCCCGGGGCGG - Intronic
1116435025 14:44887064-44887086 CGGCAGGGGCCGGCCCAGGGCGG - Intergenic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1116945281 14:50830717-50830739 GGGCGGGGGCGGGCCGGCGGGGG - Intronic
1116950209 14:50872295-50872317 CGTCGGGGCCCGGCCAGGGGTGG - Intronic
1117424544 14:55580596-55580618 AGCCGGGGTCGGGCCCAGAGCGG - Intronic
1117427028 14:55610890-55610912 CGCCCGGGGCGGGAAGGGGGCGG - Intronic
1118638076 14:67766438-67766460 CGCTGGGGGCCTGGCCGGGGTGG + Exonic
1118797035 14:69153047-69153069 CGCGGGGGGAGGGCCGGGTGGGG - Exonic
1119286389 14:73458353-73458375 GGCCGGGGCCGGGGCCAGGGCGG - Intronic
1119330133 14:73787294-73787316 AGCCGGGGGCGCGGGCGGGGCGG - Intronic
1119418652 14:74493338-74493360 CTGTCGGGGCGGGCCCGGGGAGG + Exonic
1119418664 14:74493403-74493425 AGCCGGGGGCGGGGCGCGGGCGG - Exonic
1120976578 14:90254215-90254237 CAGAGGGGGCGGGGCCGGGGTGG - Intergenic
1121050322 14:90815972-90815994 CGCGGTGTGGGGGCCCGGGGGGG - Intronic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121127775 14:91418562-91418584 TGGTGGGGGCGGGCCCGGGTCGG - Intergenic
1121776187 14:96592685-96592707 AGCCGAGGGCCGGCGCGGGGCGG - Intergenic
1122131025 14:99604522-99604544 CGCCGGGAGCCGGCCGCGGGCGG - Intergenic
1122183303 14:99971337-99971359 CGCGAGGGGCGTGGCCGGGGTGG - Intergenic
1122326478 14:100883656-100883678 TTCCGGGGGCGGGCCTCGGGGGG + Exonic
1122436725 14:101706004-101706026 CGCCGCGGCCGGGCATGGGGAGG + Intergenic
1122541677 14:102501183-102501205 CGGCGGGGGCGGGGCATGGGGGG + Exonic
1122543372 14:102509716-102509738 CGCCGGCGGCGGGCGGCGGGCGG + Exonic
1122581991 14:102777142-102777164 CGGCGGGGGCGCGGCGGGGGCGG + Intergenic
1122582079 14:102777383-102777405 CGCGGGCGGCGGGGGCGGGGCGG + Intergenic
1122582205 14:102777783-102777805 TGCCCGGCGCGGGCCCGGCGCGG + Intronic
1122630177 14:103104088-103104110 TGGAGGGGGCGGGCCCTGGGGGG + Intronic
1122649901 14:103220583-103220605 GCCCGGGGGCGGGGCTGGGGTGG + Intergenic
1122658516 14:103279099-103279121 CGCGGGGGTCTGGCCTGGGGCGG - Intergenic
1122736696 14:103847606-103847628 CGCTGGGGGCGGGGCCTGCGGGG - Intergenic
1122791225 14:104185034-104185056 AGCCGGGGGCGGCCCTGGTGGGG - Intergenic
1122880736 14:104689515-104689537 GGCCGGGGGCGGGGCCTGGGGGG - Intergenic
1122889009 14:104724142-104724164 GGCCGGGGGAGGGCCAGGGCGGG - Intergenic
1122889014 14:104724153-104724175 GGCAGGGGGCGGGCCGGGGGAGG - Intergenic
1122904550 14:104795766-104795788 GGCGCGGGGCGGGCGCGGGGCGG - Intergenic
1122917335 14:104865214-104865236 GGGCGGGGGCGTGCCCGGGGCGG + Intergenic
1122960974 14:105093518-105093540 CCCGGGGCGCGGGCCGGGGGCGG - Intergenic
1122975290 14:105168436-105168458 CGGCGGCGGCGGGGCCGGGCGGG - Exonic
1123007910 14:105333302-105333324 CGCCTGGGGCAGGCCAGGGGAGG - Intronic
1123964000 15:25438223-25438245 GGACGCGAGCGGGCCCGGGGCGG - Intronic
1124249807 15:28099349-28099371 GGCCGGGGGCGTGCCTGGGTGGG - Exonic
1124410575 15:29433103-29433125 CGTCGGGGGCTGGCCCAGGCAGG - Intronic
1124414910 15:29466671-29466693 CCCCAGGGGAGGGCCCGGGGAGG + Intronic
1124415036 15:29466976-29466998 CCCCAGGGGAGGGCCCGGGGAGG + Intronic
1124427019 15:29570864-29570886 CGCCGGGAGCGGGCCGGGCCGGG + Intergenic
1124640023 15:31391596-31391618 GGGCGGGGGCGGGGGCGGGGTGG - Intronic
1124640357 15:31392812-31392834 GGGCGGGGGCGGGGGCGGGGTGG - Intronic
1124816065 15:32993898-32993920 AGCCGGGGGCGGGGTGGGGGGGG + Intronic
1125464082 15:39934035-39934057 CGCCGGGGACGGGCCGTAGGCGG - Intergenic
1125503356 15:40252858-40252880 CGCCGGGCGGGCGCCCGCGGAGG - Exonic
1125664132 15:41417024-41417046 CGTCGGGGGCGGGGCAGGGCGGG + Intronic
1125664151 15:41417078-41417100 AGCAGGGGGCGGGGCCAGGGGGG + Intronic
1126113266 15:45187688-45187710 CGCGGGGGGCGCGGCCGGAGAGG + Intronic
1126940397 15:53759733-53759755 CTGCGGGGGCAGGACCGGGGCGG - Intronic
1127293672 15:57591869-57591891 GGCCGGGGGCGGGGCCGGGCCGG - Intergenic
1127867122 15:63042284-63042306 CGCCGGGGGACGGCACAGGGGGG + Intergenic
1127877169 15:63121777-63121799 GGCAGGGGGCGGGACGGGGGTGG - Intergenic
1128078314 15:64841823-64841845 GGGCCGGGGCGGGGCCGGGGAGG - Intergenic
1128149840 15:65355881-65355903 CGCCGGGGCCGGGCCCAGCTGGG - Intronic
1128743692 15:70099374-70099396 CGGCCGGAGCGGGCGCGGGGAGG - Intergenic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129287970 15:74541154-74541176 GGGCGGGGGCGGGGGCGGGGCGG - Intergenic
1129330872 15:74826540-74826562 AGGTGGGGGCGGGCCCGGGCGGG + Exonic
1129330890 15:74826586-74826608 CGTGGGGCGCGGGCCCGCGGCGG + Exonic
1129386992 15:75201841-75201863 GGCTGGGGGCGGGGCGGGGGCGG - Intronic
1129468497 15:75737686-75737708 GGGCGGGGGCGGGGGCGGGGTGG + Intergenic
1129540259 15:76342573-76342595 CGGGCGGGGCGGGCCCGGTGGGG + Intergenic
1129752777 15:78077557-78077579 AGCCCGGGGCGGGTCCGGCGCGG - Exonic
1129848647 15:78779601-78779623 CCCCGGGTGCAGGCCCAGGGAGG - Intronic
1129853730 15:78810453-78810475 CGTCGGAGGCCGGCCCGGCGGGG + Intronic
1129933622 15:79431951-79431973 CCGAGGGGGCGGTCCCGGGGAGG - Intergenic
1130076680 15:80695593-80695615 AGCCTGGGCCGGGGCCGGGGCGG - Exonic
1130253276 15:82314345-82314367 CCCCGGGTGCAGGCCCAGGGAGG + Intergenic
1130531129 15:84748535-84748557 CTCCGGGGGCGGAGCGGGGGCGG - Intergenic
1130656525 15:85795073-85795095 GGCCGGGGGCGGGGAGGGGGGGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131822382 15:96286052-96286074 TGCTGGGGGCGGGTCCGGGGAGG + Intergenic
1132055646 15:98648866-98648888 GGGCGGGGGCCGGCGCGGGGCGG + Intergenic
1132178441 15:99733455-99733477 CCCTGGGGGCGGGACTGGGGAGG + Intronic
1132462234 16:61352-61374 GGCTGGGGGCGGGGCCGGCGGGG - Intronic
1132464743 16:72364-72386 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1132519865 16:382029-382051 GTCGGGGGGCGGGACCGGGGGGG + Intronic
1132537900 16:492411-492433 CTCCCGGGGAGGGCCCTGGGCGG - Intronic
1132555319 16:569662-569684 TGACGGGGGCGGGACCGGGCTGG + Intronic
1132579991 16:680372-680394 GGCCGGGGGCGGGACCAGCGGGG - Exonic
1132604575 16:788411-788433 GGCCGGGGGCGGGCCGGGGGGGG - Intergenic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132670600 16:1100800-1100822 CGCGGGGGGAGGGGGCGGGGAGG + Intergenic
1132671203 16:1102904-1102926 AGCCGGGAGGGGGGCCGGGGGGG - Intergenic
1132683446 16:1153017-1153039 GGCCGGGGGCGGGGCGGGCGGGG - Intergenic
1132683454 16:1153028-1153050 GGCCGGGGCGGGGCCGGGGGCGG - Intergenic
1132694514 16:1195905-1195927 TGCTGGGGGCGGGGCCGAGGGGG - Exonic
1132741333 16:1414759-1414781 CGCGGGGGGCGTGGCCGCGGGGG - Intergenic
1132741340 16:1414774-1414796 GGCTGGGGGCGGGGCCGCGGGGG - Intergenic
1132741368 16:1414828-1414850 GGCCGGGGGCGGGGCTGCGGGGG - Intergenic
1132779359 16:1614322-1614344 GGCCGGGGCCGGGGCCGGGCAGG + Intronic
1132805041 16:1771460-1771482 CGCGCGGCGCGGGCCGGGGGCGG - Intronic
1132805484 16:1773270-1773292 GGCCGGGGCCGGGGACGGGGCGG + Exonic
1132842303 16:1984091-1984113 CGCGGGGGCCGGGCCCGAGCCGG - Intronic
1132843655 16:1990325-1990347 CGGCGGGGGAGGGGCCGGCGAGG - Intronic
1132851478 16:2026817-2026839 CGGCGGGGGCGGGGAAGGGGCGG + Intronic
1132889442 16:2196630-2196652 GGCGGGGGGCGGCCCGGGGGCGG + Intergenic
1132889495 16:2196779-2196801 GTCCCGGGGCGGGCGCGGGGAGG - Intergenic
1132987819 16:2777192-2777214 CGGCCGGGCCGGGCCGGGGGCGG - Intronic
1133032929 16:3020313-3020335 AGGCGGGGGCGGGGGCGGGGCGG + Exonic
1133048123 16:3100313-3100335 CGGAGGGGGCGTGTCCGGGGCGG + Intergenic
1133121564 16:3611707-3611729 CGCCGGGCGCGGGCCCGCGGCGG + Intronic
1133219921 16:4315649-4315671 GGCCGGGGGCGGGGCCGCGGGGG + Intronic
1133219951 16:4315743-4315765 CGCGGGGAGCGGGCACCGGGAGG - Intronic
1133232104 16:4371793-4371815 CCCGGGGGGCGGGCCCGCCGCGG - Intronic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1133286744 16:4694248-4694270 GGCGGGGGGCGGGGCCCGGGCGG - Intronic
1133328716 16:4958190-4958212 CGCCTGGGGCGGGGCCAGAGTGG + Intronic
1133350623 16:5098231-5098253 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
1133350669 16:5098382-5098404 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1133661640 16:7924163-7924185 CGGGGGTGGCGGGCCAGGGGAGG - Intergenic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1133784447 16:8963629-8963651 GGCCGCGGGCCGGCCGGGGGCGG + Intronic
1133802101 16:9092310-9092332 GGCCGGGGCCGGGCCCGGGCGGG - Intronic
1134012613 16:10866500-10866522 CTCCTGGGGTGGGCCCGGAGTGG + Intergenic
1134070176 16:11255830-11255852 AGCAGGCGGCGGGCGCGGGGCGG - Intronic
1134070277 16:11256098-11256120 CGCCGCGGGCGGGACGGCGGGGG + Exonic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134482283 16:14630151-14630173 AGGCGGGCGCGGGCCCGGGTGGG - Exonic
1134849749 16:17470498-17470520 CCCCAGGCGCGGGCGCGGGGAGG - Exonic
1135335799 16:21599904-21599926 GGCTGGGGCCGGGGCCGGGGCGG + Intronic
1136129607 16:28211662-28211684 CGCGGGGGTCGGGCCCGGGCGGG - Exonic
1136192181 16:28623113-28623135 CGCCGGTGAGGGGCCGGGGGGGG - Exonic
1136284719 16:29234021-29234043 CGGTGGGGGCGGGGACGGGGCGG + Intergenic
1136364922 16:29805622-29805644 CGCCGGGGGCACGGACGGGGCGG - Intergenic
1136460503 16:30407570-30407592 CTCCGGGGGCGGGGAGGGGGCGG - Exonic
1136534972 16:30893959-30893981 GGCCGGGGCCGAGCCCGCGGCGG + Exonic
1136535061 16:30894204-30894226 CCAAGGGGGCGGGCCCGGGTCGG - Exonic
1136628733 16:31477100-31477122 GGCAGGGGGCGGGCCCTCGGGGG + Intronic
1137454846 16:48610193-48610215 CGGCGGGGCCCGGCCCGCGGCGG - Exonic
1137601255 16:49757884-49757906 AGCCGAGGGCGGGTCAGGGGAGG - Intronic
1137683317 16:50369105-50369127 GGCCGAGGGCGGGGCCGGGGCGG + Intergenic
1138178744 16:54928896-54928918 AGCCGGGGGCGGGCGCTGAGGGG + Intergenic
