ID: 1179900219

View in Genome Browser
Species Human (GRCh38)
Location 21:44388468-44388490
Sequence ATGGAGAAGGACAGTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 12, 3: 109, 4: 783}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179900217_1179900219 -6 Left 1179900217 21:44388451-44388473 CCAAGATAAAAAGATATATGGAG 0: 1
1: 0
2: 1
3: 20
4: 339
Right 1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG 0: 1
1: 0
2: 12
3: 109
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179900219 Original CRISPR ATGGAGAAGGACAGTGATGA TGG Intronic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
900415667 1:2533394-2533416 CTGGAGATGGACAGTGGTGATGG - Intergenic
900415826 1:2534212-2534234 CTGGAGGTGGACAGTGGTGATGG + Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
900922828 1:5684522-5684544 TTTGAGAAGCACAGTGTTGAGGG + Intergenic
902180160 1:14682049-14682071 CTGGAGATGGATAGTGATGATGG - Intronic
902322324 1:15676735-15676757 ATGTAGAAGGGAAGTGATGTGGG - Intergenic
902548577 1:17205891-17205913 ATGGTGATGAACAGTGATGATGG + Intronic
902783882 1:18720862-18720884 ATCAAGAAGGCCAGGGATGATGG + Intronic
902803210 1:18844144-18844166 ATTCTGAAGGACAGTAATGATGG + Intronic
902944897 1:19828150-19828172 ATGGAGATGGATGGTGGTGAGGG - Intergenic
903308990 1:22437790-22437812 ATGGAGATGGATGGTGGTGATGG - Intergenic
903335950 1:22624704-22624726 CTGGAGATGGACGGTGGTGATGG + Intergenic
903520526 1:23944255-23944277 CTGGAGATGGATGGTGATGATGG - Intergenic
903825975 1:26146040-26146062 ATGGAGGAGGAGGGAGATGAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904471223 1:30737607-30737629 GAAGATAAGGACAGTGATGAAGG + Exonic
904478703 1:30780920-30780942 CTGGAGATGGACGGTGGTGATGG + Intergenic
904564156 1:31417618-31417640 CTGGAGAAGGATGGTGGTGATGG - Intronic
905160733 1:36031608-36031630 CTGGAAATGGATAGTGATGATGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
905690082 1:39936609-39936631 ATGAGGTAGGACAGTGATGGGGG + Intergenic
905845559 1:41228325-41228347 CTGGAGATGGATGGTGATGAGGG + Intronic
906771329 1:48487505-48487527 TGGGAGAAGGACAGTGAAGGGGG - Intergenic
907084253 1:51654980-51655002 CTGGAGATGGATGGTGATGATGG + Intronic
907233606 1:53024368-53024390 ATGGAGATGAAAGGTGATGATGG + Intronic
908222986 1:62027049-62027071 CTGGAGATGGATGGTGATGATGG - Intronic
908384288 1:63626292-63626314 CTGGAGATGGATAGTGGTGATGG - Intronic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
911039176 1:93578707-93578729 CTGGGGAGGGACAGTGATGCAGG - Intronic
911121783 1:94303475-94303497 CTGGAGATGGACGGTGGTGATGG + Intergenic
911266633 1:95752425-95752447 ATGGAAATGGATGGTGATGATGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911606015 1:99906075-99906097 CTGGAGATGGACAGTGATGATGG - Intronic
912479516 1:109970197-109970219 ATGGAGATGGATGGTGGTGATGG + Intergenic
912587886 1:110783438-110783460 CAGGAAAAGGGCAGTGATGAAGG - Intergenic
912651251 1:111441609-111441631 ATAGAACAAGACAGTGATGAGGG + Intronic
912653402 1:111462342-111462364 ATGGAGCTGGATAGTGGTGATGG + Exonic
913581809 1:120233859-120233881 ATGGAGAAGGAAAGAGATCAGGG + Intergenic
913626367 1:120664529-120664551 ATGGAGAAGGAAAGAGATCAGGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914563740 1:148845306-148845328 ATGGAGAAGGAAAGAGATCAGGG + Intronic
914609087 1:149284920-149284942 ATGGAGAAGGAAAGAGATCAGGG - Intergenic
915230158 1:154439669-154439691 CTGGAGAAGTAAAGTGGTGATGG - Intronic
915603344 1:156936152-156936174 GAGGAGAAGGAAGGTGATGAAGG - Intronic
915889496 1:159759254-159759276 ATCGTGAAGAACATTGATGATGG + Intergenic
915922394 1:159986337-159986359 CTGGAGATGGACAGTGGTGATGG + Intergenic
916275239 1:162987019-162987041 ATGGAGAAAGACAGAGGAGATGG - Intergenic
916347322 1:163808226-163808248 CTGGGGAAGGACAGTGTTTAAGG + Intergenic
916914351 1:169390008-169390030 CTGGAGATAAACAGTGATGATGG + Intronic
917002759 1:170377996-170378018 TTGGAGATGGATAGTGATGATGG - Intergenic
917087905 1:171322134-171322156 ATGGAGAGAGACAGGGCTGAAGG + Intronic
917811791 1:178665766-178665788 CTGGAGATGGATAGTGATGATGG + Intergenic
917829167 1:178860521-178860543 CTGGAGAAGGATGGTGGTGATGG - Intronic
918292793 1:183125036-183125058 ATAAAGAAGGACAGTCATGGTGG + Intronic
918374487 1:183895439-183895461 AGGGAGAAGGAGATTGATGGAGG + Intronic
918822498 1:189272891-189272913 ATAGAGTAGGACAATGATAATGG + Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919198528 1:194320671-194320693 ATGGAGTAAGACAGAGAAGAAGG - Intergenic
919287418 1:195581755-195581777 CTGGAGATGGACAATGTTGATGG - Intergenic
919707424 1:200690650-200690672 AAGCAAAAGGACAGTGATGGGGG + Intergenic
919797067 1:201327256-201327278 AGGGAGAAAGACAGGGATGGAGG + Intronic
920259008 1:204676264-204676286 TTGGAAGAGGACAGTGTTGAAGG - Intronic
920282732 1:204856322-204856344 AGGGAGAAGGCCAGTTCTGATGG + Intronic
920757525 1:208748549-208748571 AGGGAGAAGGAAGGTGAAGAGGG - Intergenic
920869918 1:209785397-209785419 TTGGAGCAGGACAGAGATTAAGG + Intergenic
921042400 1:211446352-211446374 TTGGAAATGGACAGTGGTGATGG + Intergenic
921412444 1:214850186-214850208 ATGAAGAAAGAAGGTGATGAAGG + Intergenic
921412475 1:214850513-214850535 ATGGAGGAGGGCAGAGAAGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921650030 1:217666646-217666668 CTGGAGATGAACAGTGGTGATGG - Intronic
922332973 1:224594061-224594083 CTGGAGATGGATAGTGGTGATGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923069001 1:230545767-230545789 ATGGATAAGTACAGCCATGATGG + Intergenic
923086189 1:230705159-230705181 ATGGAGATGGACGGGGGTGATGG + Intronic
923408114 1:233683211-233683233 TTGGTGAAGGAGAGAGATGAAGG + Intergenic
923409932 1:233697343-233697365 CTGGAGATGGATAGAGATGATGG + Intergenic
923668934 1:236023518-236023540 CTGGAGATGAACAGTGGTGATGG + Intronic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924210373 1:241759803-241759825 CTGGAGATGGATGGTGATGAAGG - Intronic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063342195 10:5276816-5276838 ATGGTGAAGGAGAGAAATGAAGG + Intergenic
1063532213 10:6844500-6844522 AAGCAGAAGGCCAGTGAAGAAGG + Intergenic
1063640488 10:7825415-7825437 CTGGAGAAGGATGGGGATGATGG - Intronic
1063649393 10:7918210-7918232 AAGGAGAAGGGGCGTGATGAAGG + Intronic
1064467756 10:15601482-15601504 CTGGAGATGGACAGTGCTGATGG + Intronic
1064479932 10:15729458-15729480 ATGGAGATGGGCAGATATGATGG + Intergenic
1065054034 10:21825148-21825170 CTAGAGATGGACAGTGGTGATGG - Intronic
1065905438 10:30246951-30246973 CTGGAGATGGATAGTGGTGATGG + Intergenic
1066125360 10:32336387-32336409 AAGGAGGAAGACAGGGATGAAGG - Intronic
1066160922 10:32727258-32727280 AAGGAGAAGGATAGTCCTGAAGG + Intronic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1067182325 10:43997708-43997730 AGGGAGGAGGACAGTGTTGCTGG - Intergenic
1067535415 10:47106219-47106241 CTGGAGATGGACAGTAGTGAAGG - Intergenic
1067546763 10:47197429-47197451 ATGGAGATGGATGGTGGTGATGG - Intergenic
1067684990 10:48461044-48461066 CTGGAGATGGATAGTGCTGATGG + Intronic
1067717542 10:48701006-48701028 ATGGAGCTGGATAGTGCTGATGG - Intronic
1068046635 10:51894455-51894477 CTGGAGACAGACAGTGGTGATGG + Intronic
1068223444 10:54074268-54074290 TTAGAGATGGATAGTGATGATGG - Intronic
1068574705 10:58672167-58672189 CTGGAGATGGATGGTGATGATGG - Intronic
1068684001 10:59850248-59850270 CTGGAGATGGACAGTGCTGACGG + Intronic
1068888735 10:62126250-62126272 CTGGAGATGGACAGTGGTGATGG + Intergenic
1068958138 10:62839653-62839675 CTGGAGATGGATGGTGATGATGG - Intronic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069963834 10:72096964-72096986 ATGGAGATGGACGGCGGTGACGG + Exonic
1069965572 10:72112474-72112496 CTGGAGATGGATAGTGATGATGG + Intronic
1070058422 10:72957254-72957276 CTGGAGATGGATAGTGGTGATGG - Intergenic
1071517006 10:86304666-86304688 TTGGAGATCGACAGAGATGATGG - Intronic
1072712898 10:97729201-97729223 ATGGAGATGGATGGTGGTGATGG - Intergenic
1072724581 10:97804325-97804347 CTGGAAATGGACAGTGGTGATGG - Intergenic
1072814608 10:98492905-98492927 ATAGAGATGGACAGTGGTGATGG - Intronic
1072907676 10:99469736-99469758 ATGGAAATGGACAGTGATTCTGG - Intergenic
1073043622 10:100623537-100623559 ATGGAGAAAGACAGGCAGGAAGG + Intergenic
1073607944 10:104914924-104914946 CTAGCCAAGGACAGTGATGACGG + Intronic
1074134919 10:110617980-110618002 CTGAAGAAGGACAGGAATGAGGG - Intergenic
1074321366 10:112406332-112406354 ATGAAGAAGAACGGTCATGAGGG - Intronic
1075613265 10:123870731-123870753 CTGGAGGAGCTCAGTGATGAGGG - Intronic
1075706037 10:124501632-124501654 CTGGAACTGGACAGTGATGATGG + Intronic
1075918351 10:126189177-126189199 ATAGAGAAGGATCATGATGAAGG + Intronic
1075952272 10:126490536-126490558 CTGGAGATGGATGGTGATGATGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076057237 10:127385825-127385847 GAGGAGAAGGCCTGTGATGACGG - Intronic
1076190789 10:128482064-128482086 ATGGAGAGAGACACAGATGAAGG + Intergenic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1076424376 10:130357090-130357112 ACTGGGAAGGATAGTGATGATGG - Intergenic
1077826577 11:5816236-5816258 CTGGAGATGGAGAGTGGTGATGG + Intronic
1078034901 11:7793645-7793667 TTGGAGCAGGAGAGTCATGATGG + Intergenic
1078657701 11:13257432-13257454 ATGGAGATGGATGGTGGTGATGG + Intergenic
1079088847 11:17466573-17466595 CTGGAGATGGATAGTGGTGATGG + Intronic
1079250599 11:18784556-18784578 CTGGAGATGGACAGTGGTGATGG + Intronic
1079311548 11:19370957-19370979 ATGTAGAAGGTCAGAGATGGAGG + Intronic
1079536790 11:21524872-21524894 ATGAGGAATGACAGTGAGGAAGG + Intronic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1080261838 11:30358005-30358027 ATGGACAAGGACATTCCTGAAGG - Intergenic
1080288883 11:30648328-30648350 CTGGAGATGGATAGTGGTGATGG - Intergenic
1080809288 11:35686874-35686896 CTAGAGATGGACAGTGATGATGG - Intronic
1082626125 11:55488377-55488399 TTGGAGATGAGCAGTGATGATGG - Intergenic
1082891998 11:58149544-58149566 CTGGAGAAGGATAGTGGTGATGG - Intronic
1083170017 11:60918240-60918262 ATGGACGAGGACAGTGAGCAAGG - Intronic
1084415863 11:69032699-69032721 ATGGTTAAGGACAGAGGTGAGGG - Intergenic
1084896697 11:72276600-72276622 ATGAAGATGGACGGTGGTGATGG - Intergenic
1085164694 11:74387572-74387594 ATGGAAAATGACACTGATCAGGG - Intronic
1085440512 11:76558417-76558439 CTGGAGATGGACACTGGTGATGG - Intergenic
1085723877 11:78937141-78937163 ATGGGGAAGGGCAGTGATCCTGG + Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088109967 11:106249883-106249905 ATGGAGATGGAAATTTATGAGGG + Intergenic
1088971865 11:114780913-114780935 TTGGGGGAGGAGAGTGATGAGGG + Intergenic
1088998521 11:115027462-115027484 ATGGAGATGGATGGTGGTGATGG + Intergenic
1089119316 11:116122432-116122454 ACGGAGATGGATGGTGATGATGG + Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089626937 11:119757110-119757132 ATGGAGCTGGAGAGTAATGATGG + Intergenic
1091093910 11:132799438-132799460 ATGGAGAAGGAAGGAGATGAGGG + Intronic
1091787199 12:3250350-3250372 ATCATGAAGGACAGTGAAGAGGG - Intronic
1092535057 12:9379395-9379417 ATGGAGAAGGGCAGGCCTGAGGG + Intergenic
1093729678 12:22553133-22553155 AAGGAGAAAGACAGCGATAAGGG - Intergenic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094499316 12:31008383-31008405 ATGAGGAAGGACAGGGAAGAGGG - Intergenic
1094715999 12:33015968-33015990 CTGGAGAGTGACTGTGATGAAGG + Intergenic
1095328910 12:40933101-40933123 AGGGAGAAGGAAAGAGAAGAAGG - Intronic
1095766165 12:45898343-45898365 GTGGAGATGGATAGTGGTGATGG + Intronic
1095935875 12:47680362-47680384 CTGGTGATGGACAGTGGTGATGG + Intronic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096582330 12:52593944-52593966 CTGGAGGTGGACAGTGGTGATGG + Intronic
1096602563 12:52740374-52740396 CTGGAGAAGGACCCTGATAAAGG + Intergenic
1097146293 12:56941624-56941646 TTGCAGAAAGACAGTGATCAGGG - Intergenic
1097206190 12:57323267-57323289 TTGGAGAAGGACAGGAAGGAAGG + Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097633020 12:62087207-62087229 ATGGAGATGGATAGTCATGATGG + Intronic
1098590093 12:72200961-72200983 CTGGAGTAGGACAGTGATACAGG + Intronic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1099974555 12:89532913-89532935 CTGGAGATGGACTGTGGTGATGG + Intergenic
1100813028 12:98359097-98359119 CTGGAAATGGACAGTGGTGATGG - Intergenic
1101321925 12:103680193-103680215 TTGGAGAAGGATGGTAATGATGG + Intronic
1101418664 12:104531067-104531089 AAGGAGAAGGGAAGAGATGAAGG - Intronic
1101426664 12:104593791-104593813 ATAGAGAGAGACAGTAATGAAGG + Intronic
1101581579 12:106046787-106046809 GTGGAGAAGGACAGTAAAGGGGG + Intergenic
1101667223 12:106829706-106829728 ACGGAGAAGGATGGTGGTGATGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102246015 12:111356317-111356339 CTGGAGATGGAGGGTGATGATGG - Intergenic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102432255 12:112892754-112892776 ATGAGTAAGGACAGTGATGGTGG - Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1103625949 12:122219908-122219930 ATGAAGCAGTACAGTGTTGATGG + Intronic
1104406639 12:128523325-128523347 CTGGAGATGGATGGTGATGATGG + Intronic
1105284704 13:18994574-18994596 ATGCAGAAGGCCAGGGAAGAAGG + Intergenic
1105405940 13:20132831-20132853 CTGGAGATGGATGGTGATGATGG - Intergenic
1105431070 13:20338581-20338603 CTGGAGATGGATGGTGATGATGG + Intergenic
1106312824 13:28568648-28568670 ATGGAGCAGCACAGTGGTGCTGG - Intergenic
1106812545 13:33374341-33374363 CTGGAGATGGATAGTGGTGATGG + Intergenic
1106957490 13:34956789-34956811 CTGGACAAGGATGGTGATGATGG - Intronic
1107423417 13:40270738-40270760 ATGGAGGAGCACAGAGCTGAGGG - Intergenic
1108544783 13:51481962-51481984 GTGGAGAATGGGAGTGATGAAGG - Intergenic
1108560913 13:51643166-51643188 CTGGAAATGGACAGTGGTGATGG - Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1109455871 13:62588031-62588053 CTGGAGATGGACGGTGGTGATGG + Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1109953256 13:69530491-69530513 AAGGAGAGGGAGAGAGATGAGGG - Intergenic
1109984760 13:69965465-69965487 ATGGAGAAGGGGAGAAATGAGGG - Intronic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1112128079 13:96492014-96492036 ATTGAGAAGGATAGTCATTAAGG - Intronic
1112179231 13:97061226-97061248 ATGGAAAATGACAGGGGTGAAGG + Intergenic
1112203653 13:97302827-97302849 AGTGAAAAGGACAGTGAAGAAGG + Intronic
1112264187 13:97907677-97907699 CTGGAGATGGATGGTGATGATGG + Intergenic
1112588986 13:100746627-100746649 CTGGAGATGGATAGTGGTGATGG + Intergenic
1112741131 13:102473699-102473721 TTGGAGATGGATAGTGGTGAGGG + Intergenic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1112999924 13:105623140-105623162 ATAGATAAGGACAATGATTATGG + Intergenic
1113074391 13:106453465-106453487 AGGGAGAAGGAAACTGCTGAGGG + Intergenic
1113509624 13:110842905-110842927 CTGGAGAAGGATGGTGGTGAAGG - Intergenic
1113512820 13:110869585-110869607 ATGGAGACGGACCGAGTTGAAGG - Intergenic
1113529944 13:111016449-111016471 CTGGAGATGGACAGTGGTGATGG + Intergenic
1113561782 13:111287182-111287204 AAGGAGAAGGACAGTCAGGATGG - Intronic
1115074866 14:29376217-29376239 ATGGAGCAGGATAGTAATGATGG - Intergenic
1115181551 14:30632078-30632100 TTGGAGAAGGACTGTGTTCATGG + Intronic
1115192628 14:30761897-30761919 ATAGAGAAGTACTGGGATGATGG + Intergenic
1115197884 14:30821507-30821529 ATCGTGAAGAACATTGATGATGG + Intergenic
1116473201 14:45309282-45309304 ATGGAAAAGGACATGGATGCAGG - Intergenic
1116602283 14:46941018-46941040 CTGGAGAGGCACAGTGATGCAGG - Intronic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117554583 14:56871105-56871127 ATGGAGATGGATGGTGGTGATGG + Intergenic
1117565073 14:56985731-56985753 ATAGGGAAGGGCAGTGCTGATGG + Intergenic
1118355418 14:65009600-65009622 ATGGAGGAGGGCTGGGATGAGGG - Intronic
1118546257 14:66892799-66892821 CTGGAGATGGACAGTGGTGATGG + Intronic
1118981927 14:70724189-70724211 CTGGAGAAGGGAAGTGATTATGG - Intronic
1119801580 14:77450035-77450057 CTGGAGATGGATAGTGGTGATGG - Intronic
1120737677 14:88072027-88072049 ATGGAGATTAAAAGTGATGAGGG + Intergenic
1121081331 14:91110853-91110875 CTGGAGATGGTTAGTGATGATGG - Intronic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1121217727 14:92261600-92261622 CTGGAGAAGGACAGTGATCAGGG - Intergenic
1121298229 14:92847609-92847631 AAGCACAAGGACTGTGATGAGGG - Intergenic
1121308303 14:92921253-92921275 CTGGAAATGGATAGTGATGATGG - Intergenic
1121569021 14:94932601-94932623 CTGGAGAAGGATTGTGGTGATGG - Intergenic
1121697842 14:95927940-95927962 AGGGAGAAGGAGAGGGATGGAGG - Intergenic
1121739420 14:96240920-96240942 ATGAAGGAGTACAGCGATGAGGG + Exonic
1121973216 14:98378464-98378486 ATGTAGATGGACAGTGCTCAAGG + Intergenic
1122073484 14:99220640-99220662 CTGGAGATGGACGGTGGTGATGG + Intronic
1122219256 14:100225613-100225635 CTGGAGATGGATGGTGATGATGG + Intergenic
1122233885 14:100321320-100321342 GTGCAGATGGACAGTGGTGAAGG + Intergenic
1122793274 14:104193387-104193409 AGGGAGGAGGACAGGGCTGAGGG - Intergenic
1122916092 14:104859647-104859669 ATGGAGATGGAAGGTGGTGATGG - Intergenic
1122916212 14:104860187-104860209 ATGGAGATGGAGGGTGGTGATGG - Intergenic
1124345142 15:28917269-28917291 AGAGAGAGGGACTGTGATGAGGG + Intronic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125597335 15:40895224-40895246 ATGGACAAAGAAAGTGGTGAAGG + Intronic
1125865373 15:43042619-43042641 TTGGAGAAGGATGGTGGTGATGG + Intronic
1126486649 15:49188431-49188453 ATGGAGGAGTACAGTGATTATGG - Intronic
1126847433 15:52773956-52773978 TTGGGAAAGGACAGGGATGATGG + Intronic
1127185865 15:56480090-56480112 CTGGAGATGGACAATGGTGATGG + Intergenic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1127556019 15:60088516-60088538 AGGGAGAACGAGAGAGATGAAGG + Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128349766 15:66881065-66881087 GTGGGGAATGACAGTGATGCTGG + Intergenic
1128499521 15:68218146-68218168 ATGGGGAAGGACAGGGGAGACGG + Intronic
1128636662 15:69306765-69306787 ATGGAGATGGATGGTGGTGATGG - Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129167288 15:73785956-73785978 CTGGAGCAGGACAGTGGAGAGGG + Intergenic
1129319422 15:74766033-74766055 CTGGAGATGGACAGTGGTGATGG + Intergenic
1129708915 15:77810381-77810403 AGGGAGAGGGACAGCGAGGAGGG + Intronic
1129790151 15:78335711-78335733 ATGGAGCAGGTGAGTGCTGAAGG - Intergenic
1130443924 15:83981164-83981186 TGGGAGAAGGACAGTGATATGGG - Intronic
1131238311 15:90716571-90716593 CTGGAGATGGATAGTGGTGATGG + Intergenic
1131521220 15:93117453-93117475 CTGGAGATGGACAGTGGTGATGG + Intergenic
1132060171 15:98685966-98685988 CTGGAGATGGACAGTGGTGATGG - Intronic
1132082894 15:98882664-98882686 GTGAATAGGGACAGTGATGAGGG + Intronic
1132126934 15:99235732-99235754 CTGGAGATGGACAGTGGTAATGG - Intronic
1132393391 15:101455036-101455058 CTGGAGATGGACAGTGGTGATGG + Intronic
1132952269 16:2569934-2569956 ATGGAGCAGGGCAGTGGTGTGGG + Intronic
1132962082 16:2630236-2630258 ATGGAGCAGGGCAGTGGTGTGGG - Intergenic
1133012527 16:2922400-2922422 CTGGAGATGGACGGTGGTGACGG - Intronic
1133401194 16:5488490-5488512 ATGGAGGATTATAGTGATGATGG + Intergenic
1133401213 16:5488623-5488645 ATGGAGGATTATAGTGATGATGG + Intergenic
1133401229 16:5488739-5488761 ATGGAGGATTATAGTGATGATGG + Intergenic
1133476321 16:6125283-6125305 ATGGAGGAGGATAGAGATGGAGG + Intronic
1133720583 16:8490782-8490804 ATGGAGAACGATGGAGATGAAGG + Intergenic
1134209347 16:12262842-12262864 CTGGAGTTGGACAGTGGTGATGG - Intronic
1134268357 16:12711395-12711417 ATGGAGACAGATGGTGATGATGG + Intronic
1134405575 16:13955869-13955891 ACGGAGAAGTACAGTTTTGATGG + Intergenic
1134607792 16:15584743-15584765 ATGGAGAAGGCCTGTGTTGTAGG - Intronic
1134867119 16:17618332-17618354 GGGGAGGAGGACAGTGAGGATGG + Intergenic
1135535805 16:23293561-23293583 CTGGAGATGGATAGTGGTGATGG + Intronic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1137980983 16:53069353-53069375 CTGGAGATGGATAGTGGTGATGG - Intronic
1138332167 16:56223964-56223986 TTAGAGAAGGTCAGAGATGAAGG + Intronic
1138520841 16:57570086-57570108 AGGGGCAAGGACGGTGATGAAGG - Intronic
1139132890 16:64167778-64167800 CAGGAGGAGGACAATGATGAAGG - Intergenic
1139141744 16:64272422-64272444 ATGGAGATGGATGGTGCTGATGG + Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139370454 16:66465586-66465608 CTGGAGATGGATAGTGTTGATGG - Intronic
1139494922 16:67309410-67309432 GGGGAGAGGGACAGGGATGAAGG + Intronic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1141075361 16:81001529-81001551 ATGGAGATGGACGGTGGTGATGG + Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1142314347 16:89334250-89334272 ATTGTGAAGGCCATTGATGAGGG - Intronic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1142977433 17:3654087-3654109 AAGGAGGAGCCCAGTGATGATGG + Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143278916 17:5735605-5735627 CTGGAGATGGATGGTGATGATGG + Intergenic
1143607687 17:7999007-7999029 CTGGAGATGGACAGTGGTGATGG + Intergenic
1143619952 17:8075101-8075123 AGGGAAAAAGACAGTGGTGAAGG - Intronic
1143695185 17:8609345-8609367 ATCGAGAAGGAAAGGGAGGAAGG + Intronic
1143759658 17:9091801-9091823 CTGGAGACGGATGGTGATGATGG - Intronic
1145791447 17:27630153-27630175 ATGGGGATGGACAGTGCAGATGG + Exonic
1145893764 17:28438972-28438994 ATAGAGATGGATAGTGGTGATGG - Intergenic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1146417448 17:32649279-32649301 CTGGAGAAAGATAGTGGTGATGG - Intronic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146866631 17:36341559-36341581 CTGGAAATGGACAGTGGTGATGG - Intronic
1146951445 17:36909318-36909340 CTGGAGATGGACACTGGTGATGG + Intergenic
1147041341 17:37721650-37721672 ATGGAGCAGGAGAGTTCTGAAGG - Intronic
1147069499 17:37942168-37942190 CTGGAAATGGACAGTGGTGATGG - Intergenic
1147081029 17:38021706-38021728 CTGGAAATGGACAGTGGTGATGG - Intronic
1147096971 17:38145663-38145685 CTGGAAATGGACAGTGGTGATGG - Intergenic
1147165262 17:38589725-38589747 ATGGGGAAGGACAGGGCTGCTGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149316969 17:55447751-55447773 CTGGAAATGGATAGTGATGATGG - Intergenic
1149676719 17:58471128-58471150 CTGGAGATAGACAGTGGTGATGG + Intronic
1150101219 17:62425244-62425266 ATTGAGCAGGACAGTGACAATGG - Intronic
1150222193 17:63502081-63502103 CTGGAGATGGACAGTGGTGATGG - Intronic
1150458964 17:65331104-65331126 CTGGAGATGGACAGGGGTGATGG - Intergenic
1150617233 17:66781754-66781776 CTGGAGATGGCCAGTGGTGATGG + Intronic
1150641190 17:66950915-66950937 AAGGAGAAGGACAGTGTCGCTGG + Intergenic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1151084337 17:71363656-71363678 ATGAAGAAGGAAAGTAATGAAGG + Intergenic
1151410754 17:73926619-73926641 GAGGAGAAGGAGAGAGATGAGGG - Intergenic
1151644509 17:75420902-75420924 CTGGAGATGGACAATGGTGATGG + Intergenic
1151649946 17:75460897-75460919 CTGGAGATGGATAGTGATGAGGG - Intronic
1151827862 17:76533337-76533359 CTGGAGAAGCACTGTAATGAGGG + Intronic
1151863731 17:76785682-76785704 CTGGAGATGGGCAGTGGTGATGG + Intergenic
1152129916 17:78469978-78470000 CTGGAGAGGGACAGTGGTGATGG + Intronic
1152317536 17:79589692-79589714 CTGGAGAACGGCAGTGAAGAGGG + Intergenic
1152511267 17:80790614-80790636 ATGGAGAAGGACAGTGGCCCAGG - Intronic
1153078391 18:1192397-1192419 ATAGAGAAGGAAGGTGATGCTGG - Intergenic
1153287890 18:3473217-3473239 GAGGAGAGGGACAGAGATGAGGG - Intergenic
1153374693 18:4362642-4362664 CTGGAGATGGACGGTGGTGATGG + Intronic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1153709374 18:7782516-7782538 CTGGAGAAGGACAATGGTGATGG - Intronic
1153843136 18:9024688-9024710 CTGGAGATGGATAGTGGTGATGG + Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154261236 18:12834802-12834824 ATGGAGAAGAACAGTACAGAGGG + Intronic
1154436858 18:14350917-14350939 ATGGTGCAGTACAGTGATCATGG - Intergenic
1155234261 18:23803722-23803744 ATCCTGAAGGACAGTGGTGAAGG - Intronic
1156217319 18:35012808-35012830 CTGGAGAAGGATGGTGGTGATGG + Intronic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1157162564 18:45327441-45327463 CTGGAGATGGATAGTGGTGATGG - Intronic
1157447435 18:47755935-47755957 ATTGAGATGGAAAGTGTTGAAGG - Intergenic
1157506392 18:48229778-48229800 AGGGAGATGGACAGTCAGGAAGG - Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157870387 18:51225129-51225151 ATGGAGAGTTACAGTGTTGATGG - Intergenic
1158013623 18:52757906-52757928 ATTGAGAAGCAAAGTGATAAGGG - Intronic
1158112532 18:53956738-53956760 ATGGAGATCAACAGTGAAGAAGG + Intergenic
1158187208 18:54784249-54784271 AAGGTGAAGGCCAGTTATGATGG - Intronic
1159344273 18:67178938-67178960 CTGGAGATGGAAAGTGGTGATGG + Intergenic
1159617726 18:70600686-70600708 CTGGAGATGGATAGTGATAATGG - Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159977139 18:74727971-74727993 GGGGAGAAGGAGAGTGATGGAGG + Intronic
1160573187 18:79832292-79832314 CTGAGGAAGGACAGTGAGGATGG - Intergenic
1160598016 18:79990772-79990794 CTGGAGATGGATAGTGGTGATGG - Intronic
1161485000 19:4530608-4530630 ATGGATAGGGACAGAGAGGAGGG + Intronic
1161820785 19:6529583-6529605 ATGGAGAGAGACAGAGATAACGG + Intergenic
1161852511 19:6745022-6745044 GGGGAGAAGGACAGTGAAGTGGG + Intronic
1161889056 19:7020571-7020593 AATGAGAAGGACAGAAATGAAGG - Intergenic
1161892397 19:7050178-7050200 AATGAGAAGGACAGAAATGAAGG + Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163759561 19:19128185-19128207 GTGGAGATGGACGGTGGTGATGG + Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164996797 19:32726403-32726425 CTGGAGAGGGACATTGGTGATGG - Intronic
1165007223 19:32817210-32817232 CTGGAGATGGATAGCGATGATGG - Intronic
1165137965 19:33682485-33682507 CTGGAGATGGATAGTGGTGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166494891 19:43293364-43293386 ATGGAGAAAGCCAGTGGTGGAGG + Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1168442861 19:56386013-56386035 CCGGAGATGGACGGTGATGATGG + Intronic
1168518880 19:57032733-57032755 CTGGAAATGGACAGTGGTGATGG - Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925358003 2:3256189-3256211 ATGGAGGAGAGCAGTGCTGAGGG - Intronic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925613046 2:5719127-5719149 AAGAAGAAGGACAGTGAAGAAGG + Intergenic
926128258 2:10284988-10285010 TTGGGTCAGGACAGTGATGAAGG - Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926169709 2:10545058-10545080 CTGGAGATGGACGGTGGTGATGG - Intergenic
926219226 2:10924130-10924152 ATGTTGGAGGACAGTCATGAAGG - Intergenic
926386937 2:12344812-12344834 CTGGAGACAGACAGTGGTGATGG - Intergenic
926609004 2:14926692-14926714 CTGGAGATGGACAGTGGTGATGG - Intergenic
926678555 2:15647144-15647166 CTGGAGATGGACGGTGGTGATGG + Intergenic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927468968 2:23358050-23358072 GTGGAGGAGGACAGTGATGAAGG + Intergenic
927644113 2:24864767-24864789 CTGGAAACGGACAGTGGTGATGG + Intronic
927758896 2:25732559-25732581 CTGGAGACGGACAGTGGTGATGG - Intergenic
928150396 2:28823065-28823087 ATGTAAAAGGGCAATGATGATGG - Intronic
928383091 2:30838087-30838109 CTGGAGATGAACAGTGATGATGG + Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928454806 2:31410285-31410307 ATGGAGGTGGACGGTGATGATGG + Intronic
928928165 2:36598833-36598855 ATGGAGATGGATGGTGGTGATGG + Intronic
929005506 2:37389419-37389441 TTGGAGAAGGCCTGTGATAAAGG - Intergenic
929008086 2:37414895-37414917 TTGGTAGAGGACAGTGATGATGG + Intergenic
929841099 2:45464182-45464204 ATGGCTAAGGAAAGTGAAGAAGG - Intronic
929902449 2:46017137-46017159 ATGGAGATGGAGAGGGGTGATGG - Intronic
929906801 2:46053425-46053447 ATGGAGATGGATAGTGGTGACGG - Intronic
930684806 2:54296540-54296562 ATGGAAAAGGACAATGATCTTGG - Intronic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932622219 2:73271457-73271479 ATGGAGAAGGCCAGAGCTGCTGG + Intronic
933127912 2:78634246-78634268 AGAGAGAAGGACAGGGATGGAGG + Intergenic
933244225 2:79957281-79957303 AAAGAGAAGGACAGAGATAAGGG - Intronic
933672809 2:85025444-85025466 CTGGAGATGGACAGTGGTGATGG - Intronic
933737862 2:85509722-85509744 CTGGAGATGGATAGTGGTGATGG + Intergenic
933867795 2:86538332-86538354 CTGGAGATGGATAGTGGTGATGG + Intronic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934770021 2:96901710-96901732 ATGGAGATGGATGGTGGTGATGG + Intronic
934780851 2:96968715-96968737 CAAGAGCAGGACAGTGATGAGGG - Intronic
935044898 2:99472438-99472460 CTGGAGATGGATAGTGGTGATGG + Intronic
935394840 2:102596535-102596557 ATGGAGAAGGCCAGGCATGGTGG - Intergenic
935574213 2:104692207-104692229 ATGGAGATGAATAGTGGTGATGG - Intergenic
935625036 2:105165223-105165245 CTGGAGATGGACAGTGGTGATGG - Intergenic
935711929 2:105906885-105906907 CTGGAGATGGATGGTGATGATGG - Intergenic
935938661 2:108215299-108215321 CTGGAAATGGATAGTGATGATGG + Intergenic
936001005 2:108830319-108830341 TTGGGGATGGATAGTGATGATGG + Intronic
936235179 2:110736308-110736330 TTGGAGCTGGACAGTGGTGATGG - Intronic
936239617 2:110776329-110776351 CTGGAGATGGATGGTGATGATGG + Intronic
936990322 2:118357120-118357142 CTGGAGATGGATAGTGATGATGG - Intergenic
937180690 2:119993516-119993538 ATTGTGAAGAACATTGATGATGG - Intergenic
937624993 2:124034113-124034135 ATGAAAAAGGACAGTGAGAAGGG + Intronic
937824456 2:126351682-126351704 CTGGAGATGGATGGTGATGATGG + Intergenic
937888648 2:126917813-126917835 ATGGAAAAGGGCAGAAATGAGGG + Intergenic
938749975 2:134319063-134319085 CTAGAGAGGGACAGTGGTGATGG - Intronic
938905961 2:135836470-135836492 ATGGGGAAGGTGTGTGATGAAGG + Intronic
938965642 2:136386068-136386090 GGGGAGAAGGACAGGGAAGAAGG + Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939460224 2:142489593-142489615 AGAGAGAAGGCCAGTGTTGAGGG + Intergenic
939462691 2:142517147-142517169 ATGGAAAGGGATAGTGGTGAAGG - Intergenic
940283066 2:152007285-152007307 CTAGAGATGGATAGTGATGATGG - Intronic
940465207 2:154018789-154018811 AGGGAGAGGGACGGGGATGAAGG + Intronic
940487952 2:154320649-154320671 ATGGAGAAGGTCAGTCATGGAGG - Intronic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940716574 2:157232037-157232059 CTGGAGATGGATAGTGATGAAGG - Intergenic
940733005 2:157415978-157416000 ATGACGATGGACAGTGAAGATGG - Exonic
940854796 2:158721701-158721723 CTGGAGATGGATAGTGTTGATGG + Intergenic
940946144 2:159620730-159620752 ATGGGGAAGGACAGAGATAAAGG + Intergenic
941228812 2:162883163-162883185 AAGGAGAAGGAAAGTGATGGTGG + Intergenic
942271220 2:174277393-174277415 CTGGAGATGGACAGTGGTGATGG - Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942329190 2:174804196-174804218 CTGGAGAAAGACAGTGCTGGTGG + Intronic
942364168 2:175205377-175205399 ATGGAGATGGATGGTGGTGATGG - Intergenic
942617497 2:177809171-177809193 CTGGAGATGGATAGTGGTGATGG + Intronic
942762896 2:179420751-179420773 CTGGAGAGGGATGGTGATGATGG - Intergenic
943073173 2:183165604-183165626 ATGGCAATGGATAGTGATGATGG - Intergenic
943234313 2:185298726-185298748 AAGGAGAAGAACAGTGTTTAGGG - Intergenic
943476869 2:188367776-188367798 AGGTTGCAGGACAGTGATGATGG - Intronic
944117366 2:196203793-196203815 CTGGAGATGGATAGTGATGATGG - Intronic
944652180 2:201842069-201842091 CTGGAGATGGACAGTGGTGACGG - Intronic
946981704 2:225224262-225224284 ATGGAGAAACACAGAGCTGAAGG + Intergenic
947197170 2:227579963-227579985 ATTTACAAGGCCAGTGATGATGG - Intergenic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
947660810 2:231865857-231865879 ATGGAGAAGAACTGTGATGTTGG - Intergenic
948565678 2:238884669-238884691 ATGGAGAAGGGCTCAGATGAAGG + Intronic
948937282 2:241175261-241175283 CTGGAGATGGACGGTGGTGATGG - Intronic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1168906601 20:1408963-1408985 CTGGAGATGGATGGTGATGATGG - Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169056396 20:2624981-2625003 GTTGAGGGGGACAGTGATGAAGG - Intronic
1169098518 20:2925114-2925136 TTGGAGATGGACAGTGGTGATGG - Intronic
1169188512 20:3641174-3641196 CTGGAGATGGATAGTAATGATGG + Intronic
1169347196 20:4838191-4838213 ATGGAAAATGACAGAGAAGAAGG + Intergenic
1170242214 20:14180005-14180027 CTGGAGATGGAAAGTGGTGATGG - Intronic
1170310552 20:14986723-14986745 ATGGGGGAGGAGAGTGATCAGGG + Intronic
1170638490 20:18130325-18130347 ATGGAGATGAATAGTGATGCTGG + Intergenic
1170682808 20:18541586-18541608 AAGGAGGAGGAGAGAGATGAGGG + Intronic
1170712053 20:18800247-18800269 CTGGAGATGGACTGTGGTGATGG - Intergenic
1170888474 20:20359954-20359976 CTGGAGATGGACAGTGGTGAGGG + Intronic
1170960946 20:21025397-21025419 CTGGAGATGGATAGTGCTGATGG + Intergenic
1171935309 20:31269553-31269575 ATGGGGATTGACAGTGATGGTGG - Intergenic
1172044096 20:32067312-32067334 ATGGAGATGGATGGTGGTGAGGG - Intronic
1172140429 20:32719057-32719079 AAGGAAGAGGACACTGATGAGGG + Intronic
1172265967 20:33614491-33614513 TTGGAGATGGATGGTGATGATGG - Intronic
1172525067 20:35595798-35595820 AAGGAGAAGGACAGTGACCTTGG + Intergenic
1172548631 20:35781617-35781639 ACGGAGATGGAGAGTGGTGATGG - Intronic
1172646911 20:36476211-36476233 AAAGAGACGGATAGTGATGATGG - Intronic
1172730785 20:37085599-37085621 CTGGAGATGGACAGTGGTGATGG - Intronic
1172798040 20:37556806-37556828 GAGGAGAAGGACAGGGAAGATGG - Intergenic
1173079212 20:39849991-39850013 ATGCTGAATGACAGTGATGGTGG - Intergenic
1173147260 20:40535544-40535566 ATGCAGAGGCACAGTGCTGAAGG - Intergenic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1175087102 20:56468758-56468780 GTTGAGAAGGTCAGTGATGTGGG + Exonic
1175609110 20:60335370-60335392 TTGGTGAAGGACACTGATAATGG - Intergenic
1175740577 20:61417278-61417300 ATGGAGAAAGACAGAGAGGGAGG - Intronic
1175945856 20:62558437-62558459 ATGCTGAAGGACAGAGATGCTGG + Intronic
1176040467 20:63062853-63062875 CTGGAGATGGACAGTGGTGATGG - Intergenic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1177109339 21:17005787-17005809 ATGGAGAGGGAGAGAGATGGAGG - Intergenic
1177343747 21:19840575-19840597 ATGGAGATGGATGGTGGTGATGG + Intergenic
1179212005 21:39332711-39332733 CTGGAGATGGATAGTGGTGATGG + Intergenic
1179440799 21:41392574-41392596 CTGGAGATGGACGGTGGTGATGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179926188 21:44535134-44535156 CTGGAGATGGACGGTGGTGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180253968 21:46609809-46609831 ATCTTGAAGGACAGTGGTGAAGG + Intergenic
1181235252 22:21444647-21444669 ATGGAGGTGGAGGGTGATGAGGG - Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181483301 22:23214905-23214927 CTGGAGATGGATAGTGGTGATGG - Intronic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1181656683 22:24306732-24306754 CTGGAGATGGATGGTGATGATGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1182078128 22:27509002-27509024 ATGGGAATGGCCAGTGATGATGG + Intergenic
1182155921 22:28072876-28072898 CCAGAGAAGGACAGTGATGGAGG - Intronic
1182233704 22:28859164-28859186 CTGGAGATTGACAGTGATGATGG - Intergenic
1182252190 22:29009871-29009893 CTGGAGATGGTCAGTGATGATGG - Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182840394 22:33384665-33384687 ATGGAGATGGACAGTGGTGGTGG + Intronic
1182873889 22:33673615-33673637 CTGGAGATGGATAGTGATGATGG - Intronic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1183614244 22:38933523-38933545 ATGGAGATGGACGGTGGTGATGG + Intergenic
1183621952 22:38979034-38979056 ATGGAGAAGGATGGTGGTGGTGG + Intronic
1183699567 22:39443359-39443381 CTGGAGATGGACGGTGGTGATGG + Intergenic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184756796 22:46520814-46520836 CTGGAGATGGAGGGTGATGATGG - Intronic
949161442 3:887901-887923 TTGTAGAAGGACAGTGATGTTGG + Intergenic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950135117 3:10575491-10575513 GTGGAGATGGATAGTGGTGATGG + Intronic
950662363 3:14474449-14474471 CTGGAGACGGACGGTGGTGATGG - Intronic
950842492 3:15980733-15980755 CTGGAGATGAATAGTGATGATGG + Intergenic
950901701 3:16503770-16503792 ATGGAGGAGGACAGAAATGTAGG - Intronic
951830884 3:26925750-26925772 CTGGAGAAAGAAAGTGAAGATGG + Intergenic
952208972 3:31209969-31209991 ATGGAGATGGATGGTGGTGATGG + Intergenic
953501209 3:43436464-43436486 AAGGAGAAGAACAGTGAAGGTGG + Intronic
953764285 3:45723667-45723689 GTGGAAATGAACAGTGATGATGG - Intronic
953957005 3:47239441-47239463 CTGGAGAAGGCCAGTGATGGTGG - Intronic
953988961 3:47468981-47469003 CTGGAAATGGATAGTGATGATGG + Intronic
954418315 3:50405160-50405182 AAGGAGTGGGACAGTGAAGAGGG + Intronic
954776427 3:53022825-53022847 ATGGAGACGGACTGTGGTAATGG + Intronic
955339360 3:58113125-58113147 ATGGAGATGGATGGTGGTGATGG - Intronic
955389605 3:58511383-58511405 ATCATGAAGGACATTGATGATGG + Intronic
956175135 3:66465777-66465799 CTGGAGATGGACGGTGGTGATGG - Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956919141 3:73907790-73907812 TTGGATAAGGACAGAGTTGAAGG + Intergenic
956929042 3:74021682-74021704 GTGGACAAGGAGAGTGATGTTGG - Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957905316 3:86545936-86545958 ATTAAGCAGGACAGAGATGAAGG - Intergenic
959735959 3:109658880-109658902 CTGGAGATGGATAGTGGTGATGG + Intergenic
960751205 3:120956252-120956274 ACAGAAAAGGACGGTGATGATGG - Intronic
961020817 3:123505321-123505343 CTGGAGATGGATGGTGATGATGG + Intronic
961142724 3:124568896-124568918 CTGGAGATGGATGGTGATGATGG + Intronic
961528316 3:127523192-127523214 CTGGAGACGGATGGTGATGATGG + Intergenic
962492920 3:135911011-135911033 CTGGAGATGGATAGTGGTGATGG + Intergenic
962760042 3:138503108-138503130 ATGGAGATGGATGGTGATGTTGG - Intronic
963291124 3:143490577-143490599 ATGGAAGTGGACAGTGGTGATGG + Intronic
964146634 3:153471852-153471874 ATGGAGAGGGAAAGAGATGTGGG + Intergenic
965275746 3:166679634-166679656 ATGGAGAAGGACGGTGTGGTTGG - Intergenic
965639150 3:170814510-170814532 AAGGACAATGTCAGTGATGAAGG + Intronic
965675318 3:171189005-171189027 CTGGAGATGGACAGTGGTGAAGG - Intronic
967107630 3:186267163-186267185 AGGGAGATTGACAGAGATGAGGG + Intronic
967206300 3:187125570-187125592 ATGTGGAAAGACAGTGATTAGGG - Intronic
967754208 3:193150103-193150125 CTGGAGATGGATAGTGGTGATGG - Intergenic
967951083 3:194841240-194841262 ATGGAGAGAGACAGTGAGGGCGG - Intergenic
968169755 3:196500562-196500584 CTGGAGATGGACGGTGGTGACGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969377776 4:6774368-6774390 CTGGAGATGGACGGTGGTGATGG + Intergenic
969512739 4:7628775-7628797 CCAGAGAAGGACAGTGGTGATGG + Intronic
970166364 4:13242474-13242496 GTGAAGCAGGACAATGATGAAGG - Intergenic
970839791 4:20454049-20454071 AAGGGGAAGCACAGTTATGAAGG - Intronic
970981440 4:22103212-22103234 ATGGAGGAAGACATTTATGATGG + Intergenic
971466489 4:26968587-26968609 CTGGAGATGGATTGTGATGATGG + Intronic
971894032 4:32566775-32566797 ATGTTGAAGGAAAATGATGATGG + Intergenic
972053113 4:34764993-34765015 CTAAAGAAGGACAGTGATGAAGG + Intergenic
972455878 4:39254706-39254728 CTAGAGATGGACAGTGGTGATGG - Intronic
972498753 4:39658144-39658166 ATGGAGTAAGACAAGGATGAGGG - Intergenic
972679442 4:41291231-41291253 TTGGAGATGAACAGTGGTGATGG - Intergenic
972796865 4:42430030-42430052 CTAGAGATGGACAGTGGTGATGG + Intronic
972907927 4:43774099-43774121 CTGGAGATGGATAGTGGTGATGG + Intergenic
973931669 4:55799303-55799325 ATTGAGATGGATAGTGGTGATGG + Intergenic
974496881 4:62641070-62641092 ATGGAGATGGATGGTGGTGATGG + Intergenic
975608486 4:76180117-76180139 ATGCAGCTGGACACTGATGATGG - Intronic
975731843 4:77345179-77345201 ATGGAGTAGGCTTGTGATGAAGG - Intronic
975981656 4:80167864-80167886 CTGGAGATGGATAGTGGTGAAGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976504087 4:85826277-85826299 ATGGAGAAGGGGATTAATGAAGG - Intronic
976674129 4:87685643-87685665 ATGGAGGAGGCCAGTGAGGCTGG - Intergenic
977370420 4:96127195-96127217 ATAGAGAAGGAAAGGGAAGAAGG - Intergenic
977960756 4:103082517-103082539 CTGGAGATGGACAGTGGTGATGG - Intronic
978012033 4:103699328-103699350 ATGAAGGAGAACAGTGATGGCGG + Intronic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979384475 4:120048187-120048209 ATGGAGATGGATGGTGGTGATGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980122724 4:128744284-128744306 CTGGAGATGGACAATGGTGAGGG - Intergenic
980220428 4:129906332-129906354 ATGAAGAATGACAGGGAAGAAGG + Intergenic
980546232 4:134266742-134266764 TTGGAGAATGATAGGGATGATGG - Intergenic
980886039 4:138763735-138763757 ATGGAGATGGATGGTGGTGATGG + Intergenic
981191394 4:141868981-141869003 AAGGAGAGGGAGAGAGATGAGGG + Intergenic
981202754 4:142000709-142000731 TTGGAGAAGGATGGTGCTGATGG + Intergenic
981551863 4:145949850-145949872 GTTGAGCAGGACAGTGAGGAGGG + Intergenic
981577562 4:146221136-146221158 CTGGAAATGGATAGTGATGATGG - Intergenic
981678504 4:147366844-147366866 ATGGAGAAGGTGAGAGATGTAGG + Intergenic
981881314 4:149616496-149616518 CTGGAGATGGATAGTAATGATGG + Intergenic
981924494 4:150123360-150123382 AAGGAGAGGGAGAGAGATGAGGG + Intronic
982108602 4:152032841-152032863 ATGGAGAGTGACAGTGATGGGGG + Intergenic
982222935 4:153140402-153140424 CTGGAGATGGATGGTGATGATGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982231613 4:153213138-153213160 ATGGAGAAGAACAGTAATAGTGG - Intronic
982273097 4:153611543-153611565 AAGGATATGGACAGTGGTGATGG - Intronic
982274289 4:153623432-153623454 CTGGAGATGGACAGTTGTGATGG - Intronic
983014438 4:162594274-162594296 ATGGAGAAGGCCAGGTGTGATGG + Intergenic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983483554 4:168305840-168305862 ATGGAGAAGGTCAATAAAGAAGG - Intronic
983512083 4:168619667-168619689 CTGGAGGAAGACAGTGATGGGGG + Intronic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984916247 4:184727341-184727363 CTGGAGATGGATGGTGATGATGG + Intronic
984947722 4:184983064-184983086 ATGGAGGAAGACAGGGAGGAGGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985799874 5:1998283-1998305 ATGGTGAAGGTCATGGATGATGG + Intergenic
985983173 5:3489042-3489064 AGGGAGAGAGACAGAGATGATGG - Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
986808630 5:11332566-11332588 TTGGAGATGGTTAGTGATGATGG - Intronic
986872780 5:12069588-12069610 CTGGAGAAGCAATGTGATGAAGG + Intergenic
986876045 5:12111184-12111206 AGGGAGAAGGGCAATGATGCTGG + Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
987856045 5:23422221-23422243 AAGGGGAAAGAAAGTGATGAGGG + Intergenic
988519466 5:31932687-31932709 CTGGAGATGGATAGTGGTGATGG - Intronic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
989165501 5:38430068-38430090 ATCGTGAAGAACATTGATGATGG - Intronic
989560866 5:42849330-42849352 ATGGAGATGGATGGAGATGATGG + Intronic
990795752 5:59538640-59538662 TTGGGGAAGGACAGTGCTGAAGG - Intronic
990885930 5:60593486-60593508 AAGGAGAGGGAGAGTGATGGGGG - Intergenic
991351524 5:65724182-65724204 CTGGAGATGGACAGTGGTGTTGG - Intronic
991373729 5:65943779-65943801 CTGGAGATGAACAGTGGTGAAGG - Intronic
991450872 5:66749320-66749342 ACGGAGCAGTACAGTGGTGAGGG - Intronic
991453703 5:66780142-66780164 CTGGAGATGGATAGTGCTGATGG - Intronic
991468539 5:66941881-66941903 ATGGAGAAGGAAAGAGATGGGGG + Intronic
991778354 5:70107496-70107518 CTGGAGATGGATAGTGGTGATGG + Intergenic
991857644 5:70982963-70982985 CTGGAGATGGATAGTGGTGATGG + Intronic
992525399 5:77605286-77605308 AGGGAGAAGGTCAGTGGTGAAGG - Intronic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
993625435 5:90219160-90219182 ATGAAGATGGATAGTGGTGATGG + Intergenic
993628135 5:90250842-90250864 ATGAAGAAGGAGAGGGATAAGGG + Intergenic
993934472 5:93984958-93984980 ATGGAGGAGGACAGGGATGAAGG - Intronic
995066894 5:107872674-107872696 AAGGAGAAGGAAAGAGACGAAGG + Intronic
995448974 5:112279494-112279516 TTGGAGATGGACAGTGATGATGG + Intronic
995626497 5:114082971-114082993 ATAGAGATGGATAGTGGTGATGG + Intergenic
995784075 5:115809661-115809683 GTGGAGATGGATAGTGATCAGGG - Intronic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996892188 5:128434613-128434635 AAGGAGAGGGACAGGGAAGAAGG - Intronic
997341238 5:133146661-133146683 CTGGAAATGGACAGTGGTGATGG - Intergenic
997599761 5:135131213-135131235 ATAGAGAAAGACAGAGATGGTGG + Intronic
997908571 5:137845200-137845222 AAGGAGAGGAACAGTGATGGTGG - Intergenic
998273465 5:140728516-140728538 CTGGAGATGGATAGTGGTGATGG - Intergenic
998508443 5:142691045-142691067 ATGTAAAAAGACAGTGATAAGGG - Intronic
998678654 5:144439230-144439252 TTGGAGAAATACAATGATGAGGG + Intronic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
999514912 5:152291415-152291437 GAGGAGAGGGACAGAGATGAGGG - Intergenic
1001237615 5:170043384-170043406 GTGGAGTAGGATAATGATGACGG - Intronic
1002337562 5:178490506-178490528 CTGGAGAAGGATGGTGGTGATGG + Intronic
1002658795 5:180775823-180775845 ATGGAGAATGCCATTGATGCTGG - Intergenic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002949110 6:1791008-1791030 ACAGAGAAGGTAAGTGATGATGG + Intronic
1003053454 6:2799555-2799577 ATGGAGAGGGACAGAGGTAAGGG - Intergenic
1003155897 6:3593985-3594007 GTGGTGAAGGACAGTTATGTTGG + Intergenic
1003191566 6:3879594-3879616 TTGTGGAAGGACAGGGATGAAGG + Intergenic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003419061 6:5939413-5939435 CTGGAGCAGGTCAGTGATGCTGG + Intergenic
1003599958 6:7507842-7507864 CTGGAGATGGACGGTGGTGACGG + Intergenic
1003934288 6:10959457-10959479 CTGGAAATGGATAGTGATGATGG + Intronic
1004933251 6:20482372-20482394 ATAGAGAAAGACAGAGAAGATGG - Intronic
1005219114 6:23565846-23565868 AAAGAGAAGGAGAGTAATGAAGG - Intergenic
1005319687 6:24640991-24641013 GTGGAGATAGATAGTGATGATGG - Intronic
1006256198 6:32834551-32834573 CTGGAGATGGATGGTGATGATGG + Intronic
1006734278 6:36261452-36261474 AGGGAGGAGGAAAGTGTTGATGG + Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1007906030 6:45461524-45461546 ATGGAGAAGGAAAGTGCAAAAGG + Intronic
1008197128 6:48538111-48538133 ATGGGGATGCACAGTGCTGAGGG + Intergenic
1008603707 6:53120019-53120041 ATGGAGTAGGATAGGGGTGAAGG - Intergenic
1008627661 6:53333897-53333919 AGGTAGAAGGACAGTGACCAGGG + Intronic
1008876061 6:56329379-56329401 ATGGAGAAAGTCAGGGGTGAAGG + Intronic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010454984 6:76044406-76044428 ATGGAGAAGGGCAGGCATGTAGG - Intronic
1010582860 6:77620857-77620879 CTGGAGATGGATAGTGATGATGG - Intergenic
1010765966 6:79777644-79777666 CTGGAGACGGACAGTGGCGATGG + Intergenic
1011147326 6:84233133-84233155 ATGAATAAGGACAGTGACGGGGG - Intergenic
1011748402 6:90431205-90431227 CTGGTGATGTACAGTGATGATGG - Intergenic
1011749096 6:90437539-90437561 CTAGAGATGGACGGTGATGATGG - Intergenic
1013003874 6:106052082-106052104 CTGGAGATGGATACTGATGATGG + Intergenic
1013573504 6:111454477-111454499 CTGGAGATGGATAGTGATGATGG - Intronic
1013975637 6:116075011-116075033 AAGGAGAAGGGCAGAGATTAGGG + Intergenic
1015220520 6:130799904-130799926 ATGGAGATGGATGGTGGTGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016113192 6:140251402-140251424 TTGGAGAAGGTCAGTTATGTTGG + Intergenic
1017029684 6:150210275-150210297 TTGGAGAAGGACAGTAATGACGG - Intronic
1017058089 6:150455858-150455880 ATGGTCATGGACAGTGATGCTGG - Intergenic
1017203323 6:151778302-151778324 CTGGAGATGGACAATGGTGATGG + Intronic
1017500771 6:155020814-155020836 CTGGAGATGGATAGTGGTGAGGG - Intronic
1017582392 6:155880394-155880416 ATGATGTAGGACAATGATGATGG - Intergenic
1017615570 6:156243361-156243383 TTGAAGAAGGACAGTTGTGAGGG + Intergenic
1017846949 6:158266890-158266912 CTGGAGATGGATAGCGATGATGG - Intronic
1018222290 6:161593327-161593349 ATGGATGAGGACAGTGAGGCAGG + Intronic
1018313882 6:162537761-162537783 ATGGAGATGGACACTGCTGGTGG - Intronic
1018577680 6:165276643-165276665 AGGGACAAGGACAATGAAGAGGG - Intergenic
1018597252 6:165494876-165494898 ATTGAGATGGATAGTGTTGAAGG - Intronic
1018619576 6:165716918-165716940 CTGGAGATGGACGGTGGTGACGG - Intronic
1019106629 6:169673060-169673082 ACTAAGAAAGACAGTGATGATGG + Intronic
1019349731 7:549022-549044 CTGGACATGGACAGTGGTGATGG + Intergenic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019608083 7:1920113-1920135 CTGGGGAAGGACAGGGATGCTGG - Intronic
1019724236 7:2592190-2592212 AGGGGTAAGGACAGTGGTGACGG - Intronic
1019853919 7:3585582-3585604 ATGAAGAAGGAAATTGATCAGGG + Intronic
1020218230 7:6212352-6212374 CTAGAGATGGATAGTGATGATGG - Intronic
1020996082 7:15266283-15266305 CTGGAGATGGACGGTGAAGATGG + Intronic
1021225402 7:18020591-18020613 AGGGAGAAAGTCATTGATGATGG - Intergenic
1021411855 7:20337945-20337967 ATGGCCAAGGACACTGATGCAGG + Intronic
1021465877 7:20943148-20943170 ATGGAGATGGATGGTGTTGATGG + Intergenic
1021772329 7:24017724-24017746 CTAGAGATGGACAGTGGTGATGG + Intergenic
1021874326 7:25034479-25034501 CTGGAGATGGATGGTGATGATGG - Intergenic
1021943744 7:25704974-25704996 AAGGAAAATGACAGTGAGGAGGG + Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022111332 7:27234202-27234224 ATGGAGAAGGCCAGGCATGGTGG - Intergenic
1022387970 7:29919263-29919285 ATGGAGAGGGATGGTGGTGACGG - Intergenic
1022715922 7:32898345-32898367 CTGGAAAAGGATAGTGGTGATGG + Intergenic
1023291147 7:38670337-38670359 GTGGAGCATGACAGAGATGATGG + Intergenic
1023305233 7:38818973-38818995 ATGGATTAGGAAAGTGTTGAAGG - Intronic
1023711943 7:43004221-43004243 ATGCAGATGGATAGTGGTGATGG - Intergenic
1023751124 7:43373716-43373738 CTGGAGATAGACGGTGATGATGG - Intronic
1023762162 7:43475042-43475064 CTGGGGAAGGAGAGTGGTGATGG + Intronic
1023979074 7:45055765-45055787 CTGGAGATGGATAGTGCTGATGG - Intronic
1025090447 7:56058831-56058853 CTAGAGATGGACAGTGCTGACGG - Intronic
1025227374 7:57177381-57177403 GTGGAGCATGACAGTGGTGAGGG - Intergenic
1025230484 7:57200818-57200840 GTGGAGCATGACAGTGGTGAGGG - Intergenic
1025832824 7:65068935-65068957 CTAGAGATGGACAGTGCTGATGG - Intergenic
1025902595 7:65758458-65758480 CTAGAGATGGACAGTGCTGACGG - Intergenic
1025928783 7:65979392-65979414 GTGGAGCAAGACAGTGGTGAGGG - Exonic
1026176519 7:68002502-68002524 ATGGAGATGGAGAGAAATGAAGG - Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1028599251 7:92583367-92583389 ATGAAAATGGATAGTGATGATGG + Intronic
1028828739 7:95304061-95304083 CTGGAGAGGGATGGTGATGATGG - Intronic
1029021847 7:97372383-97372405 CTGGAGATGGATAGTGGTGATGG - Intergenic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1030043722 7:105475770-105475792 GTGGAGGTAGACAGTGATGATGG - Intronic
1030091962 7:105865768-105865790 CTGGAGATGGACTGTGGTGATGG - Intronic
1030131865 7:106208291-106208313 CTGGAGATGGATAGTGATGAGGG + Intergenic
1030643397 7:112031443-112031465 ATGAGGAAGGACAGAGAAGAGGG - Intronic
1031122572 7:117738466-117738488 ATGGTTAAGGAAAGAGATGATGG + Intronic
1031463396 7:122079163-122079185 CTGGAGCAGGGCAGAGATGATGG + Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031860226 7:126970894-126970916 AAAGAGAGGGACAGAGATGAGGG + Intronic
1032359559 7:131242664-131242686 ATCGTGAAGAACATTGATGATGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032652699 7:133895908-133895930 AGAGAGAATGAAAGTGATGAAGG + Intronic
1032760675 7:134938534-134938556 ATGGAGAACGTCCGTGCTGAAGG - Intronic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034129430 7:148701331-148701353 AGGGAGAAGGGAAGTGAAGAGGG - Intronic
1034788066 7:153943457-153943479 ATGGAGAAGGACAAAAAAGAGGG - Intronic
1035144401 7:156799555-156799577 TAGGAGAAGGAGAGAGATGAAGG - Intronic
1036445991 8:8822374-8822396 ATGCAGAGGGACAGAGATGGGGG + Intronic
1036552105 8:9825035-9825057 CTGGAGATGGATGGTGATGACGG + Intergenic
1036743799 8:11389997-11390019 ATGGAGAGAGAGAGAGATGAAGG + Intergenic
1037098893 8:15018638-15018660 GGGGAGAAGGTAAGTGATGAAGG + Intronic
1037169015 8:15867552-15867574 AAGGAGGAGGACGGGGATGAGGG + Intergenic
1037430195 8:18803842-18803864 ATGGAGATGGACGGTGGTGACGG + Intronic
1037815612 8:22110124-22110146 AGGCAGAGGGACACTGATGAGGG - Intergenic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1037934595 8:22906926-22906948 GTGGTGAAGGAAAGTGGTGAAGG + Intronic
1038311127 8:26447078-26447100 CTGGAGATGGACAGTGGTGATGG + Intronic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1038570793 8:28660626-28660648 CTAGAGAAGGATAGTGGTGATGG - Intronic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039845966 8:41325607-41325629 TTGGAGGAGGACAGTGAGAAGGG - Intergenic
1040594841 8:48827245-48827267 GTGCAGAAGGACGGTGATCATGG + Intergenic
1040675850 8:49749307-49749329 CTGGAGATGGACAGTGGGGATGG + Intergenic
1041048502 8:53909835-53909857 ATGTGGAAGGACAGAGGTGATGG + Intronic
1041088970 8:54284127-54284149 GTGGAGATGGACGGTGGTGATGG - Intergenic
1041330051 8:56714457-56714479 GTGGGGAAGGACAGTGAGGGAGG - Intergenic
1041626619 8:60036165-60036187 AAGGAGAGGGAAAGAGATGAAGG - Intergenic
1041642845 8:60220913-60220935 TGGGAGGAGGACAGTGAAGATGG + Intronic
1041715935 8:60932058-60932080 GTGGAGATGGATGGTGATGATGG - Intergenic
1041854105 8:62429920-62429942 ATGGAGACGGATGGTGGTGATGG - Intronic
1042283850 8:67085157-67085179 CTGGAAATGGATAGTGATGATGG + Intronic
1042648107 8:71009655-71009677 ATGGGGAAGAAGAGTGCTGAGGG + Intergenic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1043054996 8:75426295-75426317 ATGGAGAAACACAGAGATCAGGG - Intronic
1043321673 8:78994380-78994402 CTGGAGATGGATGGTGATGATGG + Intergenic
1043373501 8:79621063-79621085 GTGGAGAAGGGCAGAGCTGATGG - Intronic
1044422498 8:92013936-92013958 CTGGAGATGGACAGTGGTGGTGG + Intronic
1045113857 8:98960800-98960822 ATGTAGAAAGACAGAGAGGAAGG - Intergenic
1045410185 8:101909433-101909455 GTGGAGCAAGGCAGTGATGAAGG - Intronic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1046816090 8:118585353-118585375 CTGGAGATGGATGGTGATGATGG + Intronic
1047013149 8:120693770-120693792 AAGGAGAAGGACTGCGATGACGG + Exonic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048103871 8:131385863-131385885 TTTGAGATGGACAGTGGTGATGG + Intergenic
1048228344 8:132612553-132612575 AAGGAGAGGGACAGTGTTCAGGG - Intronic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1049342454 8:142120493-142120515 AGGGAGAAGGCCTGTGAAGATGG - Intergenic
1049401596 8:142430030-142430052 ATGGAGAGGGACAGGGACAAAGG - Intergenic
1049684361 8:143933463-143933485 AAGGGGAAGGACAGGGATGGAGG - Intronic
1049939569 9:532453-532475 CTGGAGATGGATGGTGATGATGG - Intronic
1050323490 9:4477767-4477789 CTGGAGATGGATAGTGGTGACGG + Intergenic
1050530548 9:6585052-6585074 ATGGAGAATGACTGGGGTGAGGG - Intronic
1050682316 9:8126449-8126471 AAGGAGAAAGACAGTGAGAAAGG - Intergenic
1051071464 9:13173181-13173203 CTGGAGATGGATGGTGATGATGG + Intronic
1051806749 9:21002623-21002645 CTGGAGATGGACAGTGGTGATGG + Exonic
1052255995 9:26457373-26457395 ATGGAGAATGACAGTCAATAAGG + Intergenic
1052483406 9:29062744-29062766 CTAGAGATGGATAGTGATGATGG + Intergenic
1053052270 9:34971720-34971742 AGGGAGCAGGACAGGGAAGATGG + Intronic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1053307009 9:36991790-36991812 GTGGAGGACGAAAGTGATGAGGG - Intronic
1053393949 9:37755324-37755346 CTGGAGCTGGACAGTGGTGATGG + Intronic
1054474472 9:65562980-65563002 CTGGAGATGTCCAGTGATGAAGG + Intergenic
1054835436 9:69671718-69671740 CTGGAGAAAGAATGTGATGATGG - Intronic
1054929458 9:70620548-70620570 ATGCATAAGCACAGTGCTGAGGG + Intronic
1055603904 9:77948484-77948506 ATGGAAGAGGACACGGATGAAGG + Intronic
1056379663 9:86045819-86045841 AGGGAAAAGGACAGTCATGAGGG + Intronic
1056444557 9:86653297-86653319 CTGGAGATGGATAGTGGTGATGG - Intergenic
1056535374 9:87523167-87523189 CTGGAGATGGATAGTGGTGATGG - Intronic
1056546267 9:87616446-87616468 AGGGAGAAGGACAGTTTTGGGGG + Intronic
1056578459 9:87873090-87873112 AGGGAGAAAGACAGAGAGGAGGG + Intergenic
1056700699 9:88904167-88904189 AGGGAGAAGGAAAGTGATATAGG - Intergenic
1056719200 9:89058707-89058729 GTGGAGGAGGACAGTGGTGTAGG + Intronic
1056719225 9:89058819-89058841 ATGGTGGAGGACAGTGGTGGAGG + Intronic
1056719237 9:89058882-89058904 ATGGTGGAGGACAGTAGTGAAGG + Intronic
1056719251 9:89058957-89058979 ATGGTGGAGGACAGTAGTGAAGG + Intronic
1056719309 9:89059182-89059204 ATGGTGGAGGACAGTGGTGGAGG + Intronic
1056972525 9:91219029-91219051 ATGCACAGGGACTGTGATGACGG + Intronic
1057097908 9:92328934-92328956 CTGAAGATGGACAGTGGTGATGG - Intronic
1057102953 9:92381057-92381079 CTGGAGAAGGACAGTGGTGATGG - Intronic
1057121249 9:92576406-92576428 ATGAAAATGGACAGTGGTGATGG + Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057229467 9:93310994-93311016 ATGGAGATGAACAGTGGTGGTGG - Intronic
1057359286 9:94358651-94358673 CTGGAGATGGACAGTGGTGACGG + Intergenic
1057648479 9:96898939-96898961 CTGGAGATGGACAGTGGTGACGG - Intronic
1057673427 9:97116527-97116549 TTGGATCAGGACAGTGATGTTGG + Intergenic
1057825172 9:98367536-98367558 TTGGAGATGGATGGTGATGATGG + Intronic
1058691893 9:107526994-107527016 CTGGAGATGGATGGTGATGATGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058861730 9:109123054-109123076 TTGGAGTAGGACAGAGAGGAGGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059137232 9:111818791-111818813 GCGGAGATGGATAGTGATGATGG + Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059696755 9:116737046-116737068 ATGCAGAAAGACAGAGAAGATGG + Intronic
1059752921 9:117265523-117265545 ATGGAGAGGGTCAGTGTTGAGGG + Intronic
1059899957 9:118913009-118913031 ATGGTGTAGGACTGTGATCAGGG + Intergenic
1060005029 9:119992293-119992315 AAGGAAAAGGAAAGAGATGATGG - Intergenic
1060239327 9:121889453-121889475 CTGGAGATGGAAGGTGATGATGG - Intronic
1060382931 9:123193722-123193744 TTGGATAAGGACAGAAATGAGGG - Intronic
1060621611 9:125072617-125072639 ATGGAGATGGATGGTGGTGATGG - Intronic
1060692510 9:125676675-125676697 ATGGAAATGGACAGTGGTGACGG + Intronic
1060699208 9:125736186-125736208 TTGGAGAAAGATAGTGGTGATGG + Intergenic
1060900315 9:127251357-127251379 ATGGTGATTGAGAGTGATGAGGG - Intronic
1061036921 9:128119101-128119123 ATGGAGAGGTACAGGGATGGAGG + Intergenic
1061622686 9:131821968-131821990 CTGGAGATGGACGGTGGTGATGG + Intergenic
1061679311 9:132235120-132235142 AGGTAGAAGGGCAGTGATCAGGG + Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061984619 9:134123091-134123113 CTAGAAAAGGACAGTGGTGACGG + Intergenic
1186574093 X:10746997-10747019 ATGGAGAAGGTGAGAGGTGATGG + Intronic
1187296574 X:18007455-18007477 ATGGAGAAGGGAAGAGATGCTGG - Intergenic
1187482125 X:19667258-19667280 CTGGAGATGGATAGTGATGACGG + Intronic
1187761350 X:22589514-22589536 GTGGAATATGACAGTGATGAGGG + Intergenic
1188819311 X:34754125-34754147 AAGGAGAAAGAGAGTGATGGAGG + Intergenic
1189110922 X:38287725-38287747 ATAGAAAAGGAAAGTGATGGAGG - Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189426377 X:40905171-40905193 ATGGAGATGGAAAGTAATGATGG + Intergenic
1189486826 X:41440228-41440250 CTAGAGAAGGATAGTGGTGATGG - Intergenic
1189504769 X:41601163-41601185 CTGGAGATGGATAGTGATGATGG + Intronic
1190158863 X:48016258-48016280 AGGGAGAGGGAGAGGGATGAGGG - Intronic
1190174560 X:48138529-48138551 AGGGAGAGGGAGAGGGATGAGGG - Intergenic
1191941200 X:66483446-66483468 TTGCTGAAGGACAGTGGTGAAGG - Intergenic
1192197407 X:69037863-69037885 ATGGGAAAGGGCAGAGATGAAGG + Intergenic
1192274195 X:69613498-69613520 AGTGACAAGGACAGTAATGAAGG + Intergenic
1192275089 X:69620755-69620777 ATGGAGAAAGACAAAAATGAAGG - Intronic
1193304732 X:79934650-79934672 GTGGTGATGGATAGTGATGATGG + Intergenic
1194115109 X:89887397-89887419 ATGTGGAAGAACAGTGGTGAAGG + Intergenic
1194403207 X:93462594-93462616 ATGGAGAAAGAAGGTGAAGAGGG + Intergenic
1194702431 X:97130664-97130686 CTGGAGATGGATAGTGGTGATGG + Intronic
1195091231 X:101461158-101461180 CTGGAGATGGACAGTGGTGATGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1195956641 X:110338130-110338152 ATGGAGATGGATGGTGGTGATGG + Intronic
1196606053 X:117658310-117658332 CTAGAGATGGATAGTGATGATGG + Intergenic
1196707941 X:118732130-118732152 ATGGGGATGGATGGTGATGATGG - Intronic
1197681098 X:129386360-129386382 CTGGAGATGGGTAGTGATGATGG - Intergenic
1198034605 X:132788439-132788461 AAGGAGAGGGAGAGAGATGAAGG - Intronic
1198422749 X:136483998-136484020 ATGGACAAGTACAGTGATAAGGG + Intergenic
1198594444 X:138221036-138221058 TTGGAGAAGGAAAGTGCTCAAGG + Intergenic
1199592504 X:149480294-149480316 AGGGAGAAGGACTGAGAAGATGG + Intergenic
1199657376 X:150009830-150009852 AAGGAGAAGGAAAGAGATAAAGG + Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1200286890 X:154831558-154831580 AAGCAGAAAGACAGAGATGATGG - Intronic
1200371806 X:155734319-155734341 GAGGAGAAGGAAAGAGATGAGGG + Intergenic