ID: 1179887014

View in Genome Browser
Species Human (GRCh38)
Location 21:44318611-44318633
Sequence GGGCCAGGCGGTTCTGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179887014_1179887023 1 Left 1179887014 21:44318611-44318633 CCCCCATCAGAACCGCCTGGCCC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1179887023 21:44318635-44318657 TCTCCCCAGTCCCCACTCACAGG 0: 1
1: 0
2: 10
3: 36
4: 365
1179887014_1179887030 17 Left 1179887014 21:44318611-44318633 CCCCCATCAGAACCGCCTGGCCC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1179887030 21:44318651-44318673 TCACAGGCCCCACTGCTCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 257
1179887014_1179887032 19 Left 1179887014 21:44318611-44318633 CCCCCATCAGAACCGCCTGGCCC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1179887032 21:44318653-44318675 ACAGGCCCCACTGCTCTCTGGGG 0: 1
1: 0
2: 3
3: 26
4: 266
1179887014_1179887031 18 Left 1179887014 21:44318611-44318633 CCCCCATCAGAACCGCCTGGCCC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1179887031 21:44318652-44318674 CACAGGCCCCACTGCTCTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 280
1179887014_1179887033 20 Left 1179887014 21:44318611-44318633 CCCCCATCAGAACCGCCTGGCCC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1179887033 21:44318654-44318676 CAGGCCCCACTGCTCTCTGGGGG 0: 1
1: 0
2: 12
3: 32
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179887014 Original CRISPR GGGCCAGGCGGTTCTGATGG GGG (reversed) Intronic
900420559 1:2554263-2554285 GGGCCTGGCGGTGCTGGTGCCGG + Intergenic
902257495 1:15199461-15199483 GGGGCAGGTGGTTGTGAGGGTGG + Intronic
902862548 1:19256732-19256754 GGGGCAGGTGGCTCTGGTGGTGG + Intronic
903049611 1:20590844-20590866 GGGGCAGGTGGTGGTGATGGGGG + Intronic
903565365 1:24261347-24261369 GGGAGAGGCGCCTCTGATGGGGG - Intergenic
904125666 1:28236561-28236583 GGGCCCGGGAGTTCTGTTGGGGG - Intronic
906125196 1:43423189-43423211 GGGCTAGGGGGTGCTGGTGGGGG + Exonic
906949409 1:50322339-50322361 AGGGCAGGTGGCTCTGATGGTGG + Intergenic
910757218 1:90706578-90706600 CGGCCGGGCGGTCCTGAAGGTGG + Intergenic
916966163 1:169945067-169945089 AGGCCAGGGGGTGCTGAAGGTGG - Intronic
919248464 1:195019943-195019965 TGGGAAGGGGGTTCTGATGGTGG + Intergenic
919704193 1:200660527-200660549 GGGCAGGGCGGTGCTGATGGCGG + Intronic
1063733362 10:8724081-8724103 GAGCCAGGCCCTGCTGATGGTGG + Intergenic
1066627183 10:37418662-37418684 GGTCCAGGTGCTTCTGCTGGGGG - Intergenic
1069058245 10:63866852-63866874 GGGCCTGGCAGTAATGATGGTGG + Intergenic
1070152060 10:73811307-73811329 GAGCGAGGCGGTTCTGAGGGAGG + Intronic
1070769836 10:79075783-79075805 TGGCCAAGCTGTTCTGATGGGGG + Intronic
1073189731 10:101642824-101642846 GGGCCTGGTGGCGCTGATGGTGG - Intronic
1074082147 10:110176422-110176444 GGGCCAGGCGGGGCTGAGAGGGG - Intergenic
1074745190 10:116524997-116525019 GGGGCAGGCAGTTCTCATGATGG + Intergenic
1074758572 10:116646830-116646852 TGCCCAGGCAGTTCTGCTGGGGG - Intergenic
