ID: 1179897123

View in Genome Browser
Species Human (GRCh38)
Location 21:44369331-44369353
Sequence GATCCATCCCACGGTGAGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179897113_1179897123 23 Left 1179897113 21:44369285-44369307 CCATCGGAGTCGCCACCTGGGGC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 91
1179897115_1179897123 8 Left 1179897115 21:44369300-44369322 CCTGGGGCACTGTCCACCGCCGC 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 91
1179897114_1179897123 11 Left 1179897114 21:44369297-44369319 CCACCTGGGGCACTGTCCACCGC 0: 1
1: 0
2: 2
3: 9
4: 188
Right 1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 91
1179897119_1179897123 -8 Left 1179897119 21:44369316-44369338 CCGCCGCGAGGGCCTGATCCATC 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 91
1179897118_1179897123 -5 Left 1179897118 21:44369313-44369335 CCACCGCCGCGAGGGCCTGATCC 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179897123 Original CRISPR GATCCATCCCACGGTGAGTG CGG Exonic
900823113 1:4905287-4905309 CATCCAGCCCATGGTGAGTGAGG + Intergenic
901274577 1:7981178-7981200 GAAACTTCCCACAGTGAGTGGGG - Intronic
905885845 1:41491480-41491502 CCTGCATCCCAAGGTGAGTGGGG - Intergenic
905952158 1:41960938-41960960 TATCCATCCCATGGAGAGTTGGG + Intronic
907623234 1:56003411-56003433 GATGTACCCCACGGTGGGTGAGG + Intergenic
912022052 1:105117612-105117634 GACCCATCCCAAGGGGAATGGGG + Intergenic
912055755 1:105596477-105596499 GATCCCTCCCACGATATGTGGGG - Intergenic
918231560 1:182538007-182538029 GATCCATTCCACAGTCAGGGAGG - Intronic
920495111 1:206448993-206449015 GATCCATCCCATGGGGAAAGAGG + Intronic
920987895 1:210907725-210907747 GATCCATCCCAGTGGGGGTGGGG + Intronic
1066151420 10:32623805-32623827 GATATGTCACACGGTGAGTGTGG + Intronic
1067966003 10:50913475-50913497 TTTCCAACCCACAGTGAGTGTGG + Intergenic
1076420930 10:130331074-130331096 GATCCCTCCCATGGTGGGGGAGG - Intergenic
1079930469 11:26553333-26553355 TATCTATGCCAAGGTGAGTGTGG + Exonic
1082026127 11:47573590-47573612 GGTCCATCCCACGGCGCATGTGG - Exonic
1083301424 11:61741370-61741392 GCCCCACCCCAGGGTGAGTGTGG + Intronic
1083822978 11:65182956-65182978 GAAGCGTCCCACGGTGAGAGGGG + Exonic
1084743672 11:71154898-71154920 GGTCCATCCCTCTGGGAGTGTGG - Intronic
1085143519 11:74171359-74171381 GCTTCGTCCCACGTTGAGTGTGG - Exonic
1087859213 11:103132913-103132935 GATTCACACCACTGTGAGTGGGG + Intronic
1091240056 11:134046235-134046257 GATCCATCCCCGGATGGGTGGGG - Intergenic
1091320494 11:134646010-134646032 GATCCATTCGAGGGTGAGAGAGG - Intergenic
1094556033 12:31501142-31501164 GGTCCCTCCCACGGTGTGTGGGG - Intronic
1102240651 12:111322568-111322590 GGTGCCTCCCAGGGTGAGTGCGG + Exonic
1102784786 12:115595666-115595688 GAACCCTCCCATGGTCAGTGGGG - Intergenic
1103918739 12:124388851-124388873 TCTCCGTCCCACGGTGAGGGAGG + Intronic
1104375916 12:128266023-128266045 GAGCCAGCCCACGGTGAGAGGGG + Intergenic
1104513716 12:129404629-129404651 GAGCCATCACACGGTGAGAGTGG + Intronic
1113926379 13:113944073-113944095 GATCCATCCCGGGGTGACTGGGG - Intergenic
1121066900 14:90975909-90975931 TATTCATTCCACAGTGAGTGAGG - Intronic
1121924139 14:97912690-97912712 GATCCATCCCACCTTCAGAGAGG + Intergenic
1124892733 15:33748017-33748039 GGTGCATCCCACTGTGGGTGGGG - Intronic
1127576533 15:60297245-60297267 GATCCAAGCAACAGTGAGTGTGG - Intergenic
1129484983 15:75862170-75862192 GGCCCATCCCACAGTGAGTCTGG - Intronic
1131627522 15:94137679-94137701 GATCAATCCCTTGATGAGTGGGG + Intergenic
1132631357 16:919226-919248 GATCCACCCCACGTGGAGGGTGG + Intronic
1132672993 16:1109391-1109413 GCTCCAGACCACGGTGGGTGGGG - Intergenic
1135668604 16:24356113-24356135 GATCCACCCCAAGAGGAGTGGGG - Intronic
1135925724 16:26692183-26692205 GAACCTACCGACGGTGAGTGAGG + Intergenic
1137852114 16:51756165-51756187 GATCACTCCCAGGGTGAGGGTGG + Intergenic
1139207690 16:65044998-65045020 GTTCCATCCCACACTGTGTGGGG + Intronic
1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG + Intronic
1142501371 17:335071-335093 GGTCCGACCCACGGTGAGCGTGG + Intronic
1143136499 17:4715324-4715346 GAGCCAACCCAAGGTGCGTGGGG + Intronic
1151574831 17:74947533-74947555 GATCCATCCCTTCCTGAGTGAGG - Intronic
1160353953 18:78210589-78210611 GAGCCATGGCAAGGTGAGTGTGG + Intergenic
1162591677 19:11596377-11596399 GCTCCATGTCACAGTGAGTGTGG + Intronic
1165981844 19:39730963-39730985 GATCCATGACAGGGTGGGTGGGG - Intergenic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167837234 19:52084144-52084166 TATCCATCCCACAGAGAATGTGG - Intronic
925145492 2:1580757-1580779 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145571 2:1581125-1581147 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145652 2:1581494-1581516 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145664 2:1581547-1581569 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145682 2:1581653-1581675 GATCCTTCCCACAGTGAAGGAGG + Intergenic
925145695 2:1581707-1581729 GATCCTTCCCACCGTGAAGGGGG + Intergenic
927443037 2:23133006-23133028 GCTCCATCCCATGCTGAGGGTGG - Intergenic
940443700 2:153751401-153751423 GATCTATCCAATGCTGAGTGTGG + Intergenic
941729834 2:168904572-168904594 TATCCATCCCACAGACAGTGTGG - Exonic
943658985 2:190537343-190537365 GGTCCCTCCCACGATGTGTGGGG - Intergenic
948975295 2:241460061-241460083 ACTCCATGCCACGGTGACTGTGG + Intronic
1169710430 20:8555470-8555492 GCCCCATCCCATGTTGAGTGAGG - Intronic
1171897422 20:30821512-30821534 GCTCCATCCTACAGTTAGTGAGG + Intergenic
1173540424 20:43847064-43847086 GGTCCACCCCATTGTGAGTGAGG + Intergenic
1173681569 20:44885874-44885896 CAGCCCTCCCACGGTGAGTGCGG + Exonic
1176043956 20:63082933-63082955 AATCAATGCCAGGGTGAGTGGGG + Intergenic
1177852659 21:26366996-26367018 GTCCCATCCCACAGTGAGTCAGG - Intergenic
1178637914 21:34321370-34321392 GATGCATAGCATGGTGAGTGAGG + Intergenic
1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG + Exonic
1184211759 22:43040252-43040274 GAACCAGCCCAGGGTAAGTGAGG + Intronic
951503754 3:23418350-23418372 GATCCAGCCCATGGAGGGTGGGG - Intronic
953908160 3:46878732-46878754 CAGCCATCCCACCGTGAGTAGGG - Intronic
954497725 3:50981517-50981539 GATCCATCCAATGCTGAGAGTGG + Intronic
956746146 3:72312347-72312369 GAGCCTTCCCAAGGTGGGTGAGG - Intergenic
961382637 3:126505716-126505738 GATGCACCCCACGATGACTGCGG + Exonic
961388674 3:126538782-126538804 CAGCCTTCCCATGGTGAGTGTGG + Intronic
966528113 3:180942939-180942961 GATCCATAGCACTGTAAGTGGGG + Intronic
973955045 4:56055207-56055229 AATCCCTCCCCAGGTGAGTGGGG - Intergenic
981467209 4:145086932-145086954 TATCCCTCCCATGGAGAGTGGGG - Intronic
993004955 5:82419784-82419806 GATTCATCCACCTGTGAGTGGGG + Intergenic
995390868 5:111639228-111639250 AATTCATACCACAGTGAGTGGGG + Intergenic
996319733 5:122201348-122201370 AATATAACCCACGGTGAGTGCGG + Intergenic
1002678521 5:180939659-180939681 GATCTGTCCAATGGTGAGTGTGG - Intronic
1004169251 6:13283291-13283313 GATGCATCGCATAGTGAGTGAGG - Intronic
1019022883 6:168933171-168933193 GTTCCAGCCCACGGAGAGAGAGG + Intergenic
1026405683 7:70063104-70063126 CATCCATCACACTGTGGGTGGGG - Intronic
1033218923 7:139514953-139514975 AATCCAATCCACGGGGAGTGGGG - Intergenic
1034339470 7:150342257-150342279 AATCTATCCCACGGAGAATGGGG - Intergenic
1034744627 7:153512989-153513011 GATTTATCACAGGGTGAGTGAGG - Intergenic
1035050561 7:155996478-155996500 GGTGCATCTCACGGTGAGAGAGG - Intergenic
1040561695 8:48528367-48528389 GGGCCCTCCCAGGGTGAGTGAGG - Intergenic
1046702615 8:117418491-117418513 GATGCAACCCATGGAGAGTGAGG + Intergenic
1048510477 8:135057359-135057381 CATCCTTCCCACGGTGCGTGAGG - Intergenic
1050616618 9:7407981-7408003 GATCCATCCTGGGGTGAGAGGGG - Intergenic
1051523652 9:18018537-18018559 GATCAATCAAAGGGTGAGTGAGG - Intergenic
1055413077 9:76052567-76052589 GGTCCCTCCCACGATGCGTGGGG + Intronic
1203577891 Un_KI270745v1:22041-22063 GGCCCATCCCACGCTGAGAGAGG + Intergenic
1187528182 X:20072613-20072635 GATCCCACCCACGTTGAGGGTGG + Intronic
1192325428 X:70128090-70128112 CATGGATCCCACAGTGAGTGGGG - Intergenic