ID: 1179896228

View in Genome Browser
Species Human (GRCh38)
Location 21:44365253-44365275
Sequence ATTGGGTGCCACTGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179896223_1179896228 6 Left 1179896223 21:44365224-44365246 CCAGCCTTCTGGAGGGTTCTGAG No data
Right 1179896228 21:44365253-44365275 ATTGGGTGCCACTGTCCTGGAGG No data
1179896224_1179896228 2 Left 1179896224 21:44365228-44365250 CCTTCTGGAGGGTTCTGAGACAG No data
Right 1179896228 21:44365253-44365275 ATTGGGTGCCACTGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179896228 Original CRISPR ATTGGGTGCCACTGTCCTGG AGG Intronic