ID: 1179898389

View in Genome Browser
Species Human (GRCh38)
Location 21:44376235-44376257
Sequence ACCAGGATGTTCATGGTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179898389 Original CRISPR ACCAGGATGTTCATGGTACT CGG Intronic
900227584 1:1540306-1540328 ACCATGATCTTCATGATTCTGGG - Exonic
903813706 1:26049364-26049386 ACCATCAAGTTCATGGTGCTTGG - Intergenic
906448299 1:45922379-45922401 ACCAGGCTGTTCATGCTAAGGGG + Intronic
908521595 1:64948849-64948871 CCCAGAATGTTAATGGTACTTGG + Intronic
909953536 1:81749446-81749468 GCCAGGTTATTAATGGTACTGGG - Intronic
910277697 1:85465832-85465854 ACCAGAATGTTGAAGGGACTTGG - Intronic
916194862 1:162213142-162213164 ACCAGGGTGTTCAAGTTACCTGG - Intronic
919053311 1:192538125-192538147 TCTAGGATTTTTATGGTACTAGG - Intergenic
920656853 1:207883145-207883167 ACCCGGATCTTTCTGGTACTCGG + Intergenic
921786307 1:219234076-219234098 ACCAGGATGTTTAATGAACTTGG - Intergenic
921947794 1:220898575-220898597 TCCAGGATTTTTATGGTCCTAGG + Intergenic
922678788 1:227572579-227572601 ACCGGGATGATGATGGCACTTGG - Intronic
922937144 1:229431719-229431741 ACCTTGATCTTCATGGTGCTGGG + Exonic
1065430491 10:25649793-25649815 ACGAGGATAGGCATGGTACTGGG + Intergenic
1066033304 10:31452186-31452208 TCTAACATGTTCATGGTACTTGG + Intronic
1066054546 10:31668241-31668263 ACCAGGATGTTGAAGGAAATGGG - Intergenic
1069754513 10:70765133-70765155 TACAGGAAGTTTATGGTACTGGG - Intergenic
1070990580 10:80728689-80728711 AGCAGGATCTGCATGGTCCTTGG - Intergenic
1071789347 10:88938059-88938081 ACCTTGATCTTCATGGTGCTGGG + Exonic
1075612031 10:123862120-123862142 GCCAGGATGTGCATGGTCCCAGG + Intronic
1078732449 11:13987663-13987685 TCTAGGATTTTCATGGTCCTAGG + Intronic
1080201995 11:29682735-29682757 ATCAGTATGTTCATGCTAATGGG + Intergenic
1080489018 11:32742767-32742789 TCCAGGATTTTTATGGTCCTAGG + Intronic
1080737146 11:35027405-35027427 TCCAGGATTTTTATGGTCCTAGG - Intergenic
1090575420 11:128096844-128096866 ACTTTGATGTTCATGGTTCTTGG + Intergenic
1094104190 12:26792366-26792388 AACAGGATTTTAATGGTAATTGG + Intronic
1094281717 12:28747533-28747555 ACAATGTTGTTCATGGAACTGGG - Intergenic
1106043666 13:26117658-26117680 ACCAGGCTGTTCATGGACGTGGG + Intergenic
1107003464 13:35579102-35579124 GTAATGATGTTCATGGTACTAGG - Intronic
1110046973 13:70842984-70843006 AACAGGAAGTTCAGGGCACTGGG + Intergenic
1117449459 14:55836934-55836956 ACCAGGAAGGTGATGGTACCAGG + Intergenic
1119891714 14:78187709-78187731 ACCAGGATTTTCTTGGAAGTAGG + Intergenic
1121361708 14:93267476-93267498 AGCTGGATATTCATGGTACTCGG - Intronic
1124571760 15:30870824-30870846 ACCTGGCTATTCATTGTACTTGG + Intergenic
1134609846 16:15599189-15599211 ACCAGGATCTTCCTGTTAGTGGG - Intronic
1135665128 16:24329113-24329135 ACCAGGATGTCCATGCAAGTTGG + Intronic