1138360690 16:56425195-56425217 CGCCGGGGCCGGCCTCGGGCTGG + Exonic
1138398888 16:56730010-56730032 GGCCGGGGGCGGGGCGGAGGTGG - Intronic
1138450730 16:57092418-57092440 CGCCGGGCGCGGGCTGGGAGCGG + Intergenic
1139387032 16:66579360-66579382 CGTCGGGGGCCGGCGCGTGGAGG + Intergenic
1139528571 16:67530533-67530555 CGGTCGGGGCGGCCCCGGGGTGG + Intronic
1139529797 16:67537537-67537559 CGCGGGGGGCGAGCGCGGGTCGG + Intronic
1139546583 16:67652712-67652734 AGCCCGGGGCGGGACCTGGGCGG + Intronic
1139546737 16:67653189-67653211 GGCCGCGGCCGGGCCCGGGTCGG - Exonic
1139576789 16:67847081-67847103 CGCCGGGGGGGGGGGAGGGGAGG - Intronic
1139584478 16:67893187-67893209 GGTCGGGGGCGGGTCGGGGGCGG - Intergenic
1139776251 16:69318786-69318808 GGCCGGGCCCGGGCCCGGGCCGG + Intronic
1139826637 16:69762433-69762455 TGCACGGGGCGGGCCGGGGGCGG + Intronic
1140442510 16:74998893-74998915 GGCCGGGGGCGGGCGGTGGGTGG + Intronic
1140442636 16:74999299-74999321 AGCGGCGGGCGGGCGCGGGGAGG - Exonic
1140927572 16:79599176-79599198 CGGCGGGGGCGCGGCGGGGGCGG - Exonic
1141054750 16:80804559-80804581 GGCCGGCGGCGGGCGCCGGGCGG - Intergenic
1141083833 16:81077241-81077263 CGCTGGGGGCGGGACCGCGGCGG + Exonic
1141168879 16:81678639-81678661 CCCCGGGGGCGGGCACGCGGGGG - Intronic
1141608576 16:85169240-85169262 CGGCGGCGGCGGGGCCCGGGCGG - Intergenic
1141620504 16:85234740-85234762 CTGCGGGGGCGGAGCCGGGGCGG - Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1141694875 16:85614437-85614459 CGCCGGGTGGGGGACCAGGGGGG + Intronic
1141709416 16:85689170-85689192 CGGGCGGGGCGGGGCCGGGGTGG - Intronic
1141828635 16:86497619-86497641 GGCCGGGGGCGGGGGCGGGGCGG - Intergenic
1142089738 16:88203489-88203511 CGGTGGGGGCGGGGACGGGGCGG + Intergenic
1142136217 16:88453154-88453176 CGCTGGGGGCGGAGCCGGAGAGG + Intergenic
1142177297 16:88651085-88651107 GGCTGGGGGCGGGGCCTGGGCGG - Exonic
1142209849 16:88803870-88803892 CGATGCGGGGGGGCCCGGGGCGG - Exonic
1142231136 16:88900837-88900859 CGCCGATGGTGGGCCCTGGGAGG - Intronic
1142293018 16:89201349-89201371 CGCGGGGCGCGGGCCCGGGGCGG + Intronic
1142350045 16:89575691-89575713 GCCGGGGGGCGGGGCCGGGGAGG - Intergenic
1142367560 16:89657988-89658010 CCCTGGGCGCGGGCCCAGGGCGG + Intronic
1142417043 16:89948831-89948853 CGGCGGGGTCGGGGCCGGCGGGG + Intronic
1142417051 16:89948846-89948868 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417059 16:89948861-89948883 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417111 16:89948966-89948988 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417119 16:89948981-89949003 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417164 16:89949071-89949093 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417170 16:89949086-89949108 CGGCGGGGACGGGGCCGGCGAGG + Intronic
1203001579 16_KI270728v1_random:168616-168638 CGGAGGGGTCGGGTCCGGGGTGG + Intergenic
1142550119 17:732933-732955 TGGCGGGAGCGGGGCCGGGGCGG + Intronic
1142623754 17:1179987-1180009 CGCGGGGGGCGGGGCGGGGGTGG + Intronic
1142671972 17:1491614-1491636 CGGCGCGGGCGGGGCCGGGCTGG + Intronic
1142762400 17:2050183-2050205 CGCAGGCAGCGGGCCGGGGGCGG + Intergenic
1142811948 17:2399646-2399668 GGCCGGGGGCGGGGCCTGGGCGG - Intronic
1142836859 17:2593859-2593881 CGCTGGGCCCGGGCCCGGGGAGG - Exonic
1142848131 17:2691932-2691954 GGGCGGGGGCGGGGCCGCGGGGG - Intronic
1142848149 17:2691965-2691987 TGGCGGGGGCGGGGGCGGGGCGG - Intronic
1142848156 17:2691976-2691998 CGGCGGGGGCGTGGCGGGGGCGG - Intronic
1142876298 17:2853653-2853675 CGCGGGAGGCGGGGCCGGGGCGG + Intronic
1142989934 17:3723803-3723825 CGCCAGGGCCGGGGCCGGGACGG - Intronic
1143183438 17:4997703-4997725 CGTCGGGGGCTGACCCGCGGGGG - Intergenic
1143562672 17:7705023-7705045 CGCCGGGGGCTGAGGCGGGGCGG + Intergenic
1144500854 17:15786247-15786269 GGGCGGGGGGCGGCCCGGGGCGG - Intergenic
1144806729 17:17972606-17972628 CTTTGGGGGCGGGCCAGGGGAGG - Intergenic
1145163015 17:20588909-20588931 GGGCGGGGGGCGGCCCGGGGCGG - Intergenic
1145265909 17:21379520-21379542 CTCCAAGGGCAGGCCCGGGGAGG - Intronic
1145912914 17:28552672-28552694 CCCCAGGGGCGGGGCCGGGGCGG - Intronic
1146062731 17:29615612-29615634 GCCCGGGGGCGGGACTGGGGAGG - Exonic
1146183066 17:30709443-30709465 CGCCGGGGGCTGGGGCGAGGCGG - Intergenic
1146382593 17:32341942-32341964 GGCCGGGGGCGGGGCCGCAGGGG + Intronic
1146581137 17:34039957-34039979 CCCCCTGGGCAGGCCCGGGGCGG + Intronic
1146654455 17:34626806-34626828 CCGGGGGGCCGGGCCCGGGGTGG + Intronic
1147000623 17:37359415-37359437 GGCCGCGGGCGGGCCGCGGGCGG + Intronic
1147150316 17:38510371-38510393 CGGCGGGCGCGGGGCCTGGGGGG + Exonic
1147168705 17:38606051-38606073 CGGCGGGGGCGGGGGAGGGGAGG + Intergenic
1147392985 17:40121834-40121856 GGCCGGGGGCCGGCGAGGGGAGG - Intergenic
1147617173 17:41836295-41836317 GGCCGGGGGCGGGGCGGGGGTGG + Intronic
1147629246 17:41919186-41919208 GGCCGGGGCGGGGCCCCGGGTGG + Intronic
1147931419 17:43983839-43983861 CGCCTGGGGAGGACCCGGGGAGG - Intronic
1147966943 17:44199088-44199110 CGCCGGGGCCGGCGCCGGGCCGG + Intronic
1147986124 17:44308659-44308681 CGCCGGGGGAGGGAGCGAGGGGG + Exonic
1148108692 17:45132581-45132603 GGAAGGGGGCGGGGCCGGGGCGG + Exonic
1148284088 17:46372776-46372798 CGGCGGGGGCGCGCGCGCGGCGG + Intergenic
1148306309 17:46590697-46590719 CGGCGGGGGCGCGCGCGCGGCGG + Exonic
1148337462 17:46851405-46851427 GGGCGGGGGCGGTCCAGGGGCGG + Intronic
1148391553 17:47276408-47276430 CCCCTGGGGCAGGCCTGGGGAGG + Intronic
1148491282 17:48025332-48025354 CTCCAGGGGCGGGGCCGGGGTGG + Intergenic
1148553503 17:48564422-48564444 GGGCGGGGGCGGGGGCGGGGTGG - Intronic
1148601731 17:48899286-48899308 CGGCGGGGGCGGGGGGGGGGGGG + Intergenic
1148733434 17:49851381-49851403 CGCGGGAGCCGGGCCGGGGGCGG + Intergenic
1148818222 17:50345989-50346011 GGCCGGGGGCGGGGCCTGCGGGG - Intergenic
1148818228 17:50346000-50346022 CGCCGGGGCGGGGCCGGGGGCGG - Intergenic
1148852450 17:50561540-50561562 GGCCGGGGGCCGGCCGGGGCCGG + Exonic
1149614812 17:57988432-57988454 GGCTGGGGTGGGGCCCGGGGCGG + Intergenic
1150108628 17:62479189-62479211 CCCCCTGGGCAGGCCCGGGGCGG - Exonic
1150311169 17:64130270-64130292 GGCCGAGGGCGTGCCCCGGGCGG + Intronic
1150326682 17:64263317-64263339 CGGCGGCCGCGGGCGCGGGGCGG - Intergenic
1150388850 17:64779741-64779763 GGGCGGGGGCGGGCCCGGCTCGG - Intergenic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150489038 17:65561768-65561790 CGCGGGGGGCTGGCAGGGGGCGG - Intronic
1150676003 17:67245980-67246002 CGCCGGCTGCGGGCTCCGGGCGG + Intronic
1151535941 17:74738748-74738770 CCCCTGGGGCAGGCCCGGGGAGG - Intronic
1151555255 17:74843275-74843297 CTCTGGGGGCGGGTCGGGGGTGG + Exonic
1151711419 17:75809090-75809112 GGGCGGGGGCGGGGGCGGGGGGG + Intronic
1151939032 17:77281373-77281395 GGGCGGGGGCGGGGCCGGGGCGG + Intronic
1152183527 17:78840325-78840347 GGGCGGGTGCGGCCCCGGGGCGG - Intronic
1152396372 17:80035930-80035952 GGCAGGGGCCGGGCCGGGGGCGG - Intergenic
1152426295 17:80220416-80220438 CGCCGGGGACAGGCCGGGGCGGG - Exonic
1152628688 17:81399927-81399949 CGGCCGGGGCGGGCGCGGGACGG + Intronic
1152689695 17:81712369-81712391 CGCCGGGGTAGGGCCGGGGTCGG + Exonic
1152699231 17:81810956-81810978 TGGGGGGGGCGGGCCCAGGGTGG + Intronic
1152720849 17:81923263-81923285 GGCCGGGGGCGGGGGGGGGGGGG - Intronic
1152790024 17:82273744-82273766 CTCCAGGGGCGGGGCCGGGCGGG + Intergenic
1152870629 17:82751568-82751590 GGGCGGGGGCGGGGCGGGGGCGG - Intergenic
1152870833 17:82752214-82752236 GGCCGCGGGCGGCCCCGAGGAGG + Exonic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1152953057 18:12047-12069 CGCCGGGCCCGAGCCCGGCGTGG - Intergenic
1153040913 18:812333-812355 GTCAGGGGGCGGGGCCGGGGGGG - Intronic
1153201918 18:2655788-2655810 CGCTGGGCCCGGGCCCGGTGAGG + Exonic
1153565674 18:6414958-6414980 CGCGCGGGGCGGGCAGGGGGCGG - Intronic
1153911464 18:9709015-9709037 AGCCGAGGGCGCGGCCGGGGTGG + Intronic
1154125608 18:11689658-11689680 GGCCAGGGCCGGGGCCGGGGCGG - Exonic
1155258083 18:24015262-24015284 CGCGCGGGGCGGGCGCGCGGCGG - Intronic
1155284115 18:24271541-24271563 CGCCGGGGGACGGAGCGGGGAGG - Intronic
1155570251 18:27185037-27185059 CGCCGGGAGCGGGCTCTGGTGGG - Intronic
1156008626 18:32471141-32471163 CTCCGGGGACGGGCCTGGGCGGG - Intergenic
1156099629 18:33578369-33578391 CGCGGCGGGCGGGCCGGGGGCGG - Intergenic
1156350431 18:36297659-36297681 CGCGGGGGGCGGGGCGGGGGCGG - Intergenic
1156448589 18:37254046-37254068 GGCCGGGGGCGGGGCCCGAGGGG - Intronic
1156448595 18:37254057-37254079 CACCGGGGCGGGGCCGGGGGCGG - Intronic
1157446298 18:47749044-47749066 TGCCGGGCGCGGGCGAGGGGAGG - Intergenic
1157794259 18:50560059-50560081 GGCTGGGGCCGGGGCCGGGGCGG + Exonic
1158194154 18:54866280-54866302 CGCGGGGGGCAGGGGCGGGGAGG - Intronic
1158435898 18:57435536-57435558 CGCCCGGGGTGGGGGCGGGGTGG - Intergenic
1158658173 18:59359428-59359450 CGCAGGGGGCGGGTCTGGGGCGG + Exonic
1158954063 18:62523292-62523314 CGCCGGGGGAGGGCCGGGGCCGG - Exonic
1158976705 18:62716473-62716495 AGCCGGGGGCCGGCCTCGGGGGG - Exonic
1159298224 18:66523898-66523920 CTCCGGGGGTGGGGGCGGGGGGG + Intronic
1159511248 18:69400826-69400848 GGGAGGGGGCGGGCCGGGGGGGG - Intergenic
1159961110 18:74556390-74556412 CGCCGGGGGCGGGGAGGGTGAGG - Exonic
1160163212 18:76491271-76491293 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1160163328 18:76491551-76491573 GGCGGGGGGCGGGCGCCGGGGGG + Intronic
1160163379 18:76491696-76491718 GGCTGGGGGCGGGTCGGGGGGGG - Intronic
1160499180 18:79394115-79394137 AGCCGGGGCCGGGGCGGGGGCGG - Intergenic
1160500749 18:79400253-79400275 CCCGGGGGGCGGGGGCGGGGCGG + Intronic
1160508282 18:79439335-79439357 CTCCTGGGGCGGGGCCGGAGCGG - Intronic
