ID: 1179889964

View in Genome Browser
Species Human (GRCh38)
Location 21:44330462-44330484
Sequence CTCAGATTCTCCGAGTGTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179889964_1179889969 9 Left 1179889964 21:44330462-44330484 CCGGCACACTCGGAGAATCTGAG 0: 1
1: 0
2: 0
3: 2
4: 126
Right 1179889969 21:44330494-44330516 CCCGCCTGTGGACGCGTGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 52
1179889964_1179889966 -3 Left 1179889964 21:44330462-44330484 CCGGCACACTCGGAGAATCTGAG 0: 1
1: 0
2: 0
3: 2
4: 126
Right 1179889966 21:44330482-44330504 GAGCAGAGGAGCCCCGCCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179889964 Original CRISPR CTCAGATTCTCCGAGTGTGC CGG (reversed) Exonic
901482025 1:9531773-9531795 CTCAGCTTCCCAAAGTGTGCTGG + Intergenic
901681981 1:10918376-10918398 CTCAGATGCCTCCAGTGTGCAGG - Intergenic
903642987 1:24872409-24872431 CTCAGATTCTCCAGCTGAGCAGG - Intergenic
906646280 1:47477835-47477857 CTCAGATTCGCTGGGGGTGCAGG + Intergenic
907138027 1:52157653-52157675 CTCAGCCTCCCAGAGTGTGCTGG + Intronic
910542769 1:88379536-88379558 CACAGACTCTCCAAGGGTGCTGG + Intergenic
916638741 1:166703114-166703136 ATCCCATTCTCCCAGTGTGCAGG - Intergenic
920848470 1:209612565-209612587 ATCAGATTCCCCGAGTTTCCAGG + Intronic
923473422 1:234312228-234312250 GTGAGATTCTCCGATTGTTCAGG + Intronic
1066443707 10:35462650-35462672 GACAGCTTCTCAGAGTGTGCGGG + Intronic
1070734973 10:78856991-78857013 CTCAGTTTCCCCAAGGGTGCAGG - Intergenic
1073199787 10:101726030-101726052 CGCAGATCCTCAGAGTCTGCTGG - Intergenic
1084448477 11:69218170-69218192 CTCAGTTTCTCCATTTGTGCAGG - Intergenic
1091095092 11:132813420-132813442 CTCAGGTTCTACCATTGTGCTGG - Intronic
1091864694 12:3822104-3822126 TTCACATTCTCCCAGTGTGGTGG + Exonic
1097119915 12:56723910-56723932 CTGAGATACTTCTAGTGTGCTGG - Intronic
1097514298 12:60585229-60585251 CACCCATTCTCCCAGTGTGCAGG + Intergenic
1097676218 12:62604451-62604473 CTCAGATTCTGCTGGTGTGGTGG + Intergenic
1100069068 12:90688470-90688492 CTCAGATTTTCCCAATGTGTGGG + Intergenic
1100582679 12:95949996-95950018 CTAACATTCTCCGTCTGTGCAGG - Intronic
1100916435 12:99428699-99428721 CTCAGACTCTCTCAGTGGGCAGG - Intronic
1101687407 12:107038773-107038795 TTCACATTCTCCCAATGTGCAGG - Intronic
1102784895 12:115596384-115596406 CACAGTTTCTCCTACTGTGCTGG + Intergenic
1103482816 12:121261835-121261857 CCCAGCTTCTCCCAGTGAGCTGG + Intronic
1105613812 13:21994100-21994122 ATCAGATGATCTGAGTGTGCAGG - Intergenic
1107852843 13:44588290-44588312 ATCCTATTCTCCCAGTGTGCAGG - Intergenic
1107885536 13:44871844-44871866 CTCAGATCCTCCTACTGTGGAGG + Intergenic
1110109974 13:71733642-71733664 ATCAGATTATCCCAGTGTGTTGG + Intronic
1110683765 13:78347561-78347583 CTCAGCTTCTCCAAATGTGAAGG - Intergenic
1114615231 14:24064712-24064734 CTCAGCTTCTCCAAGTGACCTGG - Intronic
1122344679 14:101051199-101051221 CACACATTCTCCCACTGTGCAGG - Intergenic
1122790827 14:104183509-104183531 CTCAGTTTCCCCAAGTGTCCCGG - Intergenic
1122877197 14:104673692-104673714 CTCAGACCCTCTGAGTCTGCAGG - Intergenic
1123961101 15:25402135-25402157 CTCAGCTTCTTCAAATGTGCAGG - Intronic
1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG + Intronic
1127383396 15:58448555-58448577 CTCAGGCTCTCAGAGTGTGAAGG + Intronic