1077028347 11:451664-451686 GGGCGAGGAGGGCCTGATGGAGG + Intronic
1077405484 11:2380655-2380677 GTGCCAGCCGCCTCTGATGGAGG - Intronic
1081915780 11:46729322-46729344 GGGCCAGGCGGCTCCTGTGGGGG + Intronic
1083420023 11:62547153-62547175 GGGCCTGGGGGCTCTGAAGGTGG + Intronic
1083438937 11:62663260-62663282 GGGCAAGCCGGATCTGCTGGAGG + Exonic
1088995241 11:114990197-114990219 GGGCAGGGAGGGTCTGATGGAGG - Intergenic
1092964101 12:13625079-13625101 GGGCCAGGCACTTCTTGTGGAGG + Intronic
1094285803 12:28792173-28792195 GTCCTAGGAGGTTCTGATGGTGG - Intergenic
1096179132 12:49541059-49541081 GGGCCTTGCGGATCTGTTGGCGG - Exonic
1098051893 12:66462942-66462964 GGGCCAGCCGGGTCTGATGATGG + Exonic
1102993376 12:117330532-117330554 GGGCCAGGCCGTTGGCATGGGGG + Exonic
1103798558 12:123522290-123522312 GGGCCAGGCGGGGCTGTGGGCGG - Intronic
1104598935 12:130139463-130139485 GTGCTCGGCGGTCCTGATGGTGG - Intergenic
1104826214 12:131711293-131711315 GGGCCAGGCGGTGCCGGCGGTGG + Exonic
1104904502 12:132206012-132206034 GTGCCAGGCGCTTCTGAAGACGG - Exonic
1112487052 13:99829308-99829330 TGCCAAGGCGGTTCTGATGCAGG + Intronic
1117153078 14:52909060-52909082 GGGCCAGGAGGATGTGAGGGGGG + Intronic
1123008745 14:105337048-105337070 GGGCCACGCGGTGCTGACCGAGG - Intronic
1129695663 15:77739438-77739460 GGACCAGGGGCTTCTGAGGGAGG - Intronic
1131071677 15:89470130-89470152 GGGCCAAGCGGCTCTGCTGGGGG + Intergenic
1131097983 15:89667781-89667803 GGGCCAGGCTGCTCTGAGGGAGG + Exonic
1132592943 16:734280-734302 GGACCGGGCGGTGCTGATGTGGG + Exonic
1136016893 16:27406149-27406171 GGGCCAGGGCGGGCTGATGGGGG + Intronic
1139717012 16:68821857-68821879 GGGACAGGAGGTTCTGCGGGTGG + Intronic
1139761529 16:69187724-69187746 GGGCAAGGAGGTGCTGCTGGAGG + Exonic
1141273866 16:82566757-82566779 GGGCCAGAAGATTCTGAAGGAGG - Intergenic
1141403813 16:83774013-83774035 GGGACAGTCTGTGCTGATGGAGG - Intronic
1203142638 16_KI270728v1_random:1778426-1778448 GGGTCAGGCTGTTCTCATGTTGG + Intergenic
1143619391 17:8072425-8072447 GGGCCAGGCGGCTCTGCCGCGGG - Intergenic
1147747917 17:42706968-42706990 TGCCCAGGCGGTTTTGCTGGAGG - Intronic
1148052143 17:44774666-44774688 GAGCCAGGCGGATATGAGGGAGG - Intronic
1148564669 17:48625915-48625937 GGGCCAGGCGGCGGTGAAGGCGG - Exonic
1148853336 17:50565383-50565405 GGGGCGGGGGGTTCTGCTGGGGG + Intronic
1150782721 17:68135704-68135726 GGTGGAGGCGGTGCTGATGGGGG - Intergenic
1151558569 17:74859483-74859505 GGGTCCGGGGGTTCTGCTGGTGG - Intronic
1152132512 17:78485634-78485656 GGGCAAGTCGGTGCTGATGGGGG - Exonic
1152409837 17:80117756-80117778 GGGCCAGGCGGCTATGGTGGGGG + Intergenic
1154027934 18:10725357-10725379 GTCCCAGGCGGTGATGATGGTGG + Intronic
1156504787 18:37582995-37583017 GGTCCAGGTGGTTCTCAGGGAGG - Intergenic
1157304579 18:46507757-46507779 GAGCCAGGGGGTGCTGGTGGAGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1160478891 18:79220105-79220127 GGGACAGCCGGTCGTGATGGTGG + Intronic
1161069389 19:2252753-2252775 GGCGCAGGCGGCGCTGATGGAGG + Exonic
1161074085 19:2276530-2276552 GGGGCAGGCGGTGCTTGTGGGGG - Intronic
1161099404 19:2413899-2413921 GGGCCAGGCTGTGCTGGGGGCGG - Exonic
1161269544 19:3382305-3382327 GGGCCAGGAGGGCCTGAGGGAGG + Intronic
1161314892 19:3613214-3613236 GGGCGAGGCGGTGCTCATGGAGG - Exonic
1161660707 19:5544193-5544215 GGGCCTGGCGGTTCAGCAGGAGG - Intergenic
1161703088 19:5805360-5805382 GGCCCAGGCGGCCCGGATGGCGG + Intergenic
1162022649 19:7874675-7874697 GTGCCAGGTGGTTGTGGTGGGGG - Intergenic
1162738308 19:12758888-12758910 GGGCCTGGTGGTTGTGGTGGAGG - Intergenic
1162926350 19:13932202-13932224 GGGCCAGGCTGGTATGAAGGGGG - Intronic
1162932461 19:13963784-13963806 GGGCCAGGCGGGGGTGACGGCGG - Intronic
1163472598 19:17506037-17506059 GGGCCAGGGGGTGCTGCTGGAGG - Exonic
1164958247 19:32405421-32405443 GGGCCCGGCGGCTCTGAGGCAGG - Intergenic
1166096326 19:40541573-40541595 GGGCCAGGCTGGGCTGAGGGAGG + Intronic
1167322878 19:48807207-48807229 GGGGCAGGTGGTCCTGAAGGAGG + Intronic
1168355488 19:55697212-55697234 GCTCTAGGCGGTTGTGATGGGGG + Intronic
926045238 2:9705019-9705041 GAGCCTGGCTCTTCTGATGGGGG + Intergenic
929773789 2:44915118-44915140 CCTCCAGGTGGTTCTGATGGAGG + Intergenic
930051358 2:47218551-47218573 GGGGCTGGCGTTCCTGATGGAGG - Intergenic
930764758 2:55073925-55073947 GGGGCAGGTGGTCCTGAGGGAGG - Intronic
934773215 2:96921202-96921224 GGGCCAGCAGGTTGTGGTGGTGG + Exonic
935172435 2:100620853-100620875 GGGGCAGGAGGTACGGATGGGGG - Intergenic
936019991 2:108987660-108987682 GGGCCAGGCTGTGCTGTGGGAGG - Intronic
938145694 2:128833370-128833392 AGTCCACGAGGTTCTGATGGAGG - Intergenic
940763900 2:157769057-157769079 GGGCCAAGAGGTTTTGACGGAGG + Intronic
941005708 2:160244944-160244966 GGGACAGGGAGTTGTGATGGAGG + Intronic
941562033 2:167058622-167058644 GGCCCAGGCTATTCTGCTGGAGG - Intronic
942072422 2:172327825-172327847 GGGCCAGGCCGTGCAGATGGGGG + Intergenic
944483610 2:200181186-200181208 GAGCCAGGCTGTCCTGCTGGAGG - Intergenic
945019503 2:205556998-205557020 GGGCCAGGTGGGAATGATGGAGG - Intronic
945024487 2:205606887-205606909 GGCCCAGGTGATTCTGATGCAGG - Intronic
946370378 2:219278090-219278112 TAGGCAGGAGGTTCTGATGGTGG + Intronic
947717045 2:232346080-232346102 CGGCCGGGAGGTTCTGAAGGAGG + Intergenic
947735487 2:232452402-232452424 CGGCCGGGAGGTTCTGAAGGAGG + Intergenic
1168831079 20:845522-845544 GGGCCGGGCAGCTCTGAAGGGGG + Exonic
1171252823 20:23662478-23662500 GGGCCAGGTTCTTCTCATGGAGG + Intergenic
1175540695 20:59745937-59745959 GCACCAGGCGGTGCTCATGGTGG - Intronic
1175764522 20:61583215-61583237 GGGACAGACGGTTCTGCGGGGGG + Intronic
1175764540 20:61583275-61583297 GGGACAGACGGTTCTGCGGGGGG + Intronic
1175852620 20:62101909-62101931 AGGCCAGGCAGCTCTGAAGGTGG - Intergenic
1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG + Intergenic
1175936227 20:62515383-62515405 GGGCCAGGGGTCTCTGACGGGGG - Intergenic
1176109586 20:63405347-63405369 GGGGCAGGCGGCTCTAATGCGGG - Intergenic
1176148948 20:63579128-63579150 GTGCCAGAAGGATCTGATGGGGG + Intergenic