1160518850 18:79493221-79493243 CGCTGGGGGCGGACTCGCGGTGG + Intronic
1160630991 18:80246652-80246674 GCCCGGGGACGCGCCCGGGGAGG + Intronic
1160691434 19:462051-462073 CGCCGCCCGCGGGGCCGGGGAGG + Intergenic
1160719081 19:589807-589829 CGGCGGGGGAGGGGCGGGGGAGG - Intergenic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160725013 19:614024-614046 GGCCGGGGGCGTGGCCGGGGCGG + Intronic
1160744455 19:704107-704129 TGCAGGGGGCGGGGTCGGGGCGG + Intergenic
1160766023 19:808458-808480 AGGCCGGGGCGGCCCCGGGGTGG + Intronic
1160766819 19:812539-812561 GGCCGGGGGCGGGCGGGGGGCGG - Exonic
1160789740 19:917932-917954 CAGCGCGGGCGGGCCCGGGCGGG + Intronic
1160792578 19:929443-929465 CGGCGGGGGCGGCCCCTGCGGGG - Exonic
1160822527 19:1065182-1065204 CGCCGGGGTCGGGCTGGGGGAGG + Intronic
1160864105 19:1249608-1249630 GGGCGGGGGCGGGCGCGGAGAGG + Intronic
1160869246 19:1269503-1269525 GGGAGGGGGCGGGCCCGGGGTGG + Intronic
1160909282 19:1467434-1467456 CTCCTGGGCCGGGGCCGGGGCGG - Exonic
1160914866 19:1491588-1491610 CGTCGGGGGGCGGCCAGGGGCGG - Intronic
1160930718 19:1568366-1568388 TCGCGGGGGCGGGGCCGGGGCGG - Intergenic
1160930752 19:1568432-1568454 CGCGCGGGGCGGGGCCGGGGCGG + Intergenic
1160951885 19:1671824-1671846 GGCCGGGGGAGGGCGCGGTGGGG - Intergenic
1160967708 19:1753854-1753876 CGCCGGGGGCGCGGGCGGCGCGG + Exonic
1160979995 19:1812352-1812374 GGCCGGGGGCGGGGCCTGGAGGG + Intergenic
1160992209 19:1864418-1864440 CGCCCGCGGCGGGGCCCGGGAGG + Intergenic
1161018007 19:1992957-1992979 GGCTGGAGGCGGGGCCGGGGTGG - Intronic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161175826 19:2841718-2841740 CGCGGGAGGCGGGGCCGGGCGGG - Intronic
1161194680 19:2979804-2979826 TGCCGGGGGCGGGCGGGGGAGGG + Intronic
1161203649 19:3029231-3029253 CGCGGGCGGCGGGCCCCGCGCGG + Intronic
1161266359 19:3366520-3366542 CGCCGGCCGCGGGGCGGGGGGGG + Intronic
1161266406 19:3366674-3366696 CGCCGGCGGGGGGCCGGGCGAGG - Intronic
1161306711 19:3572923-3572945 CGACGGGGGCGGGCTGCGGGCGG + Exonic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1161471126 19:4457324-4457346 CGCAGGGGGCGGGGCGGGAGGGG - Intronic
1161505081 19:4639509-4639531 AGCCGGGGCCGGGGCCGGGGCGG - Intronic
1161608748 19:5229447-5229469 GGCCGGGGACGGGCTCCGGGCGG - Intronic
1161672767 19:5623407-5623429 CCCCGAGGGCGGGCACAGGGTGG + Intronic
1161703071 19:5805332-5805354 TGCCCGGGGGGGGCCCGGGCCGG - Intergenic
1161752882 19:6110357-6110379 CGGCCGGGCTGGGCCCGGGGCGG + Intronic
1161802707 19:6424706-6424728 CGGCGGGGCCGGGCCTGGCGCGG + Exonic
1161925042 19:7293864-7293886 CACCGGGGGCCGGCGGGGGGCGG - Exonic
1162033243 19:7926169-7926191 CGACGGGGGCGGGGCCGCCGCGG + Intergenic
1162079358 19:8209300-8209322 AGCCCGGGGCGGGGCCGTGGGGG - Intronic
1162113277 19:8413067-8413089 TGCCTGGGGCGGGGCTGGGGCGG + Intronic
1162299341 19:9835407-9835429 CGCGGGGGTCGGGGCTGGGGCGG + Intronic
1162373295 19:10291385-10291407 CCCAGGGGGCGGGGCCTGGGAGG - Intronic
1162374468 19:10296529-10296551 CGCGGAGGGCGGACCCGAGGCGG + Exonic
1162398748 19:10432286-10432308 CGCCCGGGGCTGTCCCTGGGGGG + Intronic
1162609522 19:11738580-11738602 CGCCGGGGCCGGGGCCGCAGCGG + Intronic
1162901018 19:13795619-13795641 GGCCGGGGCCAGGGCCGGGGCGG - Exonic
1162909907 19:13842982-13843004 GGCAGGGGGCGGGCGCGGGGCGG + Intergenic
1162954313 19:14090016-14090038 CGCCGGAGGGGGGCGCGGTGCGG - Exonic
1162962498 19:14136299-14136321 GGCCGGGGTCGGCCCGGGGGTGG + Intronic
1162975729 19:14206325-14206347 CGCCGGGGGCTGGGGCGAGGCGG + Intergenic
1163034829 19:14564468-14564490 CGACGGGGGCGGGGCTGGGGAGG - Intronic
1163138633 19:15331939-15331961 GGTCGGGGGCGGGCGGGGGGCGG - Intronic
1163158020 19:15449640-15449662 GGCCGGGGGCGGGGCCGTGCAGG - Intronic
1163185039 19:15631891-15631913 GGCGGGGGGCGGGCGGGGGGGGG + Intronic
1163282311 19:16325319-16325341 CGGCGGCGGCGGCTCCGGGGCGG - Exonic
1163334309 19:16661080-16661102 CGCGGGGGCCGGGCCTGGGGTGG + Intergenic
1163368693 19:16890004-16890026 CGCAGGGCGCGGGCCCGCAGCGG - Exonic
1163390485 19:17027196-17027218 GGTGAGGGGCGGGCCCGGGGAGG - Intergenic
1163433465 19:17281993-17282015 GGCCGGGGGCGGGCCAGGAGTGG + Intronic
1163440435 19:17320037-17320059 CGACAGGGGCGGGCCCGGGGTGG + Exonic
1163573557 19:18097745-18097767 GGCCGGGGCGGGGCCGGGGGCGG + Intronic
1163597077 19:18226385-18226407 GGACCGGGGCGGGCGCGGGGGGG + Intronic
1163601446 19:18251680-18251702 GGGCGGGGGCGGGGGCGGGGGGG - Intronic
1163666667 19:18606838-18606860 GGCCGGGGGCGGGGCCGGGCGGG - Exonic
1163786436 19:19277238-19277260 CCCCCGGGGCGGGCGGGGGGGGG + Intronic
1163804060 19:19385595-19385617 CGGCCGGGGCGGGTCCGAGGAGG - Intergenic
1164159670 19:22618086-22618108 GGCCGGAGGCGGGGCCGGGCCGG + Intergenic
1164274218 19:23702649-23702671 GGGCGGGGGCGGGGGCGGGGGGG - Intergenic
1164595200 19:29527426-29527448 CGCCCGGCTCGCGCCCGGGGCGG + Intronic
1164713479 19:30375446-30375468 GGCCGGGGGCGCGCCCGGGTCGG - Intronic
1164986729 19:32653729-32653751 TGGCGGGGGCGGGGACGGGGTGG + Intronic
1164995807 19:32719975-32719997 CGGCGGGGGCCTGGCCGGGGCGG + Intronic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1165143857 19:33719240-33719262 AGCCGGGGGTGGGCCGGGTGGGG + Intronic
1165213654 19:34254509-34254531 CGCCTCGGGCGGACGCGGGGAGG - Intergenic
1165256055 19:34577804-34577826 GGCTGGGGGCGGGGCAGGGGCGG - Intergenic
1165445968 19:35856856-35856878 CCCGGGGGGCGGACCCGGGCGGG + Intronic
1165511861 19:36270752-36270774 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165512413 19:36273253-36273275 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165512960 19:36275794-36275816 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165513516 19:36278349-36278371 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165514066 19:36280883-36280905 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165514618 19:36283420-36283442 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165515170 19:36285953-36285975 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165515720 19:36288489-36288511 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165516271 19:36291026-36291048 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165516823 19:36293552-36293574 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165517376 19:36296075-36296097 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165517928 19:36298610-36298632 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165518479 19:36301145-36301167 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165519028 19:36303677-36303699 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165519578 19:36306192-36306214 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165520128 19:36308720-36308742 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165623940 19:37269861-37269883 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165624486 19:37272402-37272424 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165625029 19:37274929-37274951 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165626103 19:37279992-37280014 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165626644 19:37282519-37282541 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165627184 19:37285040-37285062 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165628263 19:37290092-37290114 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165628803 19:37292617-37292639 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165629345 19:37295143-37295165 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165629886 19:37297668-37297690 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165630429 19:37300196-37300218 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165630966 19:37302734-37302756 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165861665 19:38912256-38912278 CGCCGCGGGCGGGGAGGGGGCGG - Intergenic
1165924994 19:39321075-39321097 GGTCGGGGGCGGGCCCGCGGCGG - Intergenic
1165928599 19:39342392-39342414 CGTCGGGGCGGGGCCAGGGGCGG + Intronic
1165939159 19:39406760-39406782 GGCCGGGGGCGGGGCAGGAGGGG - Intergenic
1165939886 19:39409769-39409791 GAGCGGGGGCGGGCGCGGGGCGG + Intergenic
1166105970 19:40598215-40598237 CGGCGGGGGCGGGGCCGGGAAGG + Intronic
1166144810 19:40826494-40826516 GGGAGGGGGCGGGCCCTGGGCGG + Intronic
1166182932 19:41121713-41121735 GGGAGGGGGCGGGCCCTGGGCGG - Intronic
1166547052 19:43639904-43639926 AGGCCGGGGCGGGGCCGGGGAGG + Intergenic
1166721812 19:45001442-45001464 CGCGGGGCGCGGGGCCGGGCCGG - Exonic
1166861714 19:45815299-45815321 CGCGGGGAGCGGGCCAGGGTGGG + Exonic
1167071752 19:47226188-47226210 GGCAGGGGGCGGGCGCGGCGCGG + Intronic
1167112863 19:47472056-47472078 AGGCGGGGGGAGGCCCGGGGAGG + Exonic
1167114274 19:47479974-47479996 GGCTGCGGGCGGGACCGGGGTGG - Intronic
1167268313 19:48494036-48494058 TCCCGGGGCCGGGCCCGCGGCGG - Exonic
1167358508 19:49017929-49017951 CCCTGGGGGCGGGTCTGGGGTGG + Intergenic
1167368089 19:49065076-49065098 GGTCGGGGGCGGGGGCGGGGCGG + Intronic
1167428474 19:49441560-49441582 CGCCGGGGGCGGGGCGCGGGAGG + Intronic
1167445287 19:49533881-49533903 GGCCGAGGGCGGGGCCGGCGCGG + Intronic
1167454466 19:49591286-49591308 CGTCCCGGGCGGCCCCGGGGTGG - Intergenic
1167463857 19:49640049-49640071 GGGCGGGGGCGGCCCCGGGGCGG - Exonic
1167507380 19:49878031-49878053 CTCAGGGGGCGGGGCCGGGAGGG - Intronic
1167510977 19:49895246-49895268 GGCAGGGGGCTGGCACGGGGTGG - Intronic
1167549224 19:50148075-50148097 CTCCGGGGGCGGGCCCAAGTTGG - Intergenic
1167622736 19:50568299-50568321 CGGCGCCGGCGGGCCCGAGGAGG - Intergenic
1167622756 19:50568341-50568363 GGCCGGGGCCGGGGCCTGGGGGG - Intergenic
1167649054 19:50719651-50719673 AGCCGGGGGCGGGCGAGGAGGGG - Intergenic
1167691100 19:50983952-50983974 CGCTGGGGCCGGGCATGGGGCGG - Intronic
1167862489 19:52297048-52297070 GGGCGGGGGCGGGGGCGGGGCGG - Intergenic
1167884904 19:52492687-52492709 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167889345 19:52527515-52527537 GGGCCGGGGCGGGGCCGGGGCGG - Intergenic
1167889351 19:52527526-52527548 GGCAGAGGGCGGGGCCGGGGCGG - Intergenic
1167894475 19:52570145-52570167 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167898520 19:52601170-52601192 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167909561 19:52690606-52690628 GGCAGAGGGCGGGGCCGGGGCGG + Intergenic
1167921588 19:52786874-52786896 GGCAGAGGGAGGGCCCGGGGCGG + Intronic
1167926075 19:52821753-52821775 CGCAGAGGGCGGGGCCGGAGCGG + Intronic
1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG + Intergenic
1167940566 19:52942715-52942737 GGGCGGGGGCGGGGCCGGGGCGG + Intronic
1167972390 19:53196886-53196908 GGCAGGGGGCGGGGCCGGGAGGG - Intergenic
1167972436 19:53197004-53197026 GGCAGGGGGCGGGGCCGGAGGGG - Intergenic
1168003475 19:53467609-53467631 CGCAGAGGGCGGGGCCGGGGTGG - Intergenic
1168056501 19:53867817-53867839 GGACGGGGGCGGGGCCGGGGCGG - Intronic
1168062094 19:53898767-53898789 CTCAGGGGGCGTGGCCGGGGGGG + Intronic
1168146031 19:54420547-54420569 GGCCGGGGGCGGGGACGGGAGGG + Intronic
1168153339 19:54460587-54460609 GGCTCGGGGGGGGCCCGGGGGGG - Intronic
1168153538 19:54461324-54461346 CGCCGCAGGCGGGCACGGGCTGG - Exonic
1168272632 19:55258483-55258505 CGCCGGCGGCGGGGCGGGGGGGG - Exonic
1168297345 19:55383858-55383880 CGCGGGGCGCTGGCCCGCGGCGG + Exonic
1168341236 19:55624315-55624337 CGCGAGGGGCGGGGCAGGGGAGG - Intronic
1168443674 19:56393466-56393488 TGCCGGGGGCGCGGCCGCGGTGG - Exonic
1168654694 19:58118472-58118494 GGGCCGGGGCCGGCCCGGGGCGG + Intergenic
925061894 2:897784-897806 CACTGGGGGGGGGCCCGGGGTGG + Intergenic
925959758 2:9003744-9003766 GGCCGGGGAGGGGCCGGGGGCGG + Exonic
926224928 2:10960906-10960928 CGCCCGGGGAGGGGCCGGCGTGG + Intergenic
926285194 2:11482646-11482668 CGCCGGGGAAGGGTCGGGGGAGG - Intergenic
926320650 2:11746577-11746599 CTTCGGGGGCGGGGCAGGGGCGG - Intronic
927153032 2:20206365-20206387 GACCGGGGGCGGGGGCGGGGAGG + Intronic
927619216 2:24634710-24634732 CTCCGGGGGCGGGGGGGGGGGGG - Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927708438 2:25311119-25311141 GGCTGGGGGCGGGGGCGGGGAGG + Intronic
927714287 2:25342114-25342136 CGCCGGGGCCGGGGCCAGCGCGG - Intronic
927956665 2:27211968-27211990 GGCAGGGGGCGGGCAGGGGGCGG - Intronic
927990200 2:27442286-27442308 CAGGGGGAGCGGGCCCGGGGCGG + Intergenic
928186562 2:29115712-29115734 CGGCGGGGTTGGGGCCGGGGTGG + Intronic
928303519 2:30147310-30147332 CGGCGGGGGCGGGCCGACGGCGG - Intronic
929033711 2:37671805-37671827 GGCCGGGCGCGCGCGCGGGGGGG + Exonic
929242307 2:39665755-39665777 CCCGGGGGCCGGGCCGGGGGCGG + Intronic
929242314 2:39665766-39665788 GGCCGGGGGCGGGCGGGCGGTGG + Intronic
929452710 2:42047889-42047911 CGCCGAGGACGGGCTCGGGCCGG + Intergenic
929604414 2:43225587-43225609 TGCCGGGGCTGGGCGCGGGGTGG + Exonic
929936418 2:46297340-46297362 GGCTTGGGGCGGGCACGGGGCGG - Intronic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
931348878 2:61470939-61470961 CGCCGGCGGCGGGGAAGGGGGGG + Intergenic
931710879 2:64988802-64988824 CGCGGTGAGGGGGCCCGGGGCGG - Intronic
931825523 2:65996625-65996647 AGACGGGGGCGGGGGCGGGGTGG - Intergenic
932316942 2:70790700-70790722 GGGCGGGGGCGGGGCGGGGGCGG + Intergenic
932475322 2:72002434-72002456 GGTGGGGAGCGGGCCCGGGGAGG - Intergenic
932613093 2:73214186-73214208 CGCCGGGGGCGGGACCAGAAGGG + Intergenic
932780123 2:74554332-74554354 GGCTGGGGGCGGGCCCGGCCAGG + Exonic
933666670 2:84970716-84970738 CGCCTGGGGCGGGCCTAGGCCGG - Intergenic
933666804 2:84971092-84971114 GGCGGGGGGTGGGCCGGGGGAGG + Exonic
934079107 2:88452440-88452462 TGCCGGGGGGGCGCCCGGGGCGG + Exonic
934539049 2:95159596-95159618 GGGCGGGGGCTGGCGCGGGGTGG - Exonic
934539060 2:95159620-95159642 GGGCGGGGGCTGGCGCGGGGTGG - Intronic
934539071 2:95159644-95159666 GGGCGGGGGCTGGCGCGGGGTGG - Intronic
934966866 2:98731141-98731163 CGGCGGGGGCGGAGCCGGCGGGG - Intergenic
934993265 2:98936147-98936169 CGCCGGGCGCAGGGCCGGGCCGG - Exonic
935046629 2:99489502-99489524 CGCCAGGGGTCGGCGCGGGGCGG + Intronic
935112345 2:100104912-100104934 CGCGCGGGGCGGGCGCGGCGCGG - Intronic
935112457 2:100105238-100105260 CGCGGGCGGCGGACCCGGGTGGG + Intronic
935237588 2:101151447-101151469 GGCCAGGGGCGGGTGCGGGGCGG - Intronic
935237600 2:101151470-101151492 GGCCAGGGGCGGGTGCGGGGCGG - Intronic
936104614 2:109613992-109614014 CTCCGGGGGCGGGGTTGGGGCGG + Exonic
936174254 2:110205071-110205093 CGCCCGGGCCGGTCCCGGGAAGG + Intergenic
936412921 2:112276080-112276102 CGGCGGGAGCGGGCCGGGGCCGG + Intronic
936433264 2:112482232-112482254 CGGCGGGGGCCGGGCCGCGGCGG + Exonic
936713661 2:115161566-115161588 CCCCGGGGGCGGGCGGTGGGGGG + Intronic
937203839 2:120223420-120223442 CGGCCGGGGCGGGCCCTGCGGGG + Intergenic
937221279 2:120344484-120344506 CGCCCCGGGAGGGCCGGGGGCGG + Intergenic
937951030 2:127388050-127388072 GGCCGGGCGCGCGCCCGCGGCGG - Intronic
937956171 2:127422851-127422873 CGGAGGGGGCGCGCCCGGGTGGG - Intronic
938073087 2:128318588-128318610 CGCGGGGCGCGGGGCCTGGGAGG + Intergenic
938073192 2:128318926-128318948 CCACGGGGGCGGGCCAGGGGCGG - Intergenic
938099197 2:128486620-128486642 GGCCGGGGGCGGGGTGGGGGGGG + Intergenic
938258302 2:129877638-129877660 GGGCGGGGGCGGGGCCGGGCCGG + Intergenic
938414443 2:131093041-131093063 GGCCGGGCGGGGGCCGGGGGCGG - Intronic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
939990661 2:148875174-148875196 GTCCCGGGGCGGGCCAGGGGAGG + Intergenic
939990916 2:148876009-148876031 CGCCGGGTGGGGGCCCGGGTGGG + Intronic
940646040 2:156393980-156394002 CGGCGGGGGCGGGAAGGGGGTGG + Intergenic
940883316 2:158968509-158968531 CGCGGGAGGCGCGGCCGGGGCGG + Intergenic
941819191 2:169827741-169827763 AGGCGGGGGCGGTCCGGGGGCGG + Exonic
942240812 2:173963731-173963753 CGGCGGGGGCGGGCCGCGCGCGG + Intronic
942449592 2:176100528-176100550 CGTGGGGGGCGGCCCCGGGGAGG + Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
944676017 2:202034513-202034535 CGCCGGGGCCGGGCCGTGGGCGG - Intergenic
944831209 2:203535309-203535331 CGGCGGGAGCGGGGGCGGGGCGG + Exonic
946246644 2:218391500-218391522 GGCAGGGGGCGGGCCCAGGAGGG + Intronic
946416715 2:219543597-219543619 CCGAGGGGGCGGGACCGGGGAGG + Exonic
946692419 2:222319505-222319527 CGGCGGTGGCGGGGCCGGGGTGG + Intergenic
947763731 2:232622469-232622491 CGCTGGGGGCGGGGGTGGGGGGG + Intronic
947860497 2:233354477-233354499 CACCGCGGGCGGGGGCGGGGCGG - Intergenic
947992280 2:234497121-234497143 GTCCGGGGGCGGGTCCGGGGCGG - Intergenic
947992293 2:234497144-234497166 GGGCGGGGCGGGGCCCGGGGCGG - Intergenic
948205204 2:236159781-236159803 AGGCAGGGCCGGGCCCGGGGTGG - Intergenic
948393334 2:237627566-237627588 GGCCGGGGCCGGGGCCGGGCCGG + Intronic
948479341 2:238240239-238240261 CCGCGGGGGCGGCACCGGGGCGG + Intronic
948945737 2:241218046-241218068 CGGCGGGGGCGGGCAGGGGCGGG + Intronic
949004404 2:241637173-241637195 GGGCGGGGGCGGGCCCGCTGCGG - Exonic
949014519 2:241701999-241702021 CGCGGGAGGCGGGGGCGGGGCGG - Intergenic
1168756767 20:324171-324193 CGCGGGGGGCGGGGTGGGGGTGG - Intergenic
1168769772 20:407981-408003 GGCTGGGGGCGGGGCCGGGGTGG - Intronic
1168769790 20:408009-408031 GGCCGGGGGCGGGGCCGGGGGGG - Intronic
1168769799 20:408020-408042 GGCCGGGGCGGGGCCGGGGGCGG - Intronic
1168769806 20:408032-408054 CGGGGTGGGCGGGGCCGGGGCGG - Exonic
1168795892 20:610060-610082 CCCCGGGGGCGGGCGGCGGGCGG - Exonic
1168804452 20:664218-664240 CGGCGGCGGCGGGGCGGGGGCGG - Exonic
1169164112 20:3407679-3407701 CGCGGCGCGCGGGCCCGGCGGGG + Intergenic
1169244591 20:4015573-4015595 CGCGAGGGGCGGGCCCGCCGGGG + Intronic
1169262432 20:4148720-4148742 CCGGCGGGGCGGGCCCGGGGAGG + Intronic
1169278607 20:4249295-4249317 CGCGGGGGGCGGGACCGAGGAGG + Intergenic
1170156617 20:13274672-13274694 CCCGGGGGCCGGGCGCGGGGGGG - Intronic
1170524777 20:17226868-17226890 GGGCGGGGGCGGGCCCGGGGCGG + Intronic
1170578602 20:17681901-17681923 GGCGGCGGGCGGGCCGGGGGAGG + Intronic
1170889914 20:20368208-20368230 CGCCGGGGCCGAGCGCGGAGGGG + Exonic
1171012135 20:21514595-21514617 TGCCGGGGGTGGGCGCGCGGGGG - Intergenic
1171012974 20:21518495-21518517 CGGCTGGAGCGGGCGCGGGGAGG + Intergenic
1171122419 20:22578474-22578496 AGCCGGGCGCGGTCCCCGGGTGG + Intergenic
1171173582 20:23035402-23035424 CTCGGGCGGCGGGCCCAGGGCGG - Exonic
1171346416 20:24469527-24469549 CGCCGGGCGCGGGGCAGCGGCGG - Exonic
1171452829 20:25248011-25248033 CGCCGGGGCGGGGCCTCGGGGGG - Intergenic
1171473647 20:25390917-25390939 GGCCGGGGCGGGGCCGGGGGAGG - Exonic
1171782030 20:29427957-29427979 CGCCAGGGGCAGGGCAGGGGGGG - Intergenic
1171848203 20:30290585-30290607 GGCCGGGGGCGGGGCCGGCCTGG + Intergenic
1172015437 20:31870272-31870294 GGCCGGGGCGGGGACCGGGGAGG + Intronic
1172118239 20:32583983-32584005 CACCCGGGGCTGGCCCGGGGAGG - Intronic
1172274985 20:33674469-33674491 CCGCGGGGGCGGGGCGGGGGCGG - Intergenic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172474591 20:35227046-35227068 CACCGGGGACGGGCCTGGGCCGG + Intronic
1173221858 20:41137875-41137897 CGCGCGGGGCGGGCCCAGGCAGG - Intronic
1173454093 20:43189771-43189793 GGCCGGGGCCGGGACTGGGGCGG + Exonic
1173454100 20:43189782-43189804 GGACTGGGGCGGGCGCGGGGTGG + Exonic