1136111916 16:28068840-28068862 ACCAGGCTGTTCGTGGTTCAGGG + Intergenic
1139183087 16:64770588-64770610 CCCAGGCTGTTCATGCTGCTAGG - Intergenic
1143329503 17:6122715-6122737 ACCAGGCTTTTCCTGGTAGTTGG + Exonic
1147943714 17:44068120-44068142 ACCAGGAAGTTTATGTTTCTTGG - Intergenic
1151223424 17:72630943-72630965 GCCAGGATGAGCATGGTATTGGG + Intergenic
1152653873 17:81510925-81510947 ACCTTGATCTTCATGGTGCTGGG + Exonic
1153991781 18:10406666-10406688 GCCAGGATGTTCATGAGCCTGGG + Intergenic
1154381790 18:13858401-13858423 TCCAGGATTTTTATGGTCCTGGG + Intergenic
1156847090 18:41678688-41678710 TCCAGGATTTTCATGTTACAAGG - Intergenic
1159234893 18:65658801-65658823 ACCAGGCTGTTCAGAGGACTTGG + Intergenic
1159384307 18:67703595-67703617 ACCAGGATGTTCTTATTTCTTGG - Intergenic
1160468841 18:79108011-79108033 ACTAGGATTTTCCTGGCACTAGG + Intronic
1166817183 19:45553394-45553416 ACCAGGATCTTGATGCAACTTGG - Intronic
925059604 2:880769-880791 GCCAGGATGTTCATGCACCTCGG + Intergenic
926117701 2:10223814-10223836 ACCAGGATGTCCATGGGGGTCGG - Intergenic
931335954 2:61343819-61343841 ACTAAGATGTTCATGGTAAATGG + Exonic
931939408 2:67235294-67235316 ACCTGCATGCTCATGGTACGGGG + Intergenic
932691395 2:73916745-73916767 ACCTTGATCTTCATGGTGCTGGG - Exonic
932753170 2:74385422-74385444 ACCAGCAAGTTCCTGGCACTAGG + Intronic
933115894 2:78470725-78470747 ATAAGGATATTCATGCTACTTGG - Intergenic
935454574 2:103252393-103252415 ACAAGCATGTTCATGGGACTTGG - Intergenic
935917981 2:107978495-107978517 TCCAGGATTTTTATGGTGCTAGG - Intergenic
937582196 2:123500422-123500444 ACCAGGTTGTTCATTTTGCTTGG + Intergenic
941103561 2:161325633-161325655 ACCAGAATGTTCATGGAAATAGG + Intronic
946564276 2:220946054-220946076 TCCATGATGTTCTAGGTACTGGG + Intergenic
948376963 2:237527251-237527273 ATAAGGATGTTCATGTTACAGGG - Intronic
1171945000 20:31368642-31368664 AGCAGGAGTTTCATGGTCCTTGG - Exonic
1175468771 20:59210747-59210769 AACAGGATGTTTATGGAAGTGGG - Intronic
1177999908 21:28149473-28149495 AGCATGATGTTCAGGGTATTGGG - Intergenic
1179898389 21:44376235-44376257 ACCAGGATGTTCATGGTACTCGG + Intronic
1180718936 22:17892482-17892504 AACAGGATTTTCATGATACTTGG - Intronic
1183501260 22:38181093-38181115 ACCAGGGTGATCATGGGACTGGG - Intronic
949846978 3:8381567-8381589 ACCAGAATTTTCATAGGACTAGG + Intergenic
950619220 3:14189909-14189931 TCTAGGATGTTTATGGTCCTAGG + Intronic
956650679 3:71501836-71501858 ACCAGGGTTTTCAGGGCACTGGG - Intronic
957584618 3:82117815-82117837 TCTAGGATTTTTATGGTACTAGG - Intergenic
959333834 3:105039493-105039515 GCCAGGATGTACTTGGTACCTGG + Intergenic
962096220 3:132295656-132295678 ACCAGGAAGGACATGGCACTTGG + Intergenic
967007970 3:185402418-185402440 ACAAAGATGTACATGGTAATAGG - Intronic
967248760 3:187515467-187515489 ACCAGGATGTTAATGACACCAGG - Intergenic