1178005649 21:28217283-28217305 GGGCCAAGAGGATCTGATGGCGG - Intergenic
1179887014 21:44318611-44318633 GGGCCAGGCGGTTCTGATGGGGG - Intronic
1180866574 22:19122936-19122958 GGGCCTGCCGGTTCTGAGGGTGG + Intergenic
1180971660 22:19819194-19819216 GGGCCTGGCAGTCCTGGTGGGGG - Intronic
1182296576 22:29313836-29313858 GGGCCCGGCAGTTCTGGCGGTGG - Intronic
1182766513 22:32761587-32761609 GGGGCAGGTGCTTCTGGTGGGGG + Intronic
1183337820 22:37260665-37260687 GGTCCAGGGGCTTCTGATGCTGG + Intergenic
1183950376 22:41349306-41349328 GGGGCAGGCGGTGCAGGTGGAGG + Intronic
1184755089 22:46511366-46511388 TGGCCAGGAGGTTGTGGTGGGGG - Intronic
1185074153 22:48674149-48674171 GGGCCGGGCGGTGCAGATGTAGG + Intronic
1185276012 22:49950469-49950491 GGGCCAGGCTGTGTTGTTGGGGG + Intergenic
949535009 3:4988832-4988854 GGGCAGGGCAGTTCTGCTGGAGG + Intergenic
950033039 3:9864394-9864416 GGGCCTGGCGGTCCTAGTGGGGG - Intergenic
950518756 3:13483764-13483786 GGGCCAGGCCACTCTGAGGGTGG + Intronic
950533072 3:13564240-13564262 GGGCCAGGTGGTACTGATTATGG + Intronic
950576955 3:13837776-13837798 GGCCCAGGCAGCTCAGATGGAGG - Intronic
954381321 3:50220720-50220742 GGGCCAGCAGGTTCTGCTGAGGG + Exonic
954938204 3:54346239-54346261 GGGCCAGGTTGCTCTGACGGAGG - Intronic
955320936 3:57973779-57973801 GGGCCTGGTGGTGCTGCTGGTGG + Intergenic
955396721 3:58562906-58562928 GAGCCATGCGGCTCTGATGCGGG + Intergenic
958709740 3:97703200-97703222 GGGCCAAACGGTTCTGGTTGTGG + Intronic
959615247 3:108340110-108340132 GGGCCAGGCGGATTAGAAGGAGG + Intronic
961427961 3:126862184-126862206 GGAGGAGGCGGTTGTGATGGTGG - Intronic
961428273 3:126863258-126863280 GGAGGAGGCGGTTGTGATGGTGG - Intronic
962351582 3:134660241-134660263 GGGCAAGGAGGTTGCGATGGAGG + Intronic
966852829 3:184175162-184175184 GCGCCAGGCGGGTCAGGTGGAGG - Intronic
967891190 3:194365704-194365726 GGGCCGGGCGGCCCTGCTGGAGG - Intronic
967981778 3:195070071-195070093 GGGTCTGGGGGTTCTCATGGCGG + Exonic
967991781 3:195136916-195136938 GGTCCAGGCCTTTCTGATGAAGG - Intronic
969722644 4:8901065-8901087 GGGTCAGGGGGTTCTGGTGTAGG - Intergenic
978789037 4:112641564-112641586 GGACCAGGTGCTTATGATGGAGG + Intronic
985630250 5:1010144-1010166 GAGCCAGGCGGCCCTGAGGGTGG + Intronic
985890194 5:2709124-2709146 GGGGCAGGAGGTTGAGATGGTGG + Intergenic
988487431 5:31678437-31678459 GGGACAGTCAGTTCTGGTGGGGG + Intronic
988487448 5:31678508-31678530 GGGACAGTCAGTTCTGGTGGGGG + Intronic
991589109 5:68230624-68230646 GGGACAGGTAGTTCTGCTGGTGG + Intronic
999300805 5:150489120-150489142 AGGAGAGGCTGTTCTGATGGAGG + Intronic
1003473140 6:6455560-6455582 AGGCCATGCGTTTCAGATGGAGG + Intergenic
1006301835 6:33197780-33197802 TGGCCAGGCACTTCTGATAGCGG + Exonic
1006945827 6:37783941-37783963 GGGCCGGGCTGTGCTAATGGCGG + Intergenic
1007844333 6:44741181-44741203 GGGGCAGGTGGTTCTGAGAGGGG - Intergenic
1014717210 6:124879982-124880004 GGGCAAGGTGGTTGTGATGAGGG - Intergenic
1017684063 6:156894282-156894304 GGGCCGGGGGGTTGGGATGGGGG + Intronic