1173548137 20:43914781-43914803 CGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1173792089 20:45834245-45834267 GGCCGGCGACGGCCCCGGGGAGG + Exonic
1173821158 20:46021646-46021668 CGCGGGGGGCGGGCGGGCGGAGG + Intergenic
1173823262 20:46031778-46031800 CCCAGGGGGCGGGGGCGGGGAGG + Intronic
1174053948 20:47785547-47785569 CGCGGGGAGGGGGCCGGGGGCGG - Intronic
1174204348 20:48828036-48828058 CGCGGGGGCCGGGCGAGGGGCGG + Intergenic
1175215811 20:57391311-57391333 CGCCCGGGGCGGGGCGGGGCCGG + Intergenic
1175465988 20:59191643-59191665 CGCCGGGGGCGGCCTCCTGGAGG + Exonic
1175749211 20:61483672-61483694 CAGCGGGGGCGGGGCGGGGGGGG - Intronic
1175831098 20:61965877-61965899 GGCCGGGGGCAGGGCCGAGGCGG - Intronic
1175836791 20:62001249-62001271 CTACGGGGGAGGGCCTGGGGAGG - Intronic
1175843850 20:62048668-62048690 CGCCAGGAGAGGGCCCTGGGGGG - Intronic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1175847392 20:62065877-62065899 CGACTGGGGCGGGCGCTGGGCGG + Intergenic
1175856135 20:62122095-62122117 CTCAGTGGGCGGGACCGGGGAGG - Intergenic
1175856180 20:62122225-62122247 CGCCGGGAGCCGGCCGAGGGTGG + Intergenic
1175938701 20:62527233-62527255 CGTAGGGGGCGGGGGCGGGGGGG - Intergenic
1175963337 20:62648052-62648074 GGCTGGGGGCAGGCCTGGGGAGG - Intronic
1175994116 20:62804780-62804802 CGCGGGGGGCGGGCGGGGGGAGG - Intergenic
1176005578 20:62860954-62860976 GGCCGGGGCCGGGGCCGGGGCGG - Intronic
1176128960 20:63488210-63488232 CGCGCGGGGCGGGGGCGGGGCGG + Exonic
1176131592 20:63498851-63498873 CGGCGGGGCCGGGTCCTGGGCGG - Intronic
1176131612 20:63498888-63498910 CGGCCGGGCTGGGCCCGGGGTGG - Intronic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176143206 20:63554084-63554106 GCCCGGGGGCGGGGCGGGGGTGG - Exonic
1176159693 20:63641921-63641943 GGGCCGGGGCGGGGCCGGGGCGG - Intronic
1176159710 20:63641960-63641982 GGGCGGGGGCGGGGCCAGGGCGG - Intronic
1176159763 20:63642085-63642107 GTGCGGGGGCGGGGCCGGGGCGG - Intronic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176207210 20:63895485-63895507 CGCCGCGGCCTGGGCCGGGGCGG + Intronic
1176286695 21:5022464-5022486 GGCCGGGGGCGGGGCGGGGACGG + Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176856608 21:13979971-13979993 CGGCGGGGGCAGGGGCGGGGAGG - Intergenic
1176868963 21:14072055-14072077 CCCCTGCGGAGGGCCCGGGGTGG - Intergenic
1178104058 21:29299051-29299073 AGGCGCGGGCGGGCCGGGGGCGG + Intronic
1178951571 21:36990095-36990117 CGCCGGGGGCGTGCTGGGGCCGG - Intronic
1179209359 21:39312965-39312987 GGCCGGGGGCGGGCGGCGGGCGG + Intronic
1179209526 21:39313486-39313508 CGCCATGGCCGGGCGCGGGGCGG + Exonic
1179626893 21:42653931-42653953 CGCCGGGGCCGGGCGCGGCGGGG + Intronic
1179783868 21:43719058-43719080 GGCCGGGGGCGGACCGGGGCGGG - Intergenic
1179783874 21:43719069-43719091 CGCCGGGGGCTGGCCGGGGGCGG - Intergenic
1179810121 21:43865034-43865056 CGCGGGGGGACGGCGCGGGGGGG - Intergenic
1179810374 21:43865680-43865702 CGCCCGGGAGGGGCCCGGGCCGG + Intronic
1179870486 21:44241011-44241033 GGCCGGGGGCGGGGCGGGGACGG - Intergenic
1179881948 21:44296658-44296680 CGCAGGGGGAGGGGCCGGGGGGG - Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180014693 21:45074538-45074560 CGGCGGGGGCGGGGAGGGGGCGG + Intronic
1180042746 21:45288341-45288363 CGGCGGGGGCGGGGCGGAGGAGG + Intergenic
1180064293 21:45405055-45405077 GGCAGGGGGCGGGCGCGGGGCGG - Intergenic
1180187225 21:46145790-46145812 CGCGGGGGGAGGGGCAGGGGAGG - Intronic
1180614762 22:17120215-17120237 CGCGGGGGGCGGCCTGGGGGCGG - Exonic
1180649989 22:17369607-17369629 AGCCGAGGGCGGGCGCCGGGCGG - Exonic
1180650215 22:17370304-17370326 CGGCGGGGCCGGGCGCGGGGGGG + Intronic
1180650221 22:17370317-17370339 CGCGGGGGGGGGGCCCGCGCGGG + Intronic
1180699610 22:17774262-17774284 CACCGCGGTCGGGCCCAGGGCGG + Intronic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1180791610 22:18578066-18578088 CCTCGGGGGCGGGGCCGGGCCGG + Intergenic
1180859300 22:19068153-19068175 CGGCAGGGGCGGGCCAGAGGAGG - Exonic
1180876894 22:19178829-19178851 CGCACGGGGCGGGCTGGGGGCGG - Exonic
1181026871 22:20131875-20131897 GGCCGGGGTCGGGCCGGGGTCGG - Intronic
1181230130 22:21417244-21417266 CTGCGGGGGCGGGGCCGGGCCGG - Intergenic
1181248519 22:21517622-21517644 CTGCGGGGGCGGGGCCGGGCCGG + Intergenic
1181322917 22:22022587-22022609 CGCCTTGGGAGGGCCCTGGGAGG - Intergenic
1181514340 22:23402606-23402628 CGGCCAGGGCGGGCCGGGGGCGG + Intergenic
1181514344 22:23402617-23402639 GGCCGGGGGCGGACCCGGGCTGG + Intergenic
1181571981 22:23772775-23772797 GGCGGGGGGCGGGGCCGAGGCGG + Intronic
1181574863 22:23787285-23787307 CCGCGGGGCCGAGCCCGGGGAGG - Intronic
1182413294 22:30204971-30204993 CTCCTGGAGCCGGCCCGGGGTGG + Intergenic
1182475534 22:30574625-30574647 GGCCGGGAGCGGGCGCGGCGCGG - Intergenic
1182475573 22:30574719-30574741 GGGAGGGGGCCGGCCCGGGGCGG - Intergenic
1182494188 22:30694848-30694870 GGCGGGGGGCAGGCCGGGGGCGG - Exonic
1183201423 22:36387773-36387795 TGCCCGGGGCGGGACCGCGGTGG + Intronic
1183228146 22:36564285-36564307 CCCCGGGGGCGGGGCGGGGCGGG - Exonic
1183393722 22:37560351-37560373 TGCCGGGGAGGGGGCCGGGGAGG + Intergenic
1183924705 22:41197505-41197527 CGACGGGGGTGGGGCGGGGGAGG + Intergenic
1183956004 22:41381348-41381370 GGCGGGGGCGGGGCCCGGGGCGG - Intronic
1184034048 22:41910241-41910263 GGGCCGGGGCGGGCCGGGGGCGG + Intronic
1184361945 22:44024224-44024246 GGGCGGGGGCGGGACCGGGGCGG + Intronic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184439193 22:44498233-44498255 GGCCGGGGCCGGGGCAGGGGCGG + Exonic
1184445306 22:44543762-44543784 CGGCGGGGGCGGGCGGGGGGCGG + Intergenic
1184557464 22:45240976-45240998 GGACAGGGGCGGGGCCGGGGCGG - Intergenic
1184562127 22:45269296-45269318 GGGCGGGGGCAGGCCCCGGGCGG + Intergenic
1184568882 22:45309903-45309925 CGGCTGGGGCGGGCGCGCGGGGG + Intronic
1184580345 22:45413009-45413031 GGCCCAGGGCGGGACCGGGGCGG + Intronic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1184732370 22:46377915-46377937 CCCCGGGGAGGGGCCGGGGGAGG + Intronic
1184759755 22:46537650-46537672 GGGCGGGGCCGGGCCGGGGGCGG - Intergenic
1184759762 22:46537661-46537683 GGCCGGGGGCGGGGCGGGGCCGG - Intergenic
1184766916 22:46576992-46577014 GGGCGGGGGCGGGGCCGGGGTGG + Intronic
1184778515 22:46635186-46635208 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778554 22:46635278-46635300 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778647 22:46635508-46635530 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778666 22:46635554-46635576 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1185162000 22:49235668-49235690 CGCCGGAGGCAGCCCCGCGGGGG + Intergenic
1185259635 22:49854156-49854178 GCGCGGGGGCGGGTCCGGGGCGG - Intronic
1185278760 22:49961052-49961074 GGCCGGGGCCGGGGCCAGGGCGG + Intronic
1185285873 22:49999702-49999724 GGCCGGGGGCGGGGCGCGGGGGG + Intronic
1185325830 22:50225441-50225463 CACAGCTGGCGGGCCCGGGGAGG + Intronic
1185335095 22:50267794-50267816 AGCCGGGGGAGGGCCGTGGGGGG - Intronic
1185351745 22:50343245-50343267 GGCCGGGGGCGGGGCCGCGCGGG - Intergenic
1185395009 22:50582433-50582455 CGCCTGGGGCGGGGCGGGGCCGG - Intronic
1185397656 22:50600970-50600992 CGCCGGCGGCGGGGCTGGGGCGG - Intronic
1185409383 22:50674294-50674316 CGCCGGAGGCGGGGGCCGGGAGG - Intergenic
1185409414 22:50674363-50674385 CCCCGGGGGCGGGGGCGGCGGGG - Intergenic
1185409459 22:50674482-50674504 GGCCGGGGCCGGGGCCGGCGCGG - Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950004481 3:9682937-9682959 CTCGGGGGGCGGGGGCGGGGGGG - Intronic
950400958 3:12768909-12768931 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
950517934 3:13479787-13479809 GGCCGGGGGTGGGCTCGGGTCGG + Intronic
950522610 3:13505708-13505730 AGCCGGGGCAGGGCCCTGGGTGG + Exonic
950650212 3:14402540-14402562 GGCCGGGGGCGGGGCCGGGGCGG - Intergenic
950683984 3:14603211-14603233 CGCCGGGGGCGGGATGGCGGTGG + Intergenic
950683992 3:14603228-14603250 CGGTGGGGGCGGGCGCGGAGAGG + Intergenic
950710575 3:14810632-14810654 CGCCGGGCGGGGGCGCGGGGCGG - Intergenic
951544477 3:23810789-23810811 CGTCGGGGGCGCGCGCGGGGTGG + Intronic
952316806 3:32238810-32238832 CGCCGGGGGCTGTCCAGGCGCGG - Exonic
952334307 3:32391820-32391842 GGCCGGGGGCGGGCGGGGGCGGG - Exonic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
952908844 3:38165449-38165471 GGCCGGAGGCGGGCCCGAGGTGG + Intronic
952970950 3:38649737-38649759 GGTCGGGGGCGGGGTCGGGGCGG + Intergenic
953447360 3:42979559-42979581 CGCCGGGGGCGGCCAAGGGGAGG + Exonic
953464356 3:43105910-43105932 CGCTGGGGGCGGCGGCGGGGTGG - Exonic
953909182 3:46883197-46883219 GGCGGGGGGCGGGCCGGGGGCGG + Intronic
954004017 3:47578314-47578336 GGGCCGGGGCGGGGCCGGGGCGG - Intronic
954004024 3:47578325-47578347 GGCCGGGGGCGGGGCCGGGGCGG - Intronic
954063548 3:48088660-48088682 CGCCTCGGGCGGGCCCCGTGGGG + Intronic
954246935 3:49339691-49339713 CCTAGGGGGCGGGCCCGGCGGGG - Intronic
954327185 3:49869941-49869963 GGCCGGGGGCGGGCTGGGGGCGG + Exonic
954378053 3:50205208-50205230 GGCGGGGGGCGGGCCGGGGGCGG + Intergenic
954581789 3:51706991-51707013 GGCTGGGGGCGGGCCGGGGCCGG + Intergenic
954581796 3:51707002-51707024 GGCCGGGGCCGGGGGCGGGGCGG + Intergenic
954581801 3:51707008-51707030 GGCCGGGGGCGGGGCGGGGCGGG + Intergenic
954717990 3:52536385-52536407 GGCAGGGGGCGGGGCCGGGCCGG + Intronic
954778871 3:53045331-53045353 CCCGGGGGGCGGGTCCGCGGGGG + Intronic
954778954 3:53045612-53045634 CGTTGGGGGCGGGGGCGGGGCGG - Intronic
954812360 3:53256016-53256038 TGCCGAGGCCGGGCGCGGGGCGG + Exonic
955818796 3:62874852-62874874 CGCCGGCGCCGGAGCCGGGGTGG - Exonic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