1132091780 15:98953242-98953264 CTCAGTGTCACCGAGTGTTCTGG + Intronic
1132693317 16:1191331-1191353 GTCAGAGACCCCGAGTGTGCCGG - Intronic
1133223012 16:4327444-4327466 CTTAGTTTCCCTGAGTGTGCTGG + Intronic
1134160058 16:11880575-11880597 CTCAGCTTTTCCGAAAGTGCAGG + Intronic
1134646561 16:15872456-15872478 CTCAGCCTCTCAGAGTGTGGGGG - Intronic
1136656120 16:31710290-31710312 TTCAGATTCTCCTAGTCTTCTGG - Intergenic
1141677100 16:85523715-85523737 CTCAGTGTCTCCCAGTGTTCGGG - Intergenic
1142027734 16:87823578-87823600 CCCGGATTCTCCATGTGTGCGGG + Intergenic
1142321080 16:89383408-89383430 CTCACATTCTCCCAGAGTGTGGG - Intronic
1145791768 17:27632057-27632079 CTCAGATTTTCCGTGTATGAAGG - Intronic
1149614911 17:57988867-57988889 CTCAGATCCTCTCAGTGTGGAGG + Intergenic
1150801129 17:68283567-68283589 CTCAGCTTCCCAAAGTGTGCTGG - Intronic
1151352545 17:73540205-73540227 CTCAGAGCCTCCGAGGGAGCAGG + Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1158834686 18:61318347-61318369 CCCAGATTCTCCTAGCCTGCAGG - Intergenic
1161204883 19:3035825-3035847 CTCAGATTCTCCTAGGGAGGGGG - Intronic
1161637930 19:5400961-5400983 CTCAGAACCTCCGAATGTACTGG + Intergenic
1161757414 19:6144388-6144410 ATGACATTCTCCGTGTGTGCAGG - Intronic
1161903892 19:7140594-7140616 CTCACATTATCCCAGTGAGCTGG - Intronic
1161934795 19:7364984-7365006 CTCAGATCCTCCGAGGCTGTGGG - Intronic
1162184224 19:8892125-8892147 TTTAGATTCTCTGAGTGTCCCGG + Intronic
1162184612 19:8895181-8895203 CTTAGATTCCCTGAGTGTACTGG + Intronic
1162490489 19:10988354-10988376 CTCAGATGCTCCCAAAGTGCTGG + Intronic
1164577950 19:29417099-29417121 ATCAGACTCTCTGAGTGTTCAGG - Intergenic
1165453386 19:35897820-35897842 CCCACAGTCTCCGAGTGTGCTGG + Exonic
1165996171 19:39845788-39845810 CCCAGCTTTTCCGAGTGGGCCGG - Intronic
1167431759 19:49459199-49459221 CTCAGATTCCCAGTATGTGCTGG + Intronic
1167452451 19:49580102-49580124 CTCAGTTTCTCAGACTGTGGTGG - Intronic
1167980124 19:53268927-53268949 CTCTAATTCTGAGAGTGTGCAGG - Intergenic
1167985765 19:53313896-53313918 CTCTAATTCTGAGAGTGTGCAGG + Intergenic
1168115474 19:54219726-54219748 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168121278 19:54253875-54253897 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168124786 19:54277407-54277429 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168132819 19:54332033-54332055 CTCAGTTTCTCCAAGTGTAAAGG - Intergenic
1168181502 19:54665301-54665323 CTCAGTTTCTCCAAGTGTAAAGG + Intronic
925355623 2:3239128-3239150 CTCAGACTCTCCCAGTGGCCGGG - Intronic
926996900 2:18745360-18745382 CTCAGCTTCTCAAAGTGCGCTGG + Intergenic
932234602 2:70110911-70110933 CTCAGCCTCTCAAAGTGTGCTGG - Intergenic
937336010 2:121062727-121062749 CTCGGGTTATCCGAGTGGGCGGG - Intergenic
942094454 2:172524219-172524241 CTCAGATTCTCCAAGTACGTGGG + Intergenic
942151353 2:173078630-173078652 CACAGATTCTTCTACTGTGCTGG - Intronic
945486152 2:210398510-210398532 CTCAGATTGTTCATGTGTGCTGG + Intergenic
1168917529 20:1503113-1503135 CTTAGATTCTCATAGTGTGTAGG + Intergenic
1172179473 20:32992443-32992465 CTCAGCTTCTCAGAGTGAGAGGG - Intronic
1175251963 20:57615334-57615356 TTCAGATTCTCCCACTGTGAGGG + Intronic
1175837808 20:62007471-62007493 CGCAGATGCACCAAGTGTGCAGG - Intronic
1179274248 21:39877338-39877360 CTCAGCTTCTCTGTGTGTGACGG - Intronic
1179889964 21:44330462-44330484 CTCAGATTCTCCGAGTGTGCCGG - Exonic
1181968060 22:26670364-26670386 CTCTGATTCTCCATGTGAGCTGG - Intergenic
953678487 3:45021674-45021696 CTCACATTCTCAGAGTGGGAAGG - Intronic
954196864 3:49002180-49002202 CTCAGATACTCCGGGTGAGATGG - Intronic
954378475 3:50206943-50206965 CTCAGTTTCTCCAACTGTCCAGG - Intronic
954871888 3:53773553-53773575 TGCAGATTCTCCACGTGTGCAGG + Intronic
955264489 3:57428178-57428200 CTCAGCTTCCCACAGTGTGCTGG + Intronic
959403748 3:105935423-105935445 CTCAGGTTCTCAGAGTCTTCTGG + Intergenic
959695275 3:109242916-109242938 CTCAGATGCTCTGAGTCTCCTGG - Intergenic
960707221 3:120492935-120492957 CTCAGAGTCTACGGGTGTGTAGG + Intergenic
965748758 3:171954898-171954920 CTCAGATTCTCAAAATGAGCAGG - Intergenic
967932466 3:194700324-194700346 CTCATTTTTTCCCAGTGTGCCGG + Intergenic
970595204 4:17593898-17593920 AGCAGATTCACCGAGTGTGGTGG - Intronic
971535425 4:27742466-27742488 TTTTGATTCTCAGAGTGTGCAGG - Intergenic
973314248 4:48743104-48743126 CTCAGATTGTCTGAGTGTGGTGG - Intronic
982917672 4:161233105-161233127 GTCAGACTCTCAGAGTGTGTAGG + Intergenic
985654669 5:1123652-1123674 GTCAGCTTCTCTGAGTGTCCTGG + Intergenic
992409193 5:76488824-76488846 TTCAGATTCTCTTGGTGTGCGGG + Intronic
1000452965 5:161413015-161413037 CTCACATCCTCCCAGAGTGCTGG + Intronic
1001524194 5:172416994-172417016 CTCACAGTCACCGAGTGTGATGG - Intronic
1003218904 6:4139127-4139149 CTCAGTTTCTCTGAGTTTCCAGG + Intergenic
1006013437 6:31061672-31061694 CTCAGGTTCTCCAAGTGTAAGGG - Intergenic
1006149836 6:31981068-31981090 CTCAGCTCCTCAGAGTGGGCCGG + Exonic
1006156137 6:32013806-32013828 CTCAGCTCCTCAGAGTGGGCCGG + Intergenic
1006327146 6:33362915-33362937 CCCAGAATCTCCAAGTGTTCAGG + Intergenic
1008720803 6:54348869-54348891 CTCAGATTCTCATACTGTGTTGG + Intronic
1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG + Intronic
1013039658 6:106421080-106421102 CTCAGATTCTCAAAGTGGGATGG - Intergenic
1022942697 7:35255018-35255040 CTCAAATTCTCCGAATTCGCAGG + Intergenic
1025985762 7:66450153-66450175 CTCACATTCTCCAAGTTTGAAGG - Intergenic
1026002612 7:66573467-66573489 CTCACATTCTCCAAGTTTGAAGG - Intergenic
1026509298 7:71015361-71015383 CTTTCATTCTCCGAGTTTGCTGG + Intergenic
1027208988 7:76128702-76128724 CTCACATTCTCCAAGTTTGAAGG - Intergenic
1029991540 7:104967025-104967047 CTCAGTTTCTCCAAGTGTTGTGG + Intergenic
1038704626 8:29881961-29881983 TTCAGATCCTCTGAGAGTGCAGG + Intergenic
1039346552 8:36711573-36711595 CTCAGATTCTCTGGGGATGCTGG - Intergenic
1040433727 8:47369138-47369160 CTAAGATTCTCACATTGTGCAGG + Intronic
1044012304 8:87009549-87009571 CTCAGCCTCTCAAAGTGTGCTGG + Intronic
1046237289 8:111441825-111441847 ATCAGATTCTCTGTGTGTTCAGG - Intergenic
1048836157 8:138520786-138520808 CTCAGAGCCTCCCACTGTGCAGG - Intergenic
1060237593 9:121876837-121876859 CTCAGAAACTCTGAGTGGGCTGG + Intronic
1188682414 X:33027171-33027193 CCCAGATTATCTGAGTGGGCAGG + Intronic
1199379641 X:147155230-147155252 TTCACATTCTCCCAGAGTGCAGG - Intergenic
1200888899 Y:8300283-8300305 CATAGTTTCTCCGACTGTGCAGG - Intergenic
1201773595 Y:17641935-17641957 CTCAGCTTCTCTGAGTGTCTGGG + Intergenic
1201827961 Y:18264050-18264072 CTCAGCTTCTCTGAGTGTCTGGG - Intergenic