1018258595 6:161947554-161947576 GGGCCAGGCAGGTGTGAAGGAGG - Intronic
1019073715 6:169370249-169370271 GTCCCAGGAGGTGCTGATGGAGG + Intergenic
1019488193 7:1299026-1299048 GGGCCAGGGGGCTGTGAAGGAGG + Intergenic
1019607499 7:1917473-1917495 CGGCCAGGCGGTGCTGAGGGCGG - Intronic
1019692841 7:2426272-2426294 GAGCCAGGCTGATGTGATGGGGG + Intronic
1020832591 7:13110279-13110301 GGGGCAGGGGGTGCTGAGGGTGG - Intergenic
1025093239 7:56079835-56079857 GGGCCAGGTGTTTCTGTTAGAGG + Exonic
1025834986 7:65085780-65085802 GGGGCAGGTGGTCCTGGTGGGGG + Intergenic
1025904757 7:65775259-65775281 GGGGCAGGTGGTCCTGGTGGGGG + Intergenic
1026142048 7:67714621-67714643 AGGCCAGGCGATTCGGATGCAGG + Intergenic
1027800203 7:82741037-82741059 GGGCCAAGCGGTCTTGATGATGG - Intergenic
1027829058 7:83155034-83155056 GAGCCAGGCTGTTGAGATGGGGG + Exonic
1027829072 7:83155094-83155116 GGGCCAGGCTGTTGAGGTGGGGG + Exonic
1027829078 7:83155124-83155146 GAGCCAGGCTGTTGAGATGGGGG + Exonic
1027829094 7:83155184-83155206 GGGCCAGGCTGTTGAGGTGGGGG + Exonic
1027829100 7:83155214-83155236 GGGCCAGGCAGTTGTGAAGGAGG + Exonic
1028984568 7:96999329-96999351 GGGCCAGGAGGTGGAGATGGGGG - Intergenic
1029706262 7:102277942-102277964 GGGCCAGGCGGTTCTCCTGGGGG - Intronic
1032128430 7:129211129-129211151 GGGCCAGGCGGCTCCGGTAGAGG - Intronic
1034093133 7:148382268-148382290 GGGGCACGGGGTTCCGATGGTGG - Intronic
1034243216 7:149625007-149625029 CGGCCAGGCGGGTCTTATGAGGG - Intergenic
1034533580 7:151712729-151712751 GGGCCACGCTGTGCTGAGGGAGG + Intronic
1034739420 7:153459724-153459746 GGCCCAGGTGGTTCTTATGATGG + Intergenic
1034900421 7:154904974-154904996 GAGCCAGGCGCTGTTGATGGGGG - Intergenic
1035169443 7:157009585-157009607 GGGGCAGGCGGTGCCGGTGGAGG + Intronic
1035570694 8:670771-670793 GGGCCAGGGGGTTCAGAGGTTGG - Intronic
1040500066 8:47997842-47997864 GGGTCATGCTGTTCTGGTGGAGG + Intergenic
1044928289 8:97227962-97227984 GGTCAAGTCTGTTCTGATGGAGG + Intergenic
1047301247 8:123615184-123615206 GGGCCAGGTGATTCTGAGGCAGG - Intergenic
1049319045 8:141986205-141986227 GGGCTGGGCGGTGCTGATGCAGG + Intergenic
1052094602 9:24369254-24369276 GGGCTAGGTGGGACTGATGGGGG + Intergenic
1053593225 9:39534034-39534056 GGTCCAGGCGGTTCTGCGAGTGG + Intergenic
1053850961 9:42288742-42288764 GGTCCAGGCGGTTCTGCGAGTGG + Intergenic
1054573081 9:66831243-66831265 GGTCCAGGCGGTTCTGCGAGTGG - Intergenic
1057914878 9:99047885-99047907 GGGCCAGGCTGGTCTGTGGGCGG + Intronic
1057964829 9:99492667-99492689 GGGACAGGCTGTCCTGGTGGAGG - Intergenic
1062561206 9:137142865-137142887 GGGCCAGGAGGGTCTGCAGGAGG - Intronic
1062702605 9:137915374-137915396 GGGCCAGGGTGTTGTGATAGAGG + Intronic
1191778660 X:64844881-64844903 GGGCCAGGCTTTTCTGTTTGCGG - Intergenic
1195031162 X:100928963-100928985 GGGCCAGGCGGTCTTGGGGGCGG - Intronic
1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG + Intronic
1199981896 X:152925682-152925704 GGGCCTGGGAGTACTGATGGTGG - Intronic