956678127 3:71754003-71754025 GGCAGGGGACGGCCCCGGGGCGG + Intronic
957054890 3:75435578-75435600 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
957054935 3:75435729-75435751 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
958692151 3:97481688-97481710 CACAGGGGGCGGGGCCGGGGCGG - Intronic
958900097 3:99876084-99876106 CGCCGGGGCCGGGCGGGGGCCGG + Intronic
960110304 3:113838838-113838860 CGCTGGAGGTGGGCGCGGGGCGG + Exonic
960674294 3:120179881-120179903 GACCGGGGGCGGGGGCGGGGTGG - Intronic
960955428 3:123027618-123027640 CAGCGGGCGCGGGCCCGGGTGGG - Intronic
961073628 3:123961467-123961489 TGGCTGGGGCGGGGCCGGGGCGG + Intergenic
961299903 3:125915945-125915967 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
961305687 3:125958250-125958272 CGCGGGGCTCGGGCCCTGGGCGG - Intergenic
961309941 3:125990349-125990371 TGGCTGGGGCGGGGCCGGGGCGG - Intergenic
961322295 3:126084182-126084204 CGGCCGGGGCGGGGCCAGGGAGG - Exonic
961446221 3:126983008-126983030 GCCCGGGGGCGGGGCGGGGGCGG - Intergenic
961666837 3:128497938-128497960 GGCCGGGGCCGGGGCAGGGGAGG - Intergenic
961707978 3:128804105-128804127 GGGCGGGGGGGGGCCCAGGGAGG - Intronic
961754913 3:129121825-129121847 AGCCGGGGGCGGGCGGGGGCGGG - Intronic
961827559 3:129606813-129606835 GCCCGGGGGCGGGGCGGGGGCGG + Exonic
961888561 3:130111977-130111999 CTCAGGAGGCGGGGCCGGGGCGG + Intronic
961888607 3:130112128-130112150 CTCAGGAGGCGGGCCCTGGGAGG + Intronic
962277996 3:134030149-134030171 AGGAGGTGGCGGGCCCGGGGAGG + Intronic
962316805 3:134364208-134364230 GGCGGGGGGCGGGCCGGGAGCGG + Intronic
962498395 3:135965653-135965675 CGCCGAGGGTGGGGCCGAGGAGG + Exonic
962575493 3:136752037-136752059 GGCCGGGCGCGGGCCCCGTGCGG - Intronic
963091394 3:141486922-141486944 GGGCGGGGGCGGGGCCGCGGCGG + Intergenic
963213920 3:142724195-142724217 CGCAGGGGCCGCGCCTGGGGCGG - Exonic
963335671 3:143971769-143971791 AGCCGGGGGCGGGGCCAGAGGGG - Intergenic
965590797 3:170358203-170358225 GGCCCGGGGCTGGCGCGGGGAGG + Intronic
966181909 3:177196570-177196592 GGCCGGGGACGCGCCCGGGGAGG + Intronic
966743208 3:183253225-183253247 GGATGGGGGCGGGCCCGGGCGGG - Exonic
966874905 3:184315994-184316016 CCCCGGGGGCTGTCACGGGGAGG + Intronic
968090554 3:195895937-195895959 CGCGGGAGGCGGGCGCTGGGAGG - Intronic
968093014 3:195909693-195909715 CTGCGGGGGCCGGCGCGGGGCGG - Intronic
968434030 4:575912-575934 CGCCGGCGGCGGCCCCCAGGCGG + Intergenic
968450461 4:673883-673905 GACCGCGGGCGGGGCCGGGGCGG - Intronic
968478825 4:825202-825224 CCCCGGGGGCGTGCATGGGGTGG + Intronic
968479209 4:826298-826320 GGCGGGGGGTGGACCCGGGGCGG + Intergenic
968479249 4:826360-826382 GGCGGGGGGCGGACCCGGGGCGG + Intergenic
968479264 4:826384-826406 GGCGGGGGGTGGACCCGGGGCGG + Intergenic
968479307 4:826451-826473 GGCGGGGGGTGGACCCGGGGCGG + Intergenic
968523815 4:1046290-1046312 GGCTGGGGGAGGGCTCGGGGTGG - Intergenic
968541644 4:1171226-1171248 GGCCGGGGGCGGGGTCCGGGGGG - Intronic
968556561 4:1248867-1248889 GGCCGCGGGCGGGGGCGGGGCGG - Intronic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
968652928 4:1767221-1767243 CGCTGGGGCCGGGCCAGGGGCGG + Intergenic
968653075 4:1767566-1767588 GGTCGGGGGCGGGGCCGGCGGGG + Intergenic
968674681 4:1871231-1871253 CGCCGGGGCCGCGCACGGGCGGG - Intergenic
968815130 4:2818119-2818141 GGCAGGGGGCGGGGCCGGGAGGG + Intronic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
968965089 4:3765754-3765776 CGCCGGGGAGGAGTCCGGGGCGG - Intergenic
968977512 4:3829816-3829838 CGTCTGGGGATGGCCCGGGGTGG - Intergenic
968997750 4:3956035-3956057 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
969053262 4:4387071-4387093 CGCCGCGCGCGGACCCGGGAAGG - Exonic
969240212 4:5892539-5892561 CGAGGGGGGCGGGCCCCGGGAGG - Intronic
969240380 4:5893120-5893142 CGCCGGGGCGGGGCCGGGGCGGG + Intergenic
969285510 4:6199949-6199971 GGCTGGGGGCGGGACCGGGAGGG + Intronic
969285702 4:6200665-6200687 GGGCGGGGGCGGGGGCGGGGCGG - Intergenic
969344861 4:6564023-6564045 CGCGGGGTGCGGGCGCGGGGCGG + Intergenic
969460798 4:7327805-7327827 TGCCGGGGGCGGGGTTGGGGGGG - Intronic
969717070 4:8872909-8872931 GGCCCGGGGCTGGCCCTGGGAGG - Intergenic
969816627 4:9691966-9691988 CTCAGGAGGCGGGGCCGGGGCGG - Intergenic
970193170 4:13533855-13533877 TGCTGGGGGCGGGTCCTGGGGGG - Intergenic
970421074 4:15906106-15906128 GGCGGCGGGCGGGCCCGGGCGGG + Intergenic
971244139 4:24913109-24913131 GGCGCGGGGCGGGCCCGGCGGGG - Intronic
972765836 4:42151864-42151886 CGGCCCGGCCGGGCCCGGGGGGG + Exonic
972817187 4:42657156-42657178 CGCCGGGGGAGGGGCCTGCGGGG + Intergenic
973279222 4:48341721-48341743 CGGCGGCGGCGGGGCCGGGATGG + Exonic
973279287 4:48341972-48341994 GGCCCGGGTCGGGCCCGAGGCGG + Exonic
973687992 4:53393769-53393791 AGCCGGGGGCGGGGGGGGGGGGG - Intronic
975683275 4:76897003-76897025 CGCGGGGAGCGGGGCCGGGCAGG + Exonic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
976593936 4:86876359-86876381 GGCCGGGAGCGGGTCCTGGGCGG + Intronic
977607226 4:98995558-98995580 GGGCGGGGGCGGGGCCGGGGCGG + Intergenic
978490051 4:109302757-109302779 CGCCGGGAGGGGGTCGGGGGAGG - Intergenic
979259557 4:118634470-118634492 GGCCGGAGCTGGGCCCGGGGAGG - Intergenic
980730043 4:136812540-136812562 CTTGGGGGTCGGGCCCGGGGTGG - Intergenic
981942410 4:150296899-150296921 CGGTGGGGGTGGGCGCGGGGGGG - Intronic
982157213 4:152535274-152535296 CGAGGGCGGCGGGGCCGGGGGGG - Exonic
983517187 4:168670441-168670463 AGCCGGGCGCGGGCCGGGCGCGG + Intronic
984474193 4:180215959-180215981 CGGCGGGGTGTGGCCCGGGGAGG + Intergenic
984772158 4:183445139-183445161 CGCCGAGGCCGGTCCCGCGGAGG - Intronic
985542621 5:493882-493904 CAGCGGGGGTTGGCCCGGGGAGG + Intronic
985588007 5:750923-750945 CGCGGGAGGCAGGCTCGGGGAGG - Intronic
985602676 5:843390-843412 CGCGGGAGGCAGGCTCGGGGAGG - Intronic
985611630 5:892663-892685 CGCCGGCGGCGGGCCCGAGGCGG + Exonic
985761726 5:1752330-1752352 CGCTGGGGGCGGGGGGGGGGGGG + Intergenic
985762951 5:1761018-1761040 CGCCGGGCCAGGCCCCGGGGCGG + Intergenic
986330617 5:6713922-6713944 CGGCGGGGGCGGGGCCGCGTCGG + Intergenic
986608620 5:9546168-9546190 CGGCGGGGGCGGGGCAGGGGCGG - Intergenic
986733279 5:10650136-10650158 GGCCGGGGCTGGGGCCGGGGCGG + Exonic
987108738 5:14664993-14665015 CGCGGGGCGCGGGCCGTGGGCGG + Intronic
987132423 5:14871880-14871902 CCCCGGGGGCGGGCTGGGGAGGG + Intergenic
987303432 5:16617038-16617060 CGCCGAGGGCGGGGCGGCGGTGG + Exonic
988369282 5:30346017-30346039 GGCGGGGGGGGGGCCGGGGGGGG - Intergenic
988369283 5:30346018-30346040 GGGCGGGGGGGGGGCCGGGGGGG - Intergenic
988577768 5:32444031-32444053 CGCCGCGGGCCGGGCCGGGCCGG + Intronic
988777516 5:34490764-34490786 GGCCGGGGGTGGGCAGGGGGCGG + Intergenic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
990910212 5:60844433-60844455 CGGCGGAGGCGAGGCCGGGGCGG - Intergenic
990984273 5:61626624-61626646 CGGGGGGGGCGGGGCCGGGACGG + Intergenic
991371610 5:65925708-65925730 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
991707106 5:69369227-69369249 CTCCGGGGGGGGGCGGGGGGGGG - Intronic
992105791 5:73448224-73448246 CGGCGGTGGCGGGCCCCGGCTGG - Exonic
992400045 5:76403504-76403526 CGCGGGGGGCGCGCCCCGGGCGG + Exonic
992563151 5:77972584-77972606 GGCCCGGGCCGGGCCAGGGGTGG + Intergenic
992627580 5:78648928-78648950 CGCGCGGGGCGGGACGGGGGCGG + Intronic
992939511 5:81750031-81750053 CGGGAGGGGCGGGCCCGGCGGGG - Intronic
992939782 5:81750867-81750889 CGCCCGGGGAGCGCCGGGGGTGG - Intronic
994043543 5:95284443-95284465 CGGCGGGGGCGGGCGCGCTGGGG - Exonic
994072736 5:95620479-95620501 CGGCGGCGGCGGGCCCTGGGCGG + Exonic
994197418 5:96935885-96935907 CGCTGGGGGCGGGGCCTAGGCGG - Exonic
995724673 5:115170235-115170257 TGCCGAGGGCGGCGCCGGGGCGG + Intronic
996291004 5:121852134-121852156 GGCCGGCGGCGGGCCCGGTAGGG - Exonic
996582002 5:125041504-125041526 TGCTGGGGGCGGGGGCGGGGTGG - Intergenic
996785058 5:127229348-127229370 CGGCTGCGGCGGGCCCGGGCGGG - Intergenic
997129606 5:131263904-131263926 CGGCGGGGGCGGGGCCTGGCGGG + Intronic
997265170 5:132490987-132491009 CGCTCGGGGCGGGCCCGCGGTGG - Intergenic
997521608 5:134527155-134527177 TGCCGGGGGCGGGGCGGGGCCGG - Intronic
997732659 5:136192482-136192504 CGCCACGGGCGGCCCCGAGGCGG - Intergenic
997950915 5:138241964-138241986 CGCCGGAGCTGGGCCCAGGGCGG - Intergenic
997984507 5:138492095-138492117 GGACGGGGGCGGGCCGGGGGCGG - Intergenic
998018847 5:138753381-138753403 GGCGGGGGGCGGGCCGGGGGCGG + Intronic
999079066 5:148826449-148826471 CTCCTGGGGCTGGCCCGGGCGGG - Exonic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
999773678 5:154793970-154793992 GGCCGGGGACGCGGCCGGGGTGG + Exonic
1000071405 5:157743957-157743979 CGGCGGGCGCGGGCGCGGGCGGG + Exonic
1001529924 5:172454548-172454570 TGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1002006416 5:176238355-176238377 CGGCGGGGCGGGGCTCGGGGCGG + Exonic
1002197634 5:177509864-177509886 TGCCCGGGGCGGGACGGGGGAGG - Intronic
1002219964 5:177672282-177672304 CGGCGGGGCGGGGCTCGGGGCGG - Intergenic
1002521592 5:179795690-179795712 CGCGGCGGGAGGGCGCGGGGCGG + Intronic
1002524180 5:179806453-179806475 CGCCAGGTGCGGGCCGGGCGGGG + Intronic
1002527071 5:179820802-179820824 CGACGGTGGCGGGGGCGGGGAGG + Exonic
1002784971 6:393387-393409 CGGCGGGGGCGCGCCGGGGAGGG + Intronic
1002897907 6:1389901-1389923 CCGCGAGGGCGGGCCCCGGGCGG - Exonic
1002927776 6:1614755-1614777 TGCCGGGGACGGGGACGGGGCGG + Intergenic
1003046508 6:2737968-2737990 TGCCGGGGGCGGGTGGGGGGGGG + Intronic
1003074502 6:2971445-2971467 AGCCGGGGGCGCGAGCGGGGAGG - Intronic
1003175643 6:3751059-3751081 CGCCGGGGGCGCCCCCAGGCTGG + Intronic
1003291274 6:4780405-4780427 GGGCGGGGGCGGGGGCGGGGGGG - Intronic
1003325092 6:5085202-5085224 CGACGGGGGAGGGCCGGGGGCGG - Exonic
1003345289 6:5260994-5261016 GGGCGGGGGCGGGATCGGGGCGG - Intergenic
1003645587 6:7910829-7910851 CTCCGGGGCGGGGCGCGGGGCGG - Intronic
1004194001 6:13487775-13487797 CGGCCTGGGCGGGGCCGGGGAGG - Intergenic
1004924034 6:20402277-20402299 CGCCGGGGGTGGGGAGGGGGCGG + Exonic
1006047187 6:31308095-31308117 AGCCGGAGGCGGGGCCAGGGAGG + Intronic
1006300728 6:33192497-33192519 GGCCGGGGGCGGGGGCGAGGTGG - Exonic
1006300734 6:33192508-33192530 GGCGGGGGCCGGGCCGGGGGCGG - Intergenic
1006313517 6:33277553-33277575 GGCCAGGGGCGGCCCCGGTGAGG - Exonic
1006336992 6:33425995-33426017 CGGCGGGAGCTGGCCGGGGGCGG + Intronic
1006369218 6:33633822-33633844 GGCGCGGGGCGGGCGCGGGGCGG + Intronic
1006396227 6:33789127-33789149 CGCCAGGGGCGGGCGGGGGGCGG - Exonic
1006589075 6:35141169-35141191 AGCCGGAGGCGGGCCTGGGCCGG - Intronic
1006860689 6:37170087-37170109 CGCGGCGGGCGGGGACGGGGCGG - Intergenic
1007701778 6:43770118-43770140 CCCCCGGGGCGGGCCGGGGGCGG + Intergenic
1007722077 6:43890986-43891008 AGTCGGGGGCGGGCAGGGGGTGG - Intergenic
1007783201 6:44265633-44265655 CGCCGGGGGCGGGGAGGGGGCGG - Exonic
1010083099 6:71886716-71886738 CGGCGGGGGCGGGCAGGCGGAGG - Intronic
1010209884 6:73354329-73354351 GGCCGGGGGCGGGGCCTGGCCGG - Intergenic
1010872357 6:81058881-81058903 CGGCGGGGGCTGGGCGGGGGTGG + Intergenic
1011277037 6:85642250-85642272 CGCCCGGGGAGCGCCAGGGGCGG - Intronic
1013575742 6:111482718-111482740 CGCCGGGCGCGGGGCGGGAGCGG - Intronic
1014230297 6:118895012-118895034 CGCCGGGGGCAGGCGGGCGGCGG - Intronic
1015244767 6:131063322-131063344 CGCCGGGGGCTCGTCCGGCGGGG - Exonic
1015315015 6:131807935-131807957 CGCGAGGGGCGGGCGCGGCGGGG + Intergenic
1015402138 6:132798653-132798675 GGCCGGGGGCGGGGCAGGGGTGG + Intergenic
1015525855 6:134175135-134175157 CGCCGGCGGAGGGCGCGGGGAGG + Intronic
1016328157 6:142926769-142926791 CGCCGGGAGCTGGTCCGGGAGGG - Intronic
1017084094 6:150697556-150697578 CGCTGAGGGCCGGCCCTGGGAGG + Intronic
1017671835 6:156777203-156777225 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1017873078 6:158502705-158502727 GTCCAAGGGCGGGCCCGGGGGGG + Exonic
1018013588 6:159693321-159693343 CGCGGGGGGGGGGGGCGGGGCGG - Exonic
1018169032 6:161129668-161129690 CGCTGGGGGTGGGGCCAGGGTGG - Intergenic
1018331056 6:162727772-162727794 GGCCGGGCGCGGGGGCGGGGAGG - Intronic
1018400305 6:163414555-163414577 GGCCGGGGGCGGGCGGCGGGCGG - Intronic
1018628728 6:165804788-165804810 CCCCGGGGCCGGGCCGCGGGCGG + Intronic
1019111938 6:169724037-169724059 CGGAGGGGGCGGGGCCGGGGCGG - Exonic
1019520862 7:1459912-1459934 CGGCGGGGCGGGGCCTGGGGAGG - Intergenic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1019701421 7:2476475-2476497 CGCCGGGGGAGGGCTGGGGGTGG + Intronic
1019701435 7:2476502-2476524 CGCCGGGGTGGGGCTGGGGGTGG + Intronic
1019711405 7:2519716-2519738 GCACGGGGGCGGGACCGGGGCGG + Intronic
1020037717 7:4974654-4974676 CGCTGGGGGCTGGCCCGGCTCGG + Intergenic
1020106356 7:5423940-5423962 GGCCGGGGGCCGGGCTGGGGGGG - Intronic
1020109348 7:5439571-5439593 AGGCGGGGGCGGGGCAGGGGGGG - Intronic
1020162101 7:5780973-5780995 CGCTGGGGGCTGGCCCGGCTCGG - Intronic
1020177891 7:5897556-5897578 CGACGGGGGGGGGGGCGGGGGGG + Intergenic
1020178108 7:5898820-5898842 GGCCGGGAGCGGGCCCTGGGCGG + Exonic
1020252938 7:6483939-6483961 CGGCGGGGGAAGGCCCGGAGAGG - Intronic
1020274327 7:6615597-6615619 GGCCGGGGGCGGGGGCGCGGGGG - Exonic
1020274372 7:6615698-6615720 CGCGGGGGCCGGGGCGGGGGCGG - Exonic
1020278313 7:6637526-6637548 CGGCGGCGGCGGGGCCGGGCTGG + Intronic
1020304819 7:6826155-6826177 GGCCGGGAGCGGGCCCTGGGCGG - Exonic
1020418215 7:7969458-7969480 CGCCGGGAGCGGGAACGGTGCGG + Exonic
1021489284 7:21201081-21201103 GGCCGGGGGCTGGGCGGGGGAGG + Intergenic
1021510491 7:21427976-21427998 GGTCGGGGGCGGGGCCAGGGCGG - Intergenic
1021969361 7:25951375-25951397 GGCTGGGGGCGGGGGCGGGGTGG + Intergenic
1021992507 7:26152134-26152156 CCACGGGCGCGGGCCCCGGGCGG + Intergenic
1022101058 7:27169433-27169455 CGCGGGGGTCGGGCCGGGCGGGG - Intronic
1022207973 7:28180821-28180843 GGGCGGGGGCGGGGGCGGGGGGG + Intergenic
1022447027 7:30478904-30478926 CGCCCGGGTCTGGCGCGGGGGGG + Intergenic
1023000340 7:35801514-35801536 CGCCGGGGGCCAGCCCGCCGCGG - Intronic
1023773580 7:43582966-43582988 GGGCGGGGTCGGGCGCGGGGCGG + Intronic
1023937177 7:44748558-44748580 CGCCGGGAGCGGGGCGGGGCCGG - Intergenic
1024043820 7:45574460-45574482 CGCGGGCGGCGGCGCCGGGGCGG - Intronic
1025078771 7:55964783-55964805 CGCTGGGGACAGGGCCGGGGCGG - Intronic
1025604624 7:63030415-63030437 GGGCGGGGGCGGGCGGGGGGCGG + Intergenic
1026968320 7:74453994-74454016 CGCGGGGAGGGGGCGCGGGGGGG - Exonic
1027138243 7:75639308-75639330 CGCCGGGGGCGGGGGAGGCGCGG + Intronic
1028121418 7:87059714-87059736 CGCGGGGCGCGGGCGCGGCGCGG + Intergenic
1028986861 7:97016321-97016343 CGCTGGGGGTTGGCGCGGGGGGG + Intergenic
1029110557 7:98211378-98211400 CCCTCGGGGCGGGGCCGGGGCGG - Intergenic
1029238742 7:99143836-99143858 CGGCGGCGGCGGGGCCGGGCCGG - Exonic
1029440501 7:100584426-100584448 GGCCGGGGGCGGGAGCTGGGAGG + Intronic
1029490080 7:100866190-100866212 CGCCTGGGGCGGCCGAGGGGCGG + Exonic
1029640393 7:101816379-101816401 GCCCGGGGGGGCGCCCGGGGTGG - Intronic
1029640397 7:101816391-101816413 CGGCGGCGCGGGGCCCGGGGGGG - Intronic
1029644372 7:101844177-101844199 GGGCGGGGGCGGGGGCGGGGAGG - Intronic
1029708287 7:102286726-102286748 GGCCGGGGGCGGGGCCTGAGCGG + Intronic
1029708330 7:102286811-102286833 CGGCGGGGGCGGGGGCGGGGCGG + Intronic
1029746428 7:102517808-102517830 AGGCGGGGGCGGGGGCGGGGCGG + Intergenic
1029764365 7:102616787-102616809 AGGCGGGGGCGGGGGCGGGGCGG + Intronic
1030820505 7:114086480-114086502 AGTGGGGGGCGCGCCCGGGGAGG - Intronic
1031008403 7:116499592-116499614 CGCCGGGGCGGGGCTCGGGACGG + Exonic
1031919055 7:127588326-127588348 AGCCGGGGGCGGGGCCCGGACGG + Exonic
1031966593 7:128031786-128031808 CGCCGGGGGCCGGGCAGCGGCGG - Intronic
1032011639 7:128351429-128351451 AGCCGGGGACGGGGCCGGGTTGG + Exonic
1032013525 7:128361524-128361546 GGCCGGGGCTGGGCCGGGGGCGG - Intronic
1032037647 7:128531705-128531727 CCCCCTGGGCAGGCCCGGGGCGG - Intergenic
1032781495 7:135168293-135168315 TGCCGGGGGGGGGCGGGGGGGGG - Intronic
1033732828 7:144195636-144195658 GGCCAGGGGCGGGCCGCGGGTGG - Exonic
1033750223 7:144355381-144355403 GGCCAGGGGCGGGCCGCGGGTGG + Exonic
1033857543 7:145583092-145583114 GGCCGGGAGCGGACCCGGAGAGG + Intergenic
1034166545 7:149028873-149028895 TGCCGGGGGCGGGGCAGGAGAGG + Intergenic
1034439824 7:151080922-151080944 CGCCGAGGGCGGGGCCACGGAGG + Intergenic
1034441163 7:151086703-151086725 GGCCCGAGGCGGGCCCGGGGCGG - Intronic
1034560379 7:151876266-151876288 CGCCTGGGGCGGGGGCTGGGCGG - Intronic
1034618063 7:152436010-152436032 CGCAGGGGCCGGGCGGGGGGCGG + Intergenic
1034659905 7:152759956-152759978 GGCCGGGAGCGGGGCCGCGGAGG - Intronic
1034963066 7:155374284-155374306 CGGCGGGGGCTGGGCCGGGCGGG + Intergenic
1035153398 7:156893205-156893227 AGTCGGGGGCGGGGCGGGGGCGG + Exonic
1035167464 7:157000091-157000113 CGCGGGGGGCGGAGCGGGGGAGG + Intronic
1035167593 7:157000580-157000602 TGGCGGGGGCGGGGGCGGGGTGG + Intronic
1035266047 7:157690855-157690877 GCCCGGGGGCCGGGCCGGGGCGG - Intronic
1035266071 7:157690899-157690921 CGGCGCGGGCGGGCTCAGGGCGG + Intronic
1035266403 7:157692296-157692318 CGCCTGGGCCTGGCCTGGGGAGG - Intronic
1035284063 7:157795152-157795174 CGGCGGGGTCGGGGGCGGGGGGG + Intronic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1035627257 8:1080270-1080292 CGCGGGCGGCGGGGCGGGGGTGG - Intergenic
1035717208 8:1763664-1763686 CGACGGCGGCGGGCGCGGGAGGG - Intronic
1036379495 8:8227925-8227947 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1036664504 8:10730143-10730165 GGCCGGGGGCGGGCGGCGGGCGG - Intronic
1036664670 8:10730701-10730723 GGCCGGGGGCAGGCGCGGGGAGG - Intronic
1036850064 8:12194688-12194710 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1036871428 8:12436961-12436983 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1037143088 8:15540599-15540621 GGGCGGGGGCGGGCCAGGGTGGG + Intronic
1037825300 8:22156817-22156839 CGGCGGGGGCGCGCGCGGGGCGG + Exonic
1037855282 8:22367203-22367225 CGAGCGGGGCGGGCCGGGGGCGG + Intergenic
1038599919 8:28929924-28929946 GGCGGGGGGCGGGCGGGGGGCGG - Intronic
1038632992 8:29263104-29263126 CGGCGGGAGGGGGCCGGGGGCGG + Intronic
1038644944 8:29353069-29353091 CGCCAGGCGCGGGTCCGGCGGGG - Intergenic
1039484433 8:37899678-37899700 CGCCGGAGGCGGGGCTGGCGCGG + Intergenic
1039874992 8:41577991-41578013 TGCCGGGGGCGGGGCGGGGCAGG - Intronic
1041686940 8:60652601-60652623 CGGCGCGGGCGAGCCGGGGGCGG + Intergenic
1041906560 8:63039056-63039078 CGCCTGGGGCGGGTACCGGGTGG + Exonic
1042611721 8:70607962-70607984 CGGGGGGCTCGGGCCCGGGGTGG - Intronic
1043413816 8:80028649-80028671 CGGGGGGGGCGGGGCCGGGCGGG + Intronic
1044242511 8:89902904-89902926 GGCCCGGGCCGGGACCGGGGTGG + Intronic
1044591269 8:93916681-93916703 CGCTGGGGGCGGGGGGGGGGGGG + Intronic
1044591296 8:93916808-93916830 GGCCGGGGGTGGGGCGGGGGCGG - Intronic
1044591512 8:93917503-93917525 CCCCTGGGGCGGGGCCGGGCCGG + Intronic
1044973643 8:97643875-97643897 AGGCGGGGGCGGGCGGGGGGCGG - Intergenic
1045098842 8:98825715-98825737 GGCCGGGGGCGGGGCGGGGCGGG - Intronic
1045336014 8:101205291-101205313 CGGCAGGGCCCGGCCCGGGGCGG - Intronic
1045488718 8:102654458-102654480 GGCCGGGGGTGGGCCGGGAGCGG - Intronic
1047000977 8:120571996-120572018 CAGCGGGGGTGGGGCCGGGGAGG - Intronic
1047277393 8:123416551-123416573 CGAAGTGGGCGGGTCCGGGGTGG - Intergenic
