ID: 1179883059

View in Genome Browser
Species Human (GRCh38)
Location 21:44301388-44301410
Sequence GTCCTGTCCTGTGTGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179883054_1179883059 1 Left 1179883054 21:44301364-44301386 CCTGGAGCCAGTGTGGCTCCACA No data
Right 1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG No data
1179883055_1179883059 -6 Left 1179883055 21:44301371-44301393 CCAGTGTGGCTCCACAAGTCCTG No data
Right 1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG No data
1179883052_1179883059 18 Left 1179883052 21:44301347-44301369 CCGGCTACTGGCAGTGTCCTGGA No data
Right 1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179883059 Original CRISPR GTCCTGTCCTGTGTGGCTCT GGG Intronic