ID: 1179886800

View in Genome Browser
Species Human (GRCh38)
Location 21:44317682-44317704
Sequence TCCCACTGGGTGCTGCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179886794_1179886800 -10 Left 1179886794 21:44317669-44317691 CCTGAGCCCGTATTCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 162
1179886792_1179886800 -9 Left 1179886792 21:44317668-44317690 CCCTGAGCCCGTATTCCCACTGG 0: 1
1: 0
2: 0
3: 15
4: 95
Right 1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 162
1179886789_1179886800 28 Left 1179886789 21:44317631-44317653 CCGCGGCTGTCACCCAGAGCGTC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 162
1179886790_1179886800 16 Left 1179886790 21:44317643-44317665 CCCAGAGCGTCAGCATTCTTGTG 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 162
1179886791_1179886800 15 Left 1179886791 21:44317644-44317666 CCAGAGCGTCAGCATTCTTGTGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179886800 Original CRISPR TCCCACTGGGTGCTGCGAAG GGG Intronic
900901514 1:5519649-5519671 TCCCACTGGGCACTGCCTAGTGG - Intergenic
901672258 1:10862810-10862832 TCCCACTGGGGGCTGGGGAGGGG - Intergenic
902623975 1:17666324-17666346 TCTTCCTGGGTGCTGGGAAGGGG + Intronic
902746619 1:18478822-18478844 TCCCACTGGTAGCTGTCAAGAGG - Intergenic
903340191 1:22649069-22649091 TCTGACTGGGTGCTGAGAATTGG - Intergenic
905649479 1:39646839-39646861 AGCCTCTGGGTGCTGCCAAGGGG - Intergenic
909032408 1:70558051-70558073 TCTCTCTGGGTGCTGCCAAGGGG - Intergenic
910072659 1:83237687-83237709 TCCCATAGGGTGATGCCAAGAGG - Intergenic
912725924 1:112058757-112058779 TCCCACTGAATGCTGCCAACTGG - Intergenic
919475070 1:198022762-198022784 TGCCACAGGGTGATGTGAAGAGG + Intergenic
919847429 1:201650524-201650546 GCCCGCTGGGGGCTGGGAAGGGG + Intronic
921128066 1:212195672-212195694 TCCCACTGGGCACTGCCTAGTGG + Intergenic
921158305 1:212454885-212454907 TCCCTCTGGGTGATGCCATGGGG - Intergenic
921422176 1:214961113-214961135 TCCTACAGAGTGCTGCCAAGAGG + Intergenic
923542236 1:234896912-234896934 TTCCACAGGGGGCTGCGAGGTGG - Intergenic
923938828 1:238796112-238796134 TCCCACTGTATGCTTGGAAGTGG - Intergenic
1064030615 10:11880499-11880521 TCCCGCTGGGGCCTGCGCAGAGG + Intergenic
1065240098 10:23695626-23695648 TTTCACTCGGGGCTGCGAAGAGG + Intronic
1068612307 10:59073611-59073633 TCCCACAGGGTGATGCAAAAAGG + Intergenic
1069493110 10:68878506-68878528 TCCCACTGGGTGATTCTCAGAGG - Intronic
1071401887 10:85280790-85280812 TCTCACTGGGAGCTGCAGAGGGG + Intergenic
1073147298 10:101289289-101289311 TCCCACAGGGTGAGGCAAAGTGG + Intergenic
1075778390 10:125002302-125002324 TCACACGGGGTGCTGGGCAGAGG + Intronic
1075855619 10:125626916-125626938 TCCCACTGGGGCCTGGGAAATGG + Intronic
1076017609 10:127040637-127040659 GCCCCCTGGGTGTTGGGAAGAGG + Intronic