1047277427 8:123416669-123416691 CGCGGTGGGCGGGGCCAGGGCGG - Intergenic
1047998613 8:130358716-130358738 GGCCGGGGGCGGGGCGCGGGCGG - Intronic
1047998619 8:130358727-130358749 GGCGGGGGCCGGGCCGGGGGCGG - Intronic
1048009277 8:130443342-130443364 CGCCGGGACGGGGCGCGGGGCGG - Intronic
1048152080 8:131904039-131904061 CCGCGGGGGCGGGGCCGGGACGG + Intergenic
1048331723 8:133475261-133475283 AGCCAGGAGCGGGCCTGGGGCGG + Intronic
1049154664 8:141059398-141059420 CGGTGGGGGCGGGCTGGGGGTGG + Intergenic
1049194402 8:141307796-141307818 CCCCGGGGTGGGGGCCGGGGTGG + Intronic
1049276816 8:141724128-141724150 CGCCGGGGGCGGGCAGTGGGAGG - Intergenic
1049396392 8:142403052-142403074 GGCCGGGGCCGGGCGTGGGGCGG - Intronic
1049404008 8:142443559-142443581 AGCCGGGGGCGGGCCTGGGTGGG + Intergenic
1049471613 8:142777369-142777391 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049471648 8:142777474-142777496 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049471667 8:142777526-142777548 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049471686 8:142777578-142777600 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049557719 8:143291358-143291380 CCGAGGGGGCGGGCCAGGGGTGG + Intronic
1049565278 8:143334909-143334931 CGCTGGGGGCGGGGCGGGGCTGG - Intronic
1049585398 8:143430491-143430513 CGCGGGCGGCGGTCCCGGCGGGG + Intergenic
1049597059 8:143489569-143489591 TGCCTGGGGCGGTCCTGGGGCGG - Intronic
1049614290 8:143569350-143569372 AGACGGGGGCGGGGCCTGGGAGG + Intronic
1049619183 8:143590157-143590179 CGGGGAGGGCGGGCACGGGGAGG - Intronic
1049661221 8:143820477-143820499 CCCCAGGGGCGGTCCCGGGTGGG + Intronic
1049684594 8:143934229-143934251 CGCCGGGGGCGGGGCGGGGAGGG + Intronic
1049693677 8:143973562-143973584 GGGCGGGGGCGGGGCGGGGGCGG - Intronic
1049707372 8:144049168-144049190 CGCCGGGGGCGGGAAGGGCGAGG - Intergenic
1049759725 8:144326558-144326580 CGGCGGCGGCGGGCCTGCGGCGG - Exonic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1049762277 8:144336908-144336930 CGGCGGCGGCGGGCGGGGGGCGG + Intergenic
1049762704 8:144338247-144338269 CGCCGCTGCCGGGGCCGGGGCGG - Intergenic
1049788496 8:144462552-144462574 GGTCGGAGCCGGGCCCGGGGCGG - Intronic
1049792346 8:144477933-144477955 AGCCGGGGGCGGAGCCTGGGAGG - Intergenic
1049929170 9:439516-439538 GGCAGGGGATGGGCCCGGGGAGG + Intronic
1050155948 9:2666724-2666746 GGCCGGGGGCGGGGTGGGGGCGG - Intergenic
1051936247 9:22446723-22446745 AGCCGGGGGAGGGCCCGGGGCGG - Intergenic
1051936344 9:22447145-22447167 CGCCGGGGACGGGGGCGGAGGGG - Exonic
1052362228 9:27573488-27573510 GCCCGGGGGCGGGCCCGGGGCGG - Intronic
1053129053 9:35605233-35605255 TGCCGGGGGCGGGGCTGGGCCGG - Intergenic
1053138279 9:35665244-35665266 CCGCGGAGGCGGGGCCGGGGAGG + Exonic
1053240090 9:36487894-36487916 CCTCAGGGGCGGGCCTGGGGCGG - Intergenic
1053489436 9:38487980-38488002 CGACGGGGGCGGGCGGTGGGTGG + Intergenic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1055514129 9:77020034-77020056 CGCCGGGCGCCGGTCCGGGAGGG + Exonic
1055611592 9:78030963-78030985 GGCCGGGGGCGCGCCCGGGAGGG + Intronic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057199882 9:93134292-93134314 GGCCGGGGGCGGGCCGGGGGCGG - Intergenic
1057432235 9:95004952-95004974 CGGCGGGCGCGGGGCCTGGGCGG - Intronic
1057476962 9:95411293-95411315 GGGCGGGGGCGGGGCGGGGGAGG + Intergenic
1057488549 9:95505872-95505894 GGCCGGGGGCGGGCGCAGCGCGG - Intronic
1057716678 9:97501599-97501621 AGCCAGGGGCGGGCCCGGCTCGG - Intronic
1057773276 9:97984826-97984848 CGCCCGGCGCGGGGCGGGGGCGG - Intronic
1058058776 9:100474001-100474023 GGCCGGGGCCGGGGCCGGCGAGG + Intronic
1059208273 9:112486823-112486845 CGCGGCGGGCGGGCAGGGGGCGG - Intronic
1059234509 9:112750706-112750728 CCTCGGGGGCGGGGCCGGAGCGG + Intergenic
1059268842 9:113060244-113060266 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059269978 9:113065693-113065715 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059271112 9:113071141-113071163 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059272245 9:113076587-113076609 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059273380 9:113082029-113082051 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059274516 9:113087475-113087497 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059375235 9:113876176-113876198 CGGCCGGTGCGGGCCGGGGGTGG + Intergenic
1059455671 9:114398560-114398582 AGCAGGGGGCGGCCCGGGGGGGG + Intergenic
1059483675 9:114611410-114611432 GGCGGGGGGCGGGCCCGTGAAGG + Exonic
1060106712 9:120877218-120877240 CGGCGGGGGCGGGGCGGGGCGGG + Exonic
1060283483 9:122228863-122228885 GGCTGAGGCCGGGCCCGGGGCGG - Intronic
1060478064 9:124000026-124000048 CGCGGCGCGCGGGGCCGGGGAGG - Intergenic
1060856036 9:126915269-126915291 CGCGGGGGGCGGGGCCGGGGGGG + Intronic
1060856057 9:126915320-126915342 TGCGGGGGGCGGGGCCGGCGGGG + Intronic
1060979789 9:127785612-127785634 GGCCGGACCCGGGCCCGGGGCGG - Intergenic
1061003793 9:127917046-127917068 GGCCGGGGCCGGGGCCGGCGAGG + Intergenic
1061196715 9:129110734-129110756 GGCCGGTAGCGGGCCCCGGGCGG + Exonic
1061252801 9:129436556-129436578 AGCGGGGGGCGGGGTCGGGGTGG - Intergenic
1061257405 9:129460640-129460662 CCCCGGAGCCGGGCCCGCGGCGG - Intergenic
1061370067 9:130193060-130193082 CCCCAGGGGTGGGCCCGGTGTGG + Intronic
1061382208 9:130265484-130265506 CGCCGATGGCGCGCCGGGGGCGG - Intergenic
1061609876 9:131739539-131739561 CGCCAGGGGCCGGGCCGGGCGGG - Intronic
1061802826 9:133121373-133121395 CGCCGAGGTCAGACCCGGGGCGG + Intronic
1061808490 9:133149230-133149252 CCCCGGGCTCGGGCCCGGGTGGG + Intronic
1061908444 9:133710711-133710733 CCCCGGGCGCAGGCCCGAGGTGG + Intronic
1061920956 9:133782097-133782119 CGGCGGGGGCGGGGCGGGGGAGG + Intronic
1062136408 9:134930749-134930771 CGTCGGGGGCGGGTAGGGGGGGG - Intergenic
1062306011 9:135907442-135907464 GGGCGGGAGCGGGCCGGGGGCGG + Intergenic
1062341419 9:136095319-136095341 CGGCGGGGGCGGGGCGGCGGCGG + Intergenic
1062435791 9:136546091-136546113 CGGCGGGGGTGGGGCCGGGCGGG - Intergenic
1062461882 9:136665727-136665749 GGCCGGGGGCGGGGCGGGGCGGG + Intronic
1062532847 9:137009323-137009345 GGGCTGGGGCGGGCCCGGGGGGG - Intronic
1062532861 9:137009344-137009366 AGCCGGGGCAGGGCCAGGGGTGG - Intronic
1062565803 9:137163479-137163501 AGCTGGGGGCGGGGCCGGGGCGG - Intronic
1062584218 9:137241691-137241713 GGACGCGGGCGGGCCCGGGCGGG - Intronic
1062596502 9:137302160-137302182 CGCGGGGGCCGGGCCCGGCCGGG + Exonic
1062628279 9:137452706-137452728 TGTTGGGGGCAGGCCCGGGGCGG + Intronic
1062696223 9:137877664-137877686 GGGCGGGGGCGGCCGCGGGGCGG + Intergenic
1062696337 9:137877982-137878004 GGCGGAGAGCGGGCCCGGGGCGG + Exonic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185621463 X:1453351-1453373 GGCCGGGGCGGTGCCCGGGGGGG - Intronic
1186107836 X:6226460-6226482 CGGCGGGGGCGGGAGCAGGGGGG - Intronic
1186426040 X:9465015-9465037 CGGCGGGGGCGGACCCCTGGCGG + Exonic
1186426121 X:9465281-9465303 CGGCGGCGGCGGGGCGGGGGCGG + Exonic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1187507272 X:19887765-19887787 GGGCGGGGGCGGGGCCGGAGAGG + Intergenic
1187518203 X:19991092-19991114 AGCAGTGGGCGGGGCCGGGGTGG - Intergenic
1187900792 X:24025429-24025451 CTCCCTGGGCGGGCCCCGGGCGG - Intronic
1187900793 X:24025430-24025452 CGCCCGGGGCCCGCCCAGGGAGG + Intronic
1188542661 X:31266963-31266985 CGGCGCGGGCGGGCCGGGGAGGG + Intronic
1188811417 X:34657329-34657351 AGCCCGGGGAGGGGCCGGGGCGG - Intergenic
1189262640 X:39689200-39689222 CGCCGGGGACGGGATAGGGGAGG - Intergenic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1190322321 X:49186424-49186446 GCCCGGGGGCGGGCCCTGCGGGG - Intronic
1190337195 X:49269821-49269843 CACCGGCGGCGGGACCGGCGGGG - Intronic
1190337266 X:49270034-49270056 GCCGTGGGGCGGGCCCGGGGCGG + Exonic
1190385633 X:49879957-49879979 CGCCGGGGCCGGGGCCGGGGCGG - Exonic
1192260615 X:69504265-69504287 CGGCGGGGGCTGGGGCGGGGTGG + Intergenic
1192924479 X:75741125-75741147 CGCCAAGGGTGGGCCCTGGGAGG + Intergenic
1193257530 X:79367383-79367405 GACCGTGGGCGGGCCCAGGGAGG + Intronic
1195220567 X:102742318-102742340 AGTCGGGGGCGGGGTCGGGGGGG + Intronic
1195625108 X:106999568-106999590 CGCGCGGGGCGGGCCGGGGCTGG - Intronic
1196791408 X:119468366-119468388 CGTCGGAGGCGGGGCCGGGGCGG - Intergenic
1196909228 X:120468961-120468983 CGGCGGCGGTTGGCCCGGGGAGG - Intronic
1197708027 X:129647884-129647906 CGCCGGGGGTGGGCACTTGGGGG + Exonic
1197745972 X:129932407-129932429 CGCGGGGCGCGGCCGCGGGGCGG - Intergenic
1197754452 X:129984137-129984159 CGGCGGGGCGGGGCCGGGGGCGG + Intronic
1198205326 X:134460103-134460125 GGCCGGGGGCGGGGCCTGCGGGG + Intergenic
1198276140 X:135097720-135097742 GGCTGGGGGCGGCCCCGGGAAGG - Intergenic
1198800132 X:140439716-140439738 GGCCGGGGGCGGGCCCGGGCTGG + Intergenic
1200073385 X:153539709-153539731 CGCCGGGTGAGCGCCCGGGAGGG + Intronic
1200078691 X:153564965-153564987 AGCCGGGCACGGGCCCGGGAAGG + Exonic
1200098178 X:153673842-153673864 CGGAGGGGGCGGGGCCGGCGGGG - Intronic
1200155440 X:153972426-153972448 CGCCGCGGGGGAGCCGGGGGCGG + Exonic
1200163287 X:154019858-154019880 CGGCGGGCGCGGGCCTGGGCCGG + Exonic
1200209658 X:154341606-154341628 GGCCGGGGCCGGGGCCGGGGCGG + Intergenic
1200217530 X:154374675-154374697 GGCGCGGGGCGGGCGCGGGGCGG - Intergenic
1200221194 X:154390486-154390508 GGCCGGGGCCGGGGCCGGGGCGG - Intronic
1200224867 X:154411821-154411843 CGCCGGCCGCGGGCCGGGTGGGG + Exonic
1200239512 X:154486444-154486466 GGCCGAGGGCGGGCACGGGGCGG - Intronic
1200787545 Y:7273745-7273767 CGCCCGGGGCGCCCCCGGGGTGG - Intergenic