968088313 3:195884717-195884739 ACCAGGGTGTGGATGGGACTGGG - Intronic
968782530 4:2593926-2593948 ACATGGATTCTCATGGTACTCGG + Intronic
969709904 4:8836818-8836840 TCCAGGATGTGCCTGGTTCTGGG + Intergenic
972757633 4:42065034-42065056 ATCAGGATTTTCTTGGTATTAGG + Intronic
974351949 4:60759790-60759812 ACCAGGATGTTGTTGCTTCTAGG - Intergenic
976086326 4:81410586-81410608 ACCAGTCTGTTCATGGTTATGGG - Intergenic
979449576 4:120854427-120854449 ACCTGTATGTTCGTGTTACTTGG - Intronic
980636538 4:135511797-135511819 ACCATTATGTTGATGGTTCTAGG + Intergenic
982625025 4:157755931-157755953 TCCAGGATTTTTATGGTCCTAGG + Intergenic
985754225 5:1703642-1703664 TCCAGGAGGATCATGGTGCTGGG - Intergenic
986444807 5:7811946-7811968 ACCAGCATGTACCTGGAACTTGG - Intronic
987976402 5:25020410-25020432 ATCAGAATGGTCAAGGTACTGGG - Intergenic
990470572 5:56111554-56111576 ACCAGGCTGTTCTTGGCAGTTGG + Exonic
992917786 5:81477195-81477217 CTCAGGATGTTCTTGTTACTTGG + Intronic
996177374 5:120376212-120376234 ACCAGATTGTTTATAGTACTTGG - Intergenic
1000463622 5:161549240-161549262 AGCAGTATGTTCATGGTGCTGGG - Intronic
1003339521 6:5206162-5206184 ACCAGGGTGTTTCTGGGACTTGG + Intronic
1007634036 6:43287410-43287432 ACCAGGGTGTTGTTGGTCCTGGG - Exonic
1016799844 6:148157464-148157486 ACCAGGATGGTGAAGGAACTAGG + Intergenic
1020725147 7:11803159-11803181 AGCAGCATGTTCATGGGCCTTGG + Intronic
1026475785 7:70734138-70734160 ACCAGGGTTTTCATGGTATCTGG - Intronic
1028463071 7:91117944-91117966 ACCATGATGTTCAGTGTGCTGGG + Intronic
1033022056 7:137735463-137735485 ACCAGTATCTTCAGGGTCCTGGG - Intronic
1038769885 8:30467586-30467608 ACCAGGATGTTTCTGCTCCTGGG + Intronic
1040355404 8:46612908-46612930 TCCAGGATTTTTATGGTCCTAGG - Intergenic
1041520417 8:58749899-58749921 ACCAGGCTGCTGTTGGTACTTGG + Intergenic
1042179434 8:66071081-66071103 TCTAGGATTTTTATGGTACTAGG - Intronic
1044475115 8:92616922-92616944 ACAAAGATGTTGATGGTAATTGG - Intergenic
1045482545 8:102603666-102603688 ACAAGACTGTTCATGGTCCTGGG - Intergenic
1047132194 8:122034032-122034054 AACAGGAAGTTAATGGTGCTGGG + Intergenic
1047306405 8:123656418-123656440 ACCAGGAGGATCCTGGTTCTAGG + Intergenic
1050490522 9:6183742-6183764 ACCAGAGTGTGCCTGGTACTAGG - Intergenic
1060435294 9:123587615-123587637 ACCAAGATGTTCATAGCTCTGGG - Intronic
1061228575 9:129297212-129297234 TCTAGGATTTTCATGGTCCTAGG + Intergenic
1062411429 9:136427140-136427162 ACCAAGATGTTTATGGTAATGGG - Intergenic
1187393457 X:18901081-18901103 ACCAGAATGCCCATGATACTTGG - Intronic
1187406669 X:19010498-19010520 ACCATGATGTACCTGGTACTTGG + Intronic
1195332587 X:103816460-103816482 TCTAGGATGTTTATGGTCCTAGG - Intergenic
1197756691 X:130000400-130000422 ACCAGGATGTTCAGGGAACGGGG + Intronic
1200329754 X:155283236-155283258 ACAAGGATGTTCATTGTGGTTGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic