ID: 1179901447

View in Genome Browser
Species Human (GRCh38)
Location 21:44396488-44396510
Sequence AGGGATGTGGAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 6, 2: 21, 3: 45, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179901447 Original CRISPR AGGGATGTGGAGACTGTGGA AGG Intronic
900131751 1:1090196-1090218 AGGGCTGTGGAGCTTGGGGAAGG - Intronic
900569579 1:3351704-3351726 AGGGAGGGGGAGACAGAGGAAGG - Intronic
900993391 1:6108001-6108023 AGGGATGAAGGGACGGTGGAGGG + Intronic
901213665 1:7541045-7541067 AGGGATGTGGGGGCTGTGCTGGG + Intronic
902546619 1:17194322-17194344 AGGGATGTGGAAAGTGGAGAGGG + Intergenic
902643282 1:17780360-17780382 TGGCATGTGGAGTCTGCGGAGGG + Intronic
902686489 1:18080812-18080834 AGGGCTGTGGTGATTGGGGATGG + Intergenic
904942834 1:34177133-34177155 AGGGATGAGGCGTGTGTGGATGG - Intronic
904984594 1:34534599-34534621 AGGGGTGTGGAGGCTGCGGCAGG - Intergenic
905456056 1:38088667-38088689 AGGGCTGGGGAGAGTGTGGAAGG - Intergenic
905646607 1:39628997-39629019 AGAGATGAGGAAACTGAGGAGGG + Intronic
905648831 1:39643079-39643101 TGGGATGTGAAGCGTGTGGATGG - Intergenic
906519879 1:46460649-46460671 TGGGATGTGGGGTCAGTGGAGGG + Intergenic
906692199 1:47799860-47799882 AAGCATTTGGAGCCTGTGGAAGG - Intronic
908328749 1:63049612-63049634 AGGGATGTGGGGCGTGTTGAGGG + Intergenic
909535135 1:76727733-76727755 ATGAGTGTGGAGGCTGTGGAGGG - Intergenic
914399897 1:147308645-147308667 TGGGATGGGGGGAGTGTGGAGGG + Intergenic
915083719 1:153369955-153369977 AGCCATGTGGAGACAGTGTATGG - Intergenic
915509213 1:156377451-156377473 ATGGATGTGGCCACCGTGGAAGG - Exonic
915794310 1:158711437-158711459 AGGGAAGTGGAGAGGTTGGAGGG - Intergenic
915893257 1:159790978-159791000 AGAGATGTGGAGAGTGAGGTTGG + Intergenic
917193830 1:172446019-172446041 GGGGATGTGGAGACAGTGATGGG - Intronic
917234625 1:172877775-172877797 AGGGATGGGGGGAGGGTGGAGGG - Intergenic
917985229 1:180309955-180309977 AGTGATGTGAATGCTGTGGAAGG + Intronic
918205916 1:182309092-182309114 AGCTATGTGGAGGCTGAGGAGGG + Intergenic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
920367358 1:205455210-205455232 AGGGATGGGGAGGCAGTGGGAGG + Intronic
920570634 1:207014405-207014427 AGGCAACAGGAGACTGTGGAGGG - Intronic
922168415 1:223135046-223135068 AGGGATGTGTAGTCTGTGCTGGG + Intronic
922237316 1:223731775-223731797 AGGGATGTGGAGGCAGCGGAAGG + Intronic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
923550566 1:234959755-234959777 AGGGATGTGGGTCCTGCGGATGG - Intergenic
924315123 1:242787471-242787493 TGGGATGTGGGGACTGTCCAGGG - Intergenic
924400808 1:243678948-243678970 AGAGATGTGGAGCGGGTGGAAGG - Intronic
924649417 1:245911227-245911249 AAGGATGTGGAGAAAGGGGAAGG + Intronic
1063218907 10:3948356-3948378 TGGGATGTGGAGAGGGTGGAAGG + Intergenic
1063386785 10:5620794-5620816 TGGGATGTGGTGGCTGTGGAAGG - Intergenic
1063606430 10:7526752-7526774 AGGGATGTATATATTGTGGAGGG + Intergenic
1063772819 10:9223274-9223296 AGGGATGTGGAGACATAGCAGGG + Intergenic
1064557935 10:16566416-16566438 AGGGAAGTGGAGCATGGGGAAGG + Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068689796 10:59904370-59904392 AGGGATGCAGAGACTATGAAAGG - Intronic
1069594044 10:69659106-69659128 AGTGATGGGGAGATTGTGGTGGG + Intergenic
1069716437 10:70524070-70524092 AGGGCTGGGGGGAGTGTGGATGG + Intronic
1069837118 10:71316575-71316597 AGGGATGGGGAGGCTGGGGTGGG - Intergenic
1069847302 10:71381260-71381282 GGGGATGTTGATACTGTGGCAGG + Intergenic
1069979187 10:72240451-72240473 AAAGATGTGGAGACAGAGGATGG + Intergenic
1070295261 10:75155244-75155266 AGAGATGGGAAAACTGTGGAAGG + Intronic
1070343933 10:75523529-75523551 AGCTATGTGGGGACTGTGTATGG + Intronic
1071472238 10:85991847-85991869 GGGGATGTGGAAAATGTGGGAGG + Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071672033 10:87617920-87617942 AGGGATGGGGAGACAGTCAAGGG + Intergenic
1072841210 10:98776006-98776028 ATGGTTGTGGGGACTGAGGAGGG - Intronic
1073096690 10:100984297-100984319 GGGTCTGTGGAGACTGAGGAGGG - Exonic
1073820068 10:107251710-107251732 AATGATGTGAATACTGTGGATGG - Intergenic
1074135858 10:110625880-110625902 AGGGTGTTGGAGTCTGTGGAGGG - Intergenic
1074964055 10:118473245-118473267 AGGGAGGTGGAGGCAGGGGAAGG - Intergenic
1075708258 10:124515928-124515950 AGAGCTGTGGAGATCGTGGAGGG - Intronic
1075923942 10:126235655-126235677 AGGGATGAGGAGGCTGGAGAAGG - Intronic
1077423439 11:2463503-2463525 AGGGAGGTGGAGCCTGTCCAGGG - Intronic
1078171815 11:8933782-8933804 AGGAATCTGGAGACTTTGGTTGG + Intergenic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1079067926 11:17313746-17313768 AGGTATGAGGAAACTGAGGAGGG - Intronic
1079373003 11:19868084-19868106 AGGGGTGGGGTGATTGTGGAGGG + Intronic
1080897526 11:36458934-36458956 AGAGATATGGGCACTGTGGAAGG + Intronic
1081626541 11:44659338-44659360 AGGGATGGAGAGACTGAAGAAGG + Intergenic
1081629996 11:44682563-44682585 AGGGATGTGCAGAGTGAGGGAGG - Intergenic
1081977819 11:47246928-47246950 AGGGAGGAGGAAACTGGGGAAGG + Intronic
1081991426 11:47339617-47339639 ATAGATGGGGAGACTGAGGAGGG + Intronic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1083645308 11:64168812-64168834 TAGGATGTGGAGTCTTTGGAGGG + Intergenic
1084192798 11:67506415-67506437 GGGGAAGAGGAGACTATGGATGG - Intergenic
1084726664 11:70946507-70946529 AGGGATGGTGAGCCTGGGGAAGG - Intronic
1084887188 11:72218478-72218500 AGGGTTGGGGAGACTGAGGCAGG + Intronic
1085345228 11:75764248-75764270 AGGGCTGTGGAGGCGATGGATGG + Intronic
1085807619 11:79650770-79650792 AGGTATGTGGAGTCAGTGGATGG - Intergenic
1086081728 11:82909986-82910008 AGAAATGTGGTGACTATGGAAGG - Intronic
1086316728 11:85602680-85602702 TGGGATGGGGAGACACTGGAGGG - Intronic
1086417838 11:86606740-86606762 AGGGATGTGGTGTCTTTGGTTGG + Intronic
1087924028 11:103899000-103899022 AGGTAGGTGGAGACTGGGGCAGG - Intergenic
1088031923 11:105261983-105262005 AGGGAGGAAGAGACGGTGGAAGG + Intergenic
1089163461 11:116457369-116457391 AGGGATGGGAAGACAGTGCAGGG - Intergenic
1089646855 11:119886269-119886291 AGGGCTGGGGAGCCTGGGGAGGG - Intergenic
1089775025 11:120830049-120830071 AGGGAGCTGGAGGCTGTGGCAGG - Intronic
1090168283 11:124575518-124575540 AGGGGTGTTGATACTGGGGAAGG + Intergenic
1090397240 11:126427077-126427099 AGGGATGTGGAGACAGTCTGAGG + Intronic
1090845644 11:130527839-130527861 AGGCGTGTGCAGTCTGTGGAAGG - Intergenic
1091219085 11:133919946-133919968 TGGGAGGGGGAGCCTGTGGACGG + Exonic
1093590181 12:20893546-20893568 ATTGATGTGGAGGTTGTGGAAGG + Intronic
1096692269 12:53328545-53328567 AGGGATGTGGCAGCTGTGGATGG + Exonic
1097169503 12:57105025-57105047 TGGGATGTGGAGACCCTGAATGG - Intronic
1097196071 12:57243082-57243104 AGGGATGGGGAGGGGGTGGAGGG - Intergenic
1097285916 12:57877162-57877184 GGTGATGTGGAGTCTGTGGAGGG + Intergenic
1097305637 12:58066243-58066265 ATGTGTGTGGAGACTGTGGCAGG + Intergenic
1099412758 12:82351390-82351412 AGGAATTTGGATACTGTAGATGG - Intronic
1100060542 12:90569794-90569816 AGGGATGTGGAGAAAAGGGAAGG - Intergenic
1100857890 12:98774312-98774334 AGGGAGGTGGAGACGTTGAAGGG - Intronic
1102619937 12:114186401-114186423 AGGGTGGTGGAGAGTGTGTACGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103446078 12:120996195-120996217 AGGGCTGTGGAGGCAGGGGAGGG + Intronic
1104148948 12:126063439-126063461 AGGGATGTTGATATTGGGGAAGG - Intergenic
1105213618 13:18272178-18272200 AGGGATGTGGTGACAGAGGTTGG + Intergenic
1105287769 13:19020661-19020683 AAGGATGTGGAGAAACTGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105876207 13:24555551-24555573 AGGGGGGTGGAGCCTGTGGGCGG - Intergenic
1107100352 13:36583599-36583621 AGGGATGGAGAGACCATGGAGGG - Intergenic
1107730846 13:43346776-43346798 AGAGAGGTAGAGAGTGTGGAGGG - Intronic
1107807123 13:44163833-44163855 AGGGATGGGGAGCCGGAGGATGG + Intergenic
1107832801 13:44389507-44389529 AGGGAGGTGGAGAGTTGGGAAGG - Intronic
1108141455 13:47426807-47426829 AGAGATGTGAAGACTGAGAAAGG + Intergenic
1108679170 13:52764641-52764663 AGGGATGTGATGCTTGTGGAGGG + Intergenic
1109777005 13:67054033-67054055 AGGGATGTGGTGAGGGAGGAGGG - Intronic
1110655130 13:77988703-77988725 AGGGATCTGGGGAGTTTGGATGG - Intergenic
1111678774 13:91418582-91418604 AGTGATGGGGTGAGTGTGGAAGG + Intronic
1111705722 13:91747064-91747086 AGGGATGGAAAGACTATGGAAGG + Intronic
1112168599 13:96946830-96946852 AGGGGAGTGGAGAGTGTGGGAGG + Intergenic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1113338044 13:109395525-109395547 ATGGAGGTGGAGCCTGTGGGGGG + Intergenic
1113532856 13:111042095-111042117 TGGGATGTGGAGAGTGCAGAAGG - Intergenic
1113573955 13:111381760-111381782 AGGGCTGTGGTGACTGGGGGTGG + Intergenic
1113574016 13:111381980-111382002 AGGGCTGTGGTGACTGGGGGTGG + Intergenic
1113746585 13:112749620-112749642 AGGAATGTGGATACTGTGTTAGG + Intronic
1114167847 14:20239839-20239861 AGCGTTTTGGAGACTTTGGAGGG + Intergenic
1116113181 14:40613160-40613182 AGGGATATGGAAACTGTCTATGG + Intergenic
1116898767 14:50341705-50341727 GGGGAGGTCGAGACTGTGGTGGG + Intronic
1117861100 14:60093330-60093352 AGGGAGGTGGTGACTGCTGAGGG - Intronic
1118323439 14:64766593-64766615 AGGGATGTGGGGAGGATGGAGGG + Intronic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1118709981 14:68510968-68510990 AGGGAGGTGGAGACTGGGTGTGG - Intronic
1119259532 14:73229310-73229332 AGGGATGTGGACACAGTCCAAGG + Intergenic
1119627126 14:76187844-76187866 AGGGTGGTGGGGAATGTGGATGG - Intronic
1119773557 14:77235816-77235838 GGGTATGAGGAGACTGTGGTGGG + Intronic
1119773568 14:77235843-77235865 GGGTATGGGGAGACTGTGGTGGG + Intronic
1119773704 14:77236232-77236254 GGGTATGGGGAGACTGTGGTGGG + Intronic
1120020796 14:79527395-79527417 AATGATGAGGAGATTGTGGATGG + Intronic
1120639312 14:86991065-86991087 AGGGATGTTGATAGTGCGGAAGG - Intergenic
1121150536 14:91629582-91629604 TGGGATGTGGATAGTGGGGAAGG + Intronic
1121228158 14:92336829-92336851 GGGTAGGTGGAGGCTGTGGAAGG + Intronic
1121260347 14:92561352-92561374 AGGGAGGTGGATAGTGGGGAAGG - Intronic
1122180866 14:99953613-99953635 AGGGCTGTTGAGAGTGTTGAAGG - Intergenic
1122795040 14:104201771-104201793 GAGGCGGTGGAGACTGTGGATGG + Intergenic
1122864207 14:104596234-104596256 AAGAATGTGGAAACTCTGGAGGG + Intronic
1123033370 14:105461543-105461565 GGGGAGGTGGAGACTGTGGCAGG + Intronic
1123155966 14:106226323-106226345 AGGGATTTGGAGGGTTTGGAGGG - Intergenic
1123476220 15:20593947-20593969 TGGGATGTAGACCCTGTGGACGG + Intergenic
1123641792 15:22406417-22406439 TGGGATGTAGACCCTGTGGACGG - Intergenic
1124042512 15:26118395-26118417 CGGCAAGTGGGGACTGTGGATGG + Intergenic
1124639860 15:31391065-31391087 AGGGCTGTGGGGACTATGGCGGG + Intronic
1125213828 15:37246238-37246260 AGGAATGTGGAGAATTTGAATGG + Intergenic
1126534799 15:49749713-49749735 AGGGCTCTGGATACTGTGAAAGG + Intergenic
1127785106 15:62348922-62348944 AGGGATGTGGTGAGGGAGGAAGG - Intergenic
1128061767 15:64739805-64739827 AGAGATGTGGAGTCGGGGGAAGG - Intergenic
1129337845 15:74864401-74864423 AAGGTTATGGAGGCTGTGGAGGG + Intronic
1129475616 15:75782897-75782919 AAGGAGGTGGAGAGTTTGGAGGG + Intergenic
1130574748 15:85081940-85081962 GGGGATGTGAGGGCTGTGGAGGG - Intronic
1130574754 15:85081960-85081982 TGGGATGTGAGGGCTGTGGAGGG - Intronic
1131229175 15:90647493-90647515 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131229224 15:90647628-90647650 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131598511 15:93823891-93823913 AGGGAAGTGGGGACAGTGGATGG + Intergenic
1132671124 16:1102713-1102735 AGGGAGGTGGGGGCTGTGGGAGG - Intergenic
1132671156 16:1102792-1102814 AGGGAGGTGGGGGCTGTGGGAGG - Intergenic
1133554601 16:6893212-6893234 AGGGAAGCAGAGACTGTGGAGGG + Intronic
1133742039 16:8659004-8659026 TGGGCTGTGGACACTGGGGAAGG - Intergenic
1136239701 16:28936651-28936673 AGGGATGAGGAGAGTGGGGGTGG - Intronic
1137394693 16:48108598-48108620 CGTGTTGTGGAGTCTGTGGAGGG - Intronic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137599972 16:49749952-49749974 TGGGATGTGGGGAGAGTGGATGG - Intronic
1137709679 16:50557820-50557842 AGGGCTGTGGAGGTTGGGGAGGG + Intronic
1138356123 16:56381882-56381904 AGGGATGTTGATAATGGGGAAGG + Intronic
1139518678 16:67467013-67467035 AGGGAATTGGAGACTTGGGAGGG - Intronic
1140506407 16:75476182-75476204 TGGGATGTGGAGCCTTTGGGAGG + Exonic
1140556981 16:75932610-75932632 GGGCATGTGGAAACTGTGGAGGG + Intergenic
1140808519 16:78555044-78555066 AGGAATGTGGAGACATTGGTGGG + Intronic
1141713868 16:85716071-85716093 AGGGGTTTGGAGACTGAGCAGGG - Intronic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142759494 17:2034683-2034705 GGGGATGGGGAAACTGGGGAGGG - Intronic
1142961674 17:3555643-3555665 AGGGGTGTGGGGATTGGGGAAGG + Intronic
1143854498 17:9838762-9838784 GAGAATGTGGAGACCGTGGAAGG + Intronic
1143971237 17:10797420-10797442 AGGGATTGGGAGAGTGAGGAAGG - Intergenic
1145229378 17:21161260-21161282 AGGGATGTGGATAATGGGGGAGG + Intronic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1146594515 17:34157220-34157242 CGGTATCTGGAGACTGGGGACGG + Intronic
1147133188 17:38420590-38420612 GGGGAGGTGGAGTCCGTGGAAGG + Intergenic
1147195208 17:38761919-38761941 AAGGATGTAGAGACAGAGGATGG + Intronic
1147573545 17:41586119-41586141 GGGGATGAGGAGGCTGGGGAAGG + Intronic
1148023166 17:44567003-44567025 AGGGATGTTGATAATGGGGAAGG - Intergenic
1148339394 17:46864308-46864330 GGGGATGTGGAGGCAGTGGGTGG - Intronic
1149639031 17:58191398-58191420 TGGGAGGAGGAGGCTGTGGAAGG + Intergenic
1149752162 17:59155891-59155913 AGGGAGGTGGGGACTTTGGCTGG + Intronic
1149806239 17:59620197-59620219 AGGGCTGTGGAGAAGGTGGTAGG + Intronic
1151178028 17:72305178-72305200 AGGGATTTGAGGGCTGTGGAAGG - Intergenic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1152842496 17:82579481-82579503 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842514 17:82579551-82579573 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842532 17:82579621-82579643 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842568 17:82579760-82579782 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842585 17:82579830-82579852 AGGGATCTGGGACCTGTGGATGG - Intronic
1152842603 17:82579900-82579922 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842622 17:82579970-82579992 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842640 17:82580040-82580062 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842658 17:82580110-82580132 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842676 17:82580180-82580202 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842713 17:82580320-82580342 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842732 17:82580390-82580412 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842751 17:82580460-82580482 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842770 17:82580530-82580552 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842789 17:82580600-82580622 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842807 17:82580670-82580692 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842826 17:82580740-82580762 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842845 17:82580810-82580832 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842863 17:82580880-82580902 AGGGATCTGGGCCCTGTGGATGG - Intronic
1153314884 18:3711908-3711930 AGGGATGGGGAGTGTGGGGATGG + Intronic
1153828067 18:8895569-8895591 AGAGATGAGGAGACTGTTCAGGG + Intergenic
1154033942 18:10780120-10780142 GTGGATGTGGAGGCTGTTGAGGG - Intronic
1155503741 18:26512905-26512927 AGGGAGGTGGAGGCTGTAGTGGG + Intronic
1155709092 18:28853524-28853546 AGGGCCTTGGAGAGTGTGGAGGG + Intergenic
1155736960 18:29235909-29235931 AGGTATGTGGACACATTGGAGGG - Intergenic
1155902795 18:31411678-31411700 AGGGAAGTGGAGAATGATGAGGG - Intronic
1157525445 18:48376941-48376963 AGAAATATGGAGACTGTGGTGGG - Intronic
1157739584 18:50080573-50080595 AGGCTTCTGGTGACTGTGGATGG - Intronic
1158582815 18:58699828-58699850 TTGGAGGTGGGGACTGTGGATGG + Intronic
1159174431 18:64814868-64814890 AGGGAAGTGCAGACTGAAGATGG - Intergenic
1159817164 18:73089315-73089337 AAGGATGTGAAGAATTTGGATGG - Intergenic
1160190079 18:76708460-76708482 GGGGATGCGGAGAGTGTGGTGGG - Intergenic
1160486805 18:79300486-79300508 AGGGAGGTGCAGGCTGTTGAGGG + Intronic
1161292168 19:3500448-3500470 AGGGATTCGTTGACTGTGGATGG - Intronic
1161362158 19:3856545-3856567 AGGGATGGAGAGAATGTTGATGG - Intronic
1161726574 19:5932819-5932841 AGTCAAGTGGAGACTGTGGGAGG + Intronic
1163560021 19:18013604-18013626 AGCTATGTGGAGTCTGTGGGTGG + Exonic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163732286 19:18956012-18956034 AGGGAGGTTGAGAAGGTGGATGG + Intergenic
1164434876 19:28220459-28220481 AGGGATGGAGAGACTGGGGCTGG - Intergenic
1164995898 19:32720268-32720290 AGGGATGTGGAGGCTGGGATGGG - Intronic
1165858704 19:38895228-38895250 TGGGAGGTGGAGACTGAGGCTGG - Intronic
1166835292 19:45664061-45664083 AGGGGTGGGGAGGCTGTAGAGGG - Intergenic
1166840725 19:45695491-45695513 AGGGGTGTTGAGGCTGTGAAGGG - Exonic
1167088829 19:47329380-47329402 TGGGAGGTGGAGGCTGAGGAGGG - Intergenic
1167245893 19:48373112-48373134 AGGGAAGCGGAGACTCTGCAGGG + Intronic
1167403719 19:49290226-49290248 AGGGATGTGGAGGCTGTCATAGG + Exonic
1168051065 19:53830308-53830330 AGGGTAGTGGAGCCTGTGGTGGG - Intergenic
1168260817 19:55193355-55193377 TGGGAGGTGGAGGCTGTGGTGGG + Intronic
925199041 2:1951308-1951330 AGGGGTTTGGGGACTGGGGAGGG + Intronic
925880389 2:8347216-8347238 GGGCATGTGGTGGCTGTGGAAGG + Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
926004582 2:9363414-9363436 AGGGATGTGGAGAAAAGGGAAGG - Intronic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927458267 2:23276050-23276072 AGAGATGGAGAGACTGAGGAAGG - Intergenic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
928028816 2:27761626-27761648 AGGGAGGGAGAGCCTGTGGAGGG - Intergenic
928324660 2:30309926-30309948 AGGGATGTGAATACTATGGTGGG - Intronic
929015164 2:37486584-37486606 AGGGATGTGTTGAATGTGGTTGG - Intergenic
930366181 2:50442512-50442534 AGAAATGTGGAGAGTGAGGAGGG + Intronic
932089029 2:68788446-68788468 AGGGATGATCAGACTGGGGAAGG + Intronic
932128891 2:69169576-69169598 AGACATGTGGAAACTCTGGATGG - Intronic
932282982 2:70510629-70510651 AGGGATGTGGTGACTGAGGCTGG - Intronic
933215825 2:79629070-79629092 ACGGAAGTGGAGAGTGGGGAAGG - Intronic
934300710 2:91774568-91774590 AGGGATGTGGTGACAGAGGTTGG - Intergenic
934768624 2:96894461-96894483 GTGGATGTGGGGTCTGTGGAGGG - Intronic
934916616 2:98305461-98305483 AGTGATGTGAAGATTGGGGACGG + Intronic
935194317 2:100803066-100803088 TAGGAGGTGGAGACTTTGGAAGG - Intergenic
936014899 2:108950673-108950695 AGGGATGTGGAGAAGGCTGAGGG - Intronic
937005508 2:118509081-118509103 AGGGATGGGGATATTGGGGAGGG + Intergenic
937367358 2:121273324-121273346 AGGGATGAGGAGGGTGTGGAGGG - Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
940662988 2:156570831-156570853 AGGTAAGTGATGACTGTGGATGG + Intronic
941089553 2:161159283-161159305 AGGGATGTTGATAATGGGGAAGG + Intronic
943782775 2:191843483-191843505 AGACCTGTGGAGAATGTGGAGGG - Intronic
943957531 2:194211625-194211647 AGGGATCTGGGGACTGTGAAAGG - Intergenic
944009651 2:194958241-194958263 TGGGGTGTGGAGAGTGGGGAGGG + Intergenic
944883695 2:204041516-204041538 GGGGCTCTGGAGATTGTGGATGG + Intergenic
945309713 2:208296959-208296981 AGGGATGTGGAGTCAGGAGATGG + Intronic
946292967 2:218759564-218759586 AGGGAGGGGTAGACTGTAGAGGG + Intergenic
947310203 2:228793457-228793479 GTAGATGTGGAGACTGAGGAAGG + Intergenic
948740139 2:240041112-240041134 AGGGAGGTCCTGACTGTGGATGG + Intergenic
949060894 2:241956717-241956739 CGGGAGGTGGAGAGTGTCGAGGG + Intergenic
1168982643 20:2021116-2021138 AGGACTTTGGAGGCTGTGGAAGG - Intergenic
1169394923 20:5220599-5220621 GGAAAAGTGGAGACTGTGGAAGG - Intergenic
1171238741 20:23548339-23548361 AGGCAGGTGGAGGCTGAGGAGGG - Intergenic
1171242864 20:23585899-23585921 AGGCAGGTGGAGGCTGAGGAGGG + Intergenic
1171750537 20:29044523-29044545 AGGGAGGTTGTGCCTGTGGATGG + Intergenic
1172033417 20:31996486-31996508 AGGGCTGTGGAGACAGGGCAGGG - Exonic
1172789212 20:37490960-37490982 TGGGAGGTGGAGAGTGTAGAGGG - Intergenic
1173319281 20:41972909-41972931 AGGATTGTGGAGACAGAGGATGG + Intergenic
1173556090 20:43966857-43966879 AGTGATGTGGAGTCTCTGCAGGG + Intronic
1175069954 20:56324763-56324785 AGGTATGTGGGGGCAGTGGAGGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1176029226 20:63003283-63003305 AGAGATGTGCAGGCTGTGGGAGG - Intergenic
1176314679 21:5231424-5231446 AGGGAGGTTGTGCCTGTGGATGG - Intergenic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1179158810 21:38875145-38875167 AGGGATGTGGCAGCTCTGGAGGG - Intergenic
1179618811 21:42599058-42599080 AGCGATGTGGAGAGTGGGGATGG - Intergenic
1179660719 21:42873139-42873161 AGGGATTTGGGGTCTGTTGAGGG - Intronic
1179901195 21:44395690-44395712 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901207 21:44395729-44395751 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901220 21:44395768-44395790 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901232 21:44395807-44395829 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901245 21:44395846-44395868 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901257 21:44395885-44395907 AGGGGTGTGGAGACTGTGGAGGG + Intronic
1179901263 21:44395904-44395926 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901268 21:44395923-44395945 AGGGGTGTGGAAGCTGTGGAGGG + Intronic
1179901281 21:44395962-44395984 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901293 21:44396001-44396023 AGGGATGTGGAGGCTCTGGAGGG + Intronic
1179901302 21:44396030-44396052 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179901314 21:44396069-44396091 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901326 21:44396108-44396130 AGGGGTGTGGAGACTGTGGAGGG + Intronic
1179901332 21:44396127-44396149 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901338 21:44396146-44396168 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901344 21:44396165-44396187 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901350 21:44396184-44396206 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901356 21:44396203-44396225 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901386 21:44396292-44396314 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179901392 21:44396311-44396333 AGGGGTGTGGAGGATGTGGAGGG + Intronic
1179901430 21:44396430-44396452 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901444 21:44396469-44396491 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1179901453 21:44396507-44396529 AAGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901459 21:44396526-44396548 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901464 21:44396545-44396567 AGGGGTGTGGAGGCTGTGAAGGG + Intronic
1179901470 21:44396564-44396586 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901481 21:44396603-44396625 AGGGTTGTGGAGGCTGTGGAGGG + Intronic
1179901498 21:44396652-44396674 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901515 21:44396701-44396723 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901539 21:44396770-44396792 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901556 21:44396819-44396841 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901599 21:44396938-44396960 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179958929 21:44757597-44757619 AACCATGAGGAGACTGTGGAGGG + Intergenic
1179959259 21:44759084-44759106 AGGAAGGAGGAGACTGTGGCGGG - Intergenic
1180142916 21:45903161-45903183 AGGCATATGGAGACTGGGGAAGG + Intronic
1180816452 22:18792569-18792591 AGGGATGTGGTGACAGAGGTTGG + Intergenic
1181202639 22:21226901-21226923 AGGGATGTGGTGACAGAGGTTGG + Intronic
1181699064 22:24609704-24609726 AGGGATGTGGTGACAGAGGTTGG - Intronic
1182573488 22:31256806-31256828 AAGAATGTGGCCACTGTGGAAGG + Intronic
1182867274 22:33614651-33614673 TTGGATGGGGTGACTGTGGAAGG - Intronic
1183058751 22:35322617-35322639 TGGGAAGTGGAGAGTGGGGAGGG + Intronic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
1183980252 22:41535467-41535489 AGGGATGTGTAGCCTGCAGAGGG + Intronic
1184093757 22:42305690-42305712 AGGGGTGTGGAGACCAGGGAAGG - Intronic
1184345761 22:43911717-43911739 AGGGATGGGGAGACCAGGGAGGG - Intergenic
1184445397 22:44544222-44544244 TGGGGTGTGGGGACAGTGGAGGG - Intergenic
1184649721 22:45914023-45914045 TGGGGTGTGGAGGGTGTGGACGG - Intergenic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1185052472 22:48561068-48561090 AGGTGGGTGGGGACTGTGGATGG + Intronic
1185091608 22:48778704-48778726 ATGGGAGTGGAGACTCTGGAGGG + Intronic
1203224274 22_KI270731v1_random:68512-68534 AGGGATGTGGTGACAGAGGTTGG - Intergenic
1203266552 22_KI270734v1_random:18280-18302 AGGGATGTGGTGACAGAGGTTGG + Intergenic
950163237 3:10775308-10775330 AGAGAGGTGGAGAGTTTGGAGGG + Intergenic
950192377 3:10986620-10986642 AAGAATGTGGACACTGGGGAGGG - Intergenic
950364123 3:12471200-12471222 AGCGATGTGGATACAGTGGGTGG - Intergenic
950483787 3:13260968-13260990 AGAGGTGTGGGGACTGGGGATGG + Intergenic
950668847 3:14513292-14513314 ACGGATGGGGAAACAGTGGAGGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951462103 3:22962646-22962668 TAGGAGGTGGAGCCTGTGGAAGG + Intergenic
951598438 3:24343691-24343713 AAGGATTTGGAGATTGTGGTTGG - Intronic
952177365 3:30879578-30879600 AGGGGTGGAGAGACAGTGGATGG - Intronic
952346086 3:32487120-32487142 AGGTAGGTGGCGACTGTGAATGG + Intronic
952730247 3:36630957-36630979 GGGGATGTGGAGTCTGTGCCTGG - Intergenic
952943280 3:38459330-38459352 AGGGAGGCGGAGGCTGTGGGTGG + Intronic
953834150 3:46328646-46328668 ATGGAGGTGGAGAATATGGAAGG + Intergenic
954748719 3:52801947-52801969 AGAGATCTGGAGACAGAGGAGGG - Intronic
955071879 3:55578406-55578428 AAGGAGGTGCAGACTGTGGTAGG - Intronic
955227636 3:57074120-57074142 ATGGTTGTGGAGACTGTGTGAGG + Exonic
955433796 3:58877933-58877955 AGTGCTGTGGGGACTGGGGAGGG + Intronic
955521782 3:59782408-59782430 ATGGATGTAGAGGCTGTGGATGG - Intronic
955809970 3:62777395-62777417 AGGAATGTGGAGACCTTGGCTGG + Intronic
956012762 3:64849263-64849285 CGGGAGGTGGAGGTTGTGGAAGG - Intergenic
956177956 3:66491378-66491400 AGCTATGTGGAGAAAGTGGAAGG + Intronic
956410613 3:68974480-68974502 AGGGATGTGGAGTCTGGGGTGGG - Intergenic
956944171 3:74199992-74200014 AGGGAGGTGGAGGCTGTAGTGGG - Intergenic
957509304 3:81167256-81167278 AGGGATGTGAAGGGTGTGGTGGG - Intergenic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
958842773 3:99228219-99228241 AGGGAGTTGAACACTGTGGAAGG + Intergenic
958915506 3:100045902-100045924 AGGGATGAGGTCACTGGGGAAGG + Intronic
959399397 3:105881345-105881367 ACAGGTGTGGAGACTGTGGTAGG + Intergenic
960147398 3:114217956-114217978 AGGGATTCTGAGAGTGTGGAAGG + Intergenic
960694386 3:120381813-120381835 AGAAAGGTGGAGACTGTGGTAGG + Intergenic
961104269 3:124227904-124227926 TGGGATTGGGAGACTGAGGATGG + Intronic
961442940 3:126963455-126963477 AGGGATGGAGAGACTGTGCAAGG + Intergenic
961451222 3:127003171-127003193 GGGGATGTGGAGAGTGAGTATGG + Intronic
961456026 3:127024427-127024449 AGGGATGTGTGGGCAGTGGAGGG + Intronic
961478803 3:127166297-127166319 AGGGTTGAGGACAGTGTGGATGG + Intergenic
961511560 3:127406870-127406892 AGGCATGTGAAGAGTGGGGAGGG + Intergenic
961684278 3:128618509-128618531 AGGGATTAGGAGATTGTGCAGGG - Intergenic
961767715 3:129224830-129224852 AGGAATGCTGAGACTGTTGAGGG + Intergenic
964004487 3:151811668-151811690 AGGGATGAGGAGAGGGCGGAGGG - Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965640727 3:170826169-170826191 AAGGAAGTGGAGAATGTGGGAGG + Intronic
966766075 3:183463820-183463842 TGGGATGTGAAGACTTTGGGAGG - Intergenic
967489814 3:190077404-190077426 AGGGAGGTGGAGACCTAGGAAGG - Intronic
967807320 3:193727464-193727486 AGGGATGTGGAGACTTCAGCAGG - Intergenic
967852708 3:194094077-194094099 AGGGATGAGCTGACTGTGGGAGG - Intergenic
968912441 4:3483104-3483126 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912454 4:3483148-3483170 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912467 4:3483192-3483214 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912480 4:3483236-3483258 AGGGGTGTGGAGGGTGGGGACGG + Intronic
969710288 4:8839349-8839371 AGAGACGTGGACAATGTGGAGGG - Intergenic
970506066 4:16731761-16731783 AGGGATGTGGAGACTAAAGCAGG - Intronic
970651230 4:18180390-18180412 TGGGAAGTGGAGTCTTTGGAAGG - Intergenic
970685922 4:18567201-18567223 AGGTATGTGGACACTGGAGAGGG + Intergenic
970858581 4:20676284-20676306 TGGGAGGTGGAGACTTTGGGAGG - Intergenic
971504574 4:27352240-27352262 AGGGATTTGTAGACTGTGGGAGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
973242396 4:47970576-47970598 AGGGAAGTGGAGGTTGTGGTGGG + Intronic
974446496 4:61990367-61990389 AAGATTGGGGAGACTGTGGATGG + Intronic
977003830 4:91540164-91540186 TGGGATGTAGAGAGTGGGGAAGG - Intronic
977959930 4:103074137-103074159 AGGGAAGTTGGGATTGTGGATGG + Intronic
978686157 4:111446012-111446034 AGGGATGTTGATAATGTGGGAGG + Intergenic
979422534 4:120522996-120523018 GGGGTTGAGGAGAGTGTGGATGG + Intergenic
980123372 4:128750322-128750344 AGAGTTGTGGAGTCTATGGATGG + Intergenic
981054813 4:140349849-140349871 AGTGATGTGGCCACTGTGGAGGG - Intronic
982118879 4:152120151-152120173 TGGGAGGTGGAGACTGTGAGAGG + Intergenic
982255144 4:153444228-153444250 AGGGATGTTGAGGCTGGGCAAGG - Intergenic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983239739 4:165218504-165218526 AGAAATGTGGGGACGGTGGAGGG - Intronic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
984758264 4:183343204-183343226 AGTGGTGGGGAGAGTGTGGAGGG - Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
984929614 4:184835134-184835156 AGGGATGTTGAAACTGTGAGTGG + Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
985836884 5:2278100-2278122 AGGTCTGTGGAGAGTATGGATGG + Intergenic
986570261 5:9157133-9157155 AGGGAAGGGGGAACTGTGGAGGG - Intronic
986587885 5:9337391-9337413 AGAGATGTGGAAACTGAGGAAGG - Intronic
986798792 5:11239063-11239085 AGGAGTGTGGAGACACTGGATGG + Intronic
987546111 5:19312131-19312153 ATAGAAGTGAAGACTGTGGAAGG - Intergenic
989717890 5:44486044-44486066 AGGGAGGTGAAATCTGTGGAGGG + Intergenic
989813779 5:45710828-45710850 CGGGATGGGGGGTCTGTGGAGGG + Intergenic
989814591 5:45720973-45720995 AGTGATGTGGAGGCCGGGGAAGG + Intergenic
990008175 5:50966418-50966440 AGGGGAGTGGAAACTGGGGAAGG + Intergenic
990203656 5:53406023-53406045 ATAGATGTGGAGCCTTTGGAGGG + Intergenic
990283931 5:54280801-54280823 GGGGATTTGGAGACTCTAGATGG - Intronic
990536339 5:56726904-56726926 AGAGATGAGGAGACTGAGGCTGG + Intergenic
990763102 5:59152312-59152334 AGAGATGTTCAGACAGTGGAAGG + Intronic
991022116 5:61990277-61990299 AGGACTGTGGAGGCTGTGGAAGG - Intergenic
991309796 5:65224982-65225004 ATAGATGTCGAGTCTGTGGAGGG - Exonic
992134646 5:73731966-73731988 GGGGATGTGGATACTGGGGGAGG - Intronic
992266882 5:75028048-75028070 AGGGTTGAGGAGACTGTTGGGGG - Exonic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
994224270 5:97234398-97234420 TGGGATGGGGAGATTGGGGAGGG - Intergenic
996374080 5:122785031-122785053 ATGTTTGTGGAGTCTGTGGATGG + Intronic
996571900 5:124940646-124940668 AGGGAGCTGGAGAGTGTTGATGG + Intergenic
999178668 5:149652827-149652849 AGGGATGTGGACACGCTTGATGG - Intergenic
999287000 5:150400083-150400105 GGGCATGTGGGGTCTGTGGAAGG - Exonic
1000978550 5:167791936-167791958 AGGGATGATGAGAGAGTGGATGG - Intronic
1001170631 5:169416056-169416078 GGCGAGGTGGAGCCTGTGGAAGG - Intergenic
1001207594 5:169779002-169779024 AGGGATGTTGATAGTGGGGAAGG + Intronic
1001570153 5:172725539-172725561 TGGGACGTGGAGACTTTTGATGG + Intergenic
1001759699 5:174197221-174197243 AGGCAGGTAGAGGCTGTGGAGGG + Intronic
1001944852 5:175770493-175770515 AGAGAAGCAGAGACTGTGGAGGG - Intergenic
1002450465 5:179315555-179315577 CCGGAGGTGGAGACTGTGGCTGG - Intronic
1002535725 5:179874379-179874401 TGGGATGTGGGGACTAAGGAGGG + Intronic
1002669128 5:180850967-180850989 ATGAATGTGATGACTGTGGAGGG - Exonic
1002997293 6:2298836-2298858 AGGCATGTGGACACTCTGAAGGG + Intergenic
1003060315 6:2857716-2857738 AGGGGTGTGGGGACCGTGGCTGG - Intergenic
1003471930 6:6444514-6444536 AAGGATGTGGAGAAATTGGAAGG + Intergenic
1003708784 6:8565616-8565638 AGGCAGGTGGAGATTGAGGAGGG + Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1003937899 6:10994657-10994679 GGGGAAGTGGTGACTGTGGAAGG + Intronic
1004017066 6:11741811-11741833 AGGGATTTGGATACTTTAGAGGG - Intronic
1005677691 6:28172399-28172421 ATGGATGTGGAACCTGTGGATGG - Intergenic
1006392328 6:33765852-33765874 ATGGATGTGAAGACTCCGGAAGG - Intergenic
1006824910 6:36927841-36927863 GGGGATGTGGAGACTGGGGGTGG - Intronic
1007976549 6:46107407-46107429 AGGGATGTGAAGACTATGCCTGG - Intergenic
1008053846 6:46926595-46926617 TGGAATGTGAAGGCTGTGGACGG - Intronic
1010435584 6:75826370-75826392 AGGTAGGTGGTGAGTGTGGAAGG + Intronic
1012320906 6:97844390-97844412 AGGGATGTTGATAATGGGGAAGG - Intergenic
1012345389 6:98179370-98179392 AGGGAGGTAGAGACTGTGATGGG + Intergenic
1013744408 6:113327859-113327881 AGGTAAATGGAGACTTTGGATGG + Intergenic
1015465688 6:133545998-133546020 GGGACTTTGGAGACTGTGGAGGG + Intergenic
1015543795 6:134342253-134342275 GGGGATGTGGAGAGTGTGCCAGG + Intergenic
1016527095 6:145014156-145014178 AGAGAGGTGGAAACTATGGAGGG + Intergenic
1016941830 6:149488752-149488774 AGAGATGCTGAGACGGTGGATGG + Intergenic
1018053332 6:160030444-160030466 TGGGATATGGAGACAGTGCAGGG + Intronic
1018488574 6:164268677-164268699 AGTGATGTGGAAACTGTGTGGGG + Intergenic
1018787184 6:167117191-167117213 AGGGATGCGGGGACGGTGGTGGG - Intergenic
1018826924 6:167415484-167415506 AGGGTTGGGGAGCCTGTGGTGGG + Intergenic
1019636496 7:2078831-2078853 GGGGATGTGGGGACTGGGGCCGG - Intronic
1019704887 7:2492851-2492873 AGAGTTATGGGGACTGTGGAGGG + Intergenic
1019706739 7:2500411-2500433 GGGGATGTGGGGACAGTGGCGGG - Intergenic
1020104378 7:5415061-5415083 AGGAATGAGGAGGCAGTGGAGGG - Intronic
1020380809 7:7544003-7544025 GCGGATGTGGAAACTGTGTAAGG - Intergenic
1020406799 7:7844732-7844754 AGGGATGAGAAACCTGTGGATGG - Intronic
1021231725 7:18093214-18093236 AGGTGTGTGGAGACTTTGAAAGG + Intronic
1021325868 7:19266964-19266986 AGGGGTGTGGAATCTGTGGGTGG - Intergenic
1022031380 7:26494190-26494212 AGGGAAGTGGAGCAGGTGGATGG - Intergenic
1022355644 7:29612062-29612084 AGAGATGGGGAAAATGTGGAGGG + Intergenic
1022605700 7:31811783-31811805 AGGGATGGGGAGGCTGTGGGAGG + Intronic
1022659098 7:32349391-32349413 AGGGACTGGGAGAGTGTGGAGGG + Intergenic
1024517367 7:50270307-50270329 TGGGCTATGGAGACTGTGGTGGG + Intergenic
1024729467 7:52238358-52238380 AGGGAGCTGGAGACTGTGCTGGG + Intergenic
1026361126 7:69601002-69601024 AGGGAGGGGGAGACTGTCCAGGG + Intronic
1026844617 7:73691398-73691420 AAGGATGTGGGCACTTTGGAAGG - Intronic
1027348275 7:77284362-77284384 TGGGATGAGGAGGCTGTGGAGGG - Intronic
1028798762 7:94936629-94936651 AAGTATGGGGAGACTGTGTAGGG + Intronic
1028873850 7:95799020-95799042 AGAAATGTGGATACTGAGGAGGG - Intronic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1029745280 7:102512843-102512865 AGGGAGGGGGAGACTGAGGGAGG + Intronic
1030319083 7:108145534-108145556 AGGTAGGTGGAGACTGGGGCGGG + Intergenic
1031175347 7:118341742-118341764 AAGGATGTGGAGAATTGGGAAGG + Intergenic
1031947120 7:127853850-127853872 AGGGAAGTGGAGATTCTGGCTGG + Intronic
1032483255 7:132263300-132263322 AGGGTGGTGGTGAGTGTGGATGG - Intronic
1034936882 7:155205576-155205598 AGGGAGGTGGAGACACTGGCTGG + Intergenic
1035211567 7:157332437-157332459 AGGAGCGTGGAGAATGTGGATGG - Intergenic
1036936307 8:13005311-13005333 AGGGAAGTGGAGATTGTTAATGG + Intronic
1037151304 8:15638213-15638235 AGGAAGGTGGAGACTGTACAGGG - Intronic
1037687526 8:21155877-21155899 GGGGATGTTGATAGTGTGGAAGG + Intergenic
1037900150 8:22683436-22683458 AGGCATCTGGACAATGTGGAGGG + Intergenic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1038707169 8:29905393-29905415 ATGAATGAGGTGACTGTGGAGGG - Intergenic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1039568266 8:38566111-38566133 AGGGCTCTGGCGACTGTGGAAGG + Intergenic
1042227219 8:66523227-66523249 TGAGAGGTGGAGACTGGGGAAGG + Intergenic
1042612477 8:70614184-70614206 AAGGATGTGGAGGATGTGCAAGG + Intronic
1043461534 8:80465230-80465252 AGGGATGTGGAGAAAGTGGAAGG + Intergenic
1044407906 8:91851295-91851317 AGGCATTTGGAGACAGTGCAGGG + Intergenic
1044656499 8:94553769-94553791 GGGGTTTTGGAGACGGTGGATGG + Intergenic
1044694168 8:94906196-94906218 AGGGCAGGGCAGACTGTGGAGGG - Intronic
1045266554 8:100623489-100623511 AGGGAGGAGGAGAGTGTGGCTGG - Intronic
1045361930 8:101440971-101440993 AGGGATGGGGAGAGTCTAGAGGG - Intergenic
1046116628 8:109792340-109792362 AGGGATTTGGTGACTATGTATGG + Intergenic
1047489494 8:125362944-125362966 AGGGAAGTGGAGAGTGAGGTGGG - Intronic
1047703566 8:127474222-127474244 GGAGATGTGGGGAATGTGGATGG - Intergenic
1048296417 8:133217880-133217902 CTGCATGTGGAGACTTTGGAGGG - Intronic
1048327327 8:133449789-133449811 AGGGGTGTGGGGACAGGGGACGG - Intergenic
1048340892 8:133537657-133537679 AGGGATGTGCAAGCTGTAGAGGG - Intronic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048880789 8:138870997-138871019 AGGGATGTGGGGACAGAGGTGGG + Intronic
1048990773 8:139758925-139758947 AGCCAGGTGGAGACTGTGGAAGG + Intronic
1049055200 8:140230902-140230924 AGAGAAGTGGAAACTGTGGCTGG + Intronic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1049346141 8:142139828-142139850 TGGGGAGTGGAGACTGAGGAGGG - Intergenic
1049399566 8:142418877-142418899 ATGGATGGGGAGACTGAGGCTGG + Intergenic
1049849241 8:144821881-144821903 AGGGGCGTGGAGCCCGTGGACGG - Intergenic
1050656633 9:7835867-7835889 GGGGATGTGGAGAAAGGGGAGGG - Intronic
1051733720 9:20175979-20176001 AAGGATGTGGAGGATTTGGAAGG + Intergenic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1053056024 9:34993521-34993543 GGGGAACTGGAGGCTGTGGAGGG + Intronic
1056473109 9:86925059-86925081 GGGGAAGTGGAGACAATGGAAGG + Intergenic
1060526491 9:124324013-124324035 AGAGAGGTGGGGACTGTGGGAGG - Intronic
1060733235 9:126050782-126050804 AGGGGTGTGGAGATGGAGGACGG + Intergenic
1060970090 9:127732836-127732858 ATGGATGTGGACACCATGGAGGG - Intronic
1061091511 9:128429011-128429033 AGGGTGGTGGACGCTGTGGATGG + Exonic
1061092906 9:128436703-128436725 AGGGATGCGGAGACAGCTGAAGG - Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1061170159 9:128947832-128947854 CGGGATGTGGCGACAGTGGCAGG + Intronic
1061329146 9:129881322-129881344 AGGGATGTGGGGGCTGTGCAGGG + Exonic
1061377859 9:130236712-130236734 GGGAATGTGCAGACTGGGGAGGG - Exonic
1061699082 9:132401707-132401729 AGTGAGGTTGGGACTGTGGAAGG - Exonic
1061772346 9:132935666-132935688 AGGACTGTGGGGACTGTGGCAGG - Intronic
1062003281 9:134227342-134227364 TGGGTGGTGGAGCCTGTGGATGG + Intergenic
1062024277 9:134333107-134333129 AGGGATGCTGAGACCATGGAGGG + Intronic
1062315328 9:135964362-135964384 AGGGATGGGGTGGCTGGGGAGGG + Intergenic
1062444263 9:136587129-136587151 TTGGATGGGGAGACTGAGGAGGG - Intergenic
1062551626 9:137090073-137090095 GGGGGAGTGGAGACTGGGGATGG + Intronic
1203490551 Un_GL000224v1:100867-100889 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1203503174 Un_KI270741v1:42746-42768 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1186644019 X:11486941-11486963 AGGGATGTGGAGGCTGGTGGTGG + Intronic
1186851121 X:13581097-13581119 AGTTATGTGGAGATTGGGGATGG - Intronic
1188913443 X:35879711-35879733 AGGGATCAGAAGACTGGGGATGG - Intergenic
1189045049 X:37581922-37581944 TGGGATGTGGGGACGGGGGAGGG - Intronic
1190046735 X:47117483-47117505 AGCTATTTGGAGACTGAGGAAGG + Intergenic
1190447189 X:50537996-50538018 AGGGGTGTGGAGATGGGGGATGG - Intergenic
1191929352 X:66351944-66351966 TGGGATGGGGAGAGTGGGGAGGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1196286197 X:113883153-113883175 AGGGATCTGTAGACCCTGGAAGG + Intergenic
1196646287 X:118120764-118120786 GTGGATGTGGAGACTGTTGGTGG - Intergenic
1196937533 X:120744468-120744490 AGGGAGGTGGAGATTGTTAATGG - Intergenic
1196940516 X:120771398-120771420 AGGGAAGTGAGGACTGAGGAAGG - Intergenic
1198485853 X:137086913-137086935 AGGGATGTGGCTGCTGGGGAGGG + Intergenic
1198538347 X:137609032-137609054 AGGGAAGTGGAGATTGTTAATGG + Intergenic
1199023264 X:142907823-142907845 AGAGGTGAGGAGGCTGTGGAAGG + Intergenic
1199316572 X:146385514-146385536 AGGGATGTAGAGACGGAAGAAGG + Intergenic
1200163088 X:154019205-154019227 AGGAAGGTGGAGGCTGAGGATGG + Exonic
1201273920 Y:12281570-12281592 GGGGATGTGGATACTGGGGGAGG + Intergenic