1082711778 11:56561354-56561376 TCCCACTGGGTCCTGCGTAATGG + Intergenic
1085530419 11:77189261-77189283 TCCCACTGGCTGCTAGGAGGAGG + Intronic
1085800647 11:79586121-79586143 TCACACTGGGAGCTGCGGAATGG - Intergenic
1086338266 11:85821837-85821859 TCCCACTGGATTCTGGGGAGTGG - Intergenic
1089633666 11:119798769-119798791 TCCCACTGGGTTCTGCCAATGGG + Intergenic
1091838798 12:3604706-3604728 TCCCACTCAGTGCTGGGAAGGGG - Intergenic
1092284609 12:7121558-7121580 TCCCACTGGGGGGTCCCAAGAGG - Intergenic
1092484969 12:8894855-8894877 TTCCTCTGGGGGCTGGGAAGGGG - Intergenic
1095349380 12:41189961-41189983 TCACACGGGATGCTGCAAAGAGG - Intronic
1095736055 12:45557339-45557361 TCCCACTGGGTGCAGAGTGGTGG - Intergenic
1097195477 12:57240367-57240389 GCCCTCTGGGTGCTGAGGAGAGG - Intronic
1097635298 12:62114399-62114421 TCTCACTGGGAGCTGCAAATAGG + Intronic
1104165921 12:126229731-126229753 TCCAACTGGCAGCTGTGAAGTGG - Intergenic
1104189616 12:126467368-126467390 TCCCAAGGGGTGGTGGGAAGGGG + Intergenic
1104448631 12:128852846-128852868 TCCCACAGGGTGCTGCAGAGAGG - Intergenic
1106326409 13:28694291-28694313 TCCCACTGGGAGCTGCAGACTGG + Intergenic
1107467298 13:40663135-40663157 TCCCACTGGGAGCTGCCCAAGGG + Intronic
1108674156 13:52721700-52721722 TCTCACTGGGAGCTGCAAACTGG + Intronic
1112592030 13:100772383-100772405 TCCCACAGGGTGATGTGAAGAGG - Intergenic
1113635478 13:111916324-111916346 GCCCACTGGGTGGTGCCCAGGGG - Intergenic
1114538186 14:23436131-23436153 TCCAACTGGAAGCTGGGAAGGGG + Intergenic
1115304789 14:31922754-31922776 TCCCACTGGGTTCTGCCAATGGG - Intergenic
1115851640 14:37594605-37594627 TCCCGCTCGCTGCTGGGAAGAGG + Intronic
1115912268 14:38269368-38269390 TCTCACTGGGAGCTGCAAACTGG + Intergenic
1118498499 14:66333280-66333302 TCTCACTGGGAGCTGCAGAGTGG - Intergenic
1121047769 14:90800486-90800508 GCCCACTGGGTCCTTAGAAGAGG + Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122938907 14:104972539-104972561 TCCCTCTGGCTGCTGTGAGGTGG - Intronic
1202842775 14_GL000009v2_random:138395-138417 TCCCACTGGGTGTTGCAGACCGG + Intergenic
1202912173 14_GL000194v1_random:128637-128659 TCCCACTGGGTGCTGCAGACCGG + Intergenic
1124879436 15:33627747-33627769 TCCCACTGGTTGCAGTGTAGAGG + Intronic
1125470071 15:39993785-39993807 TCACTCTGGCTGCTGCGAGGAGG + Intronic
1132593657 16:738127-738149 TGCCACAGGGTGCTGGGCAGAGG + Intronic
1133272659 16:4618096-4618118 TCCCATTGGGTGGTGGGAGGAGG + Intronic
1137067531 16:35863851-35863873 TGCCTCTGGGTGCTGAGAAGAGG + Intergenic
1139239619 16:65377769-65377791 TCCCTCTGAGGGCTGTGAAGGGG + Intergenic
1139529590 16:67536585-67536607 TTCCCCTGGGTCCTGGGAAGAGG + Intronic
1141287190 16:82683383-82683405 TCACTCTTGGTGCTGCAAAGTGG + Intronic
1141323576 16:83035198-83035220 TCCTACTGTGTGCAGCCAAGTGG + Intronic
1141987181 16:87587697-87587719 ACCCACTGGGGGCTGCGTTGTGG - Intergenic
1143662058 17:8331376-8331398 TTCCAGTGGGGGCTGCAAAGTGG - Intergenic
1143972494 17:10805640-10805662 TCCCACTAGGTCCTCGGAAGGGG + Intergenic
1144687216 17:17234161-17234183 TGGCTCTGGGTGCTGGGAAGTGG - Intronic
1145720305 17:27065226-27065248 TTCCACTTGGTACTGAGAAGAGG - Intergenic
1148321926 17:46761853-46761875 TTCCAGTGGGTCCTGTGAAGTGG + Intergenic
1149160382 17:53686719-53686741 CTCCACTGGGAGCTGCAAAGAGG - Intergenic
1151028917 17:70712588-70712610 TTCCAGTGGGTTCTGGGAAGAGG - Intergenic
1151316094 17:73323718-73323740 TCTCACTGGCTGCTGCCATGGGG - Intergenic
1152360329 17:79830388-79830410 TCCCACTGGGTCCAGCGGAGAGG - Intergenic
1152718005 17:81909099-81909121 TACAGCTGGGTGCTGGGAAGGGG - Intronic
1154197914 18:12279653-12279675 TCCCTGAGGGTTCTGCGAAGAGG - Intergenic
1156395796 18:36698841-36698863 TCCCACAGGGTGATGTGAATAGG + Intronic
1157717222 18:49896277-49896299 TCCCACAGAGTGCTGGGGAGCGG - Intronic
1160053190 18:75455745-75455767 ACACACTGGGAGGTGCGAAGCGG - Intergenic
1160686082 19:437500-437522 TCCCTATGGGGGCTGAGAAGTGG - Intronic
1160746473 19:713481-713503 CCCCACTGGGTGGTGCTCAGAGG - Intronic
1160854450 19:1210132-1210154 GCCCCCTGGGTGCTGCCAGGGGG + Intronic
1161366988 19:3885752-3885774 TCCCCATGGGAGCTGGGAAGAGG - Exonic
1163654964 19:18540275-18540297 TCCCACTTGGTGCTGTGGTGGGG - Intronic
1164107667 19:22123176-22123198 TCCACCTGGGTTCTGCGAATTGG + Intergenic
1167778772 19:51581575-51581597 TCCCACTGCGTTCTGCAATGAGG - Intronic
1168719124 19:58545149-58545171 TCCGACTGGGTGCAGAGATGAGG + Intronic
925082485 2:1081215-1081237 TCCCTCTGTGTGCAGCGGAGTGG + Intronic
927419050 2:22910325-22910347 TCACACTGGGCTCTGAGAAGAGG + Intergenic
928083951 2:28334117-28334139 GCCAACTGCGTGCTGCCAAGGGG - Intronic
928663595 2:33528417-33528439 TCCCACTGGCTGCTGCTTTGTGG + Intronic
930036815 2:47091044-47091066 TCCCACGGGGTGAGGGGAAGGGG + Intronic
930544152 2:52745869-52745891 TCCCACTGGGCACTGCCTAGTGG + Intergenic
933317776 2:80736451-80736473 TCTCACTGGGAGCTGCAAACTGG - Intergenic
938829657 2:135037820-135037842 TCCCACTGAGTGATAGGAAGAGG - Intronic
940239136 2:151544206-151544228 TCCCTCTGGGAACTGGGAAGAGG + Intronic
940988348 2:160072513-160072535 TCCCACTGGGAACTGCTTAGAGG - Intergenic
941901752 2:170685766-170685788 TCCCACAGGGTGATGTGAAGAGG + Intergenic
944540049 2:200746029-200746051 TCCCTCTGAGTGCTGTGCAGGGG + Intergenic
1169632677 20:7650522-7650544 TCCAAATGGGTGCGGCCAAGTGG - Intergenic
1170283941 20:14684215-14684237 TCTGACTGGGTGCTGCGCAAGGG - Intronic
1172646647 20:36474467-36474489 TCCTACTGGGGGCTGTGACGAGG + Intronic
1172778696 20:37423109-37423131 TCCCACTGCGTGCTGACAACAGG - Intergenic
1175895630 20:62334486-62334508 CCCCACTGGGTGGTGGGGAGCGG - Intronic
1176631530 21:9143314-9143336 TCCCACTGGGTGCTGCAGACCGG + Intergenic
1178393462 21:32219209-32219231 TCTCACTGGGTGCTGCAGACTGG - Intergenic
1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG + Intronic
1181892210 22:26073291-26073313 TCCAACTGATTGCTGCCAAGTGG + Intergenic
1183667908 22:39255794-39255816 TCCCCCAGGGTGCTGAGCAGGGG + Intergenic
1184486577 22:44783445-44783467 TCCCTCTGGCTGCAGAGAAGGGG - Intronic
950011335 3:9726268-9726290 TCCCACTGGATGATGTGAAGAGG + Intronic
952936463 3:38402093-38402115 TTCCACAGGGTGATGCAAAGTGG + Intronic
953219115 3:40951356-40951378 TCTCACTGGGTGCTGCAGACCGG + Intergenic
959333941 3:105040357-105040379 TCCCACAGGGAGATGGGAAGAGG - Intergenic
962221769 3:133570465-133570487 TCCCTCTGGGTCCTCTGAAGTGG - Intergenic
966452543 3:180078426-180078448 TCCCACTGGGGCCTGCCTAGTGG - Intergenic
968571000 4:1340617-1340639 TCCAGCTGGGTGCTGTGGAGGGG - Intergenic
968684388 4:1947192-1947214 TCCCACTGTGTCCTGAGCAGCGG - Intronic
970830807 4:20337407-20337429 TCCCACTGGGTGCCTCCCAGTGG + Intronic
971175989 4:24283260-24283282 TCCCACTGGGTTATGGCAAGAGG + Intergenic
971252538 4:24985420-24985442 TCCCACTGGGATCTTCTAAGTGG - Intergenic
973803994 4:54507246-54507268 TCCTACTGGCTGGTGTGAAGTGG - Intergenic
975076349 4:70213305-70213327 TCACACTGGATGCTGCAAACCGG + Intergenic
975744702 4:77464685-77464707 TCACACTGGGAGCTGCGGACCGG + Intergenic
977589259 4:98808372-98808394 TCCCACTGGGTGGAGTGCAGTGG + Intergenic
979466862 4:121049426-121049448 TCCCACAGGATGATGCAAAGAGG - Intronic
983583922 4:169336185-169336207 TCCCACAGGGTGATAGGAAGAGG + Intergenic
984255239 4:177382247-177382269 TCACACTGGCTGCTGTGAGGAGG - Intergenic
989224583 5:39011437-39011459 CCCCACTGGGTACTGCCTAGTGG + Intronic
993645504 5:90456035-90456057 TCCCCCTGGGTTCTTGGAAGGGG + Intergenic
994000999 5:94778951-94778973 TGCCACTGCGTGTTGCAAAGAGG - Intronic
994851372 5:105058116-105058138 ACACACTGGCTGCTGCCAAGGGG - Intergenic
998558497 5:143149137-143149159 TCCCTCTGGGTGGTGTGAAGTGG - Intronic
1000676934 5:164132643-164132665 CCCCACTGGGTACTGCCTAGTGG + Intergenic
1001837367 5:174843637-174843659 TCCCGCTGGGAGCTGGGGAGGGG + Intergenic
1002571733 5:180143430-180143452 TTCCAGTGGGTGCTGGAAAGAGG + Intronic
1002914521 6:1518422-1518444 TCCAACTGGGTCATGCAAAGGGG - Intergenic
1003016200 6:2469361-2469383 TCCCAGTGGGTGCTGCGGGGAGG + Intergenic
1003955869 6:11164718-11164740 GACCACTGTGTGCTGCGAGGTGG + Intergenic
1007894948 6:45345316-45345338 TCCCTCTGGTTGCTGAGATGGGG - Intronic
1008342382 6:50383166-50383188 TCCCACAAGGTGATGCAAAGAGG - Intergenic
1008443407 6:51559073-51559095 TCCCACTGGTTGCTGAGTAAGGG + Intergenic
1010917103 6:81633599-81633621 TCCCACTGGAAGCTGCTAAAAGG + Intronic
1015425592 6:133062838-133062860 TCCCTCCGAGTGCTGGGAAGTGG - Intergenic
1015730750 6:136345611-136345633 ACCCACTGGGTGCTGCGGACTGG + Intronic
1019012311 6:168851598-168851620 TAGCACTGGGTGCAGCCAAGTGG - Intergenic
1019564092 7:1671019-1671041 TCCCTCTGGGGGCTGGGAGGAGG + Intergenic
1022219375 7:28297416-28297438 TCCCATTGTGTGCTGAGAACAGG + Intergenic
1022282679 7:28926970-28926992 TGCCACTGGGTGCTGGAACGTGG + Intergenic
1022479349 7:30733025-30733047 TCTCACTGGGTGCTGGGCTGTGG + Intronic
1023609590 7:41959323-41959345 TACCACTGGGTGCTGAGGAAAGG + Intergenic
1024765913 7:52659167-52659189 TCCCAATGGGTGCTGCAAGGGGG - Intergenic
1025812108 7:64882051-64882073 TGCCCGTGGGTGCTGAGAAGGGG + Intronic
1027290381 7:76702842-76702864 TCCCATAGGGTGATGCCAAGAGG - Intergenic
1028902710 7:96118968-96118990 TCCCTCTGGGTTCTGCTCAGTGG - Intergenic
1032564932 7:132931881-132931903 TCCCACTGCCTGCTGCACAGTGG - Intronic
1032604167 7:133330860-133330882 TCTCACTGGGAGCTGCAAACCGG + Intronic
1036686982 8:10918277-10918299 TCCCCCTGAGTGCTTGGAAGAGG + Intronic
1037263964 8:17037628-17037650 TCCCACTGGGCACTGCCTAGTGG + Intronic
1037885707 8:22595071-22595093 TCCCAGAGGATGCTGCGGAGGGG + Intronic
1040520197 8:48169783-48169805 TCTCACTGGGAGCTGCAAATAGG + Intergenic
1041777127 8:61535832-61535854 TCCCCCTGGGTGCTGAGACGAGG + Intronic
1045604439 8:103756300-103756322 TCCCACTGGGAGCTGCAGACCGG + Intronic
1045949349 8:107833986-107834008 TCACACTGGGAGCTGCAAACTGG - Intergenic
1049192397 8:141295588-141295610 TCCCCCTGGGTGCTGTGTTGTGG - Intronic
1060038512 9:120280005-120280027 TCCCAGTGGCTGCTGTGAAACGG + Intergenic
1060183863 9:121552104-121552126 ACCCTCTGGGTGCTGGGGAGGGG - Intergenic
1060204748 9:121675844-121675866 TCCAGGTGGGTGGTGCGAAGGGG + Intronic
1060784388 9:126438690-126438712 CCCCACTGGGCTCTGGGAAGAGG - Intronic
1061753673 9:132798124-132798146 CCCCACTGGGTGCTGCTCTGAGG + Intronic
1061897314 9:133655176-133655198 TCCCACCTGGTGCTGTGATGTGG - Intronic
1203754360 Un_GL000218v1:110918-110940 TCCCACTGGGTGCTGCAGACCGG + Intergenic
1185765574 X:2723397-2723419 TCCCACGTGGTGTTGAGAAGGGG + Intronic
1187334613 X:18371330-18371352 TGGAACTGGGTGCTGCGTAGAGG + Intergenic
1187840693 X:23484366-23484388 TCTCACTGGGAGCTGCGGACCGG - Intergenic
1189442293 X:41048292-41048314 CCCCACTGGGTGTGGGGAAGGGG + Intergenic
1190221368 X:48514390-48514412 TCCCACAGGGTGCTGCCTAGAGG + Intronic
1191253111 X:58268609-58268631 TCCCACCCGGTGCGGCGCAGGGG + Intergenic
1191858139 X:65644075-65644097 TCTCACTGGCTGCTGCAAAATGG + Intronic
1194602099 X:95934735-95934757 TCCTTCTAGGTGCTGTGAAGAGG - Intergenic
1194963901 X:100266560-100266582 TCTCACTGGGAGCTGCAAACTGG - Intergenic
1194988484 X:100518305-100518327 TCCCACAGGGTGATGCAGAGGGG - Intergenic
1201167992 Y:11228566-11228588 TCTCACTGGGTGCTGCAGACCGG + Intergenic
1202622938 Y:56831333-56831355 TCACACAGGGTGCAGCGCAGTGG + Intergenic