ID: 1179903626

View in Genome Browser
Species Human (GRCh38)
Location 21:44407969-44407991
Sequence CTTTTTCCCGAGAGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179903623_1179903626 2 Left 1179903623 21:44407944-44407966 CCTAGAGGGAGTCTCGCTCTGTT 0: 1
1: 67
2: 505
3: 1344
4: 1739
Right 1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG 0: 1
1: 0
2: 2
3: 38
4: 370
1179903621_1179903626 4 Left 1179903621 21:44407942-44407964 CCCCTAGAGGGAGTCTCGCTCTG 0: 1
1: 6
2: 99
3: 530
4: 1170
Right 1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG 0: 1
1: 0
2: 2
3: 38
4: 370
1179903622_1179903626 3 Left 1179903622 21:44407943-44407965 CCCTAGAGGGAGTCTCGCTCTGT 0: 1
1: 13
2: 296
3: 1299
4: 1925
Right 1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG 0: 1
1: 0
2: 2
3: 38
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179903626 Original CRISPR CTTTTTCCCGAGAGGGAGTC AGG Intronic
900172250 1:1274647-1274669 GTTGTTCCTGAGAGGCAGTCAGG - Intergenic
901673608 1:10869869-10869891 CTTTTTCTTGAGAGGGGGTTAGG + Intergenic
901965971 1:12866662-12866684 CTTATTCAGGAGAGCGAGTCAGG + Intronic
901981365 1:13037042-13037064 CTTATTCAGGAGAGCGAGTCAGG + Intronic
902000720 1:13191887-13191909 CTTATTCAGGAGAGCGAGTCAGG - Intergenic
902019950 1:13337591-13337613 CTTATTCAGGAGAGCGAGTCAGG - Intergenic
902162354 1:14541467-14541489 CATTTTCCAGAGAGGCAGTGTGG + Intergenic
903888707 1:26555838-26555860 CCTTGTCCCCAGAGGGAGTAGGG - Intronic
903901589 1:26650110-26650132 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
904517753 1:31069882-31069904 TTTTTCCTTGAGAGGGAGTCTGG - Intergenic
904534477 1:31190158-31190180 CTTTTTCCAGGCAGGGAGGCAGG + Intronic
904707811 1:32404655-32404677 TTTTTTCCCAAAAGGGAGACTGG + Intergenic
905241638 1:36585438-36585460 CTTTTTCCTGAGCTGGAATCGGG + Intergenic
906514035 1:46428406-46428428 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
908250552 1:62262164-62262186 CATTTTCCCTAGAGGCAGTACGG + Intronic
908449072 1:64233017-64233039 TTTTTTTTCGAGATGGAGTCTGG + Intronic
909018370 1:70404343-70404365 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
910567963 1:88666724-88666746 TTTTTTCTTGAGACGGAGTCTGG - Intergenic
911809215 1:102252650-102252672 TTTTTTCCCAAGACGGAATCTGG - Intergenic
912352297 1:109025720-109025742 TCTTTTTCCGAGATGGAGTCTGG - Intronic
912458954 1:109818582-109818604 CTCTTTTCCCAGAGGGGGTCAGG + Intergenic
912818270 1:112847601-112847623 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
912834053 1:112979811-112979833 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
913273872 1:117119594-117119616 TTTTTTTCTGAGATGGAGTCTGG - Intronic
914420924 1:147527724-147527746 CTTATTCCCGAGAGGCAGCCTGG - Intergenic
914753434 1:150550360-150550382 ACTTTTCCAGAGAGGGAGCCAGG + Intronic
914822433 1:151114998-151115020 TTTTTTCTTGAGACGGAGTCTGG - Intronic
915155289 1:153870559-153870581 CTTTTTTTTGAGACGGAGTCTGG - Intronic
915294362 1:154909748-154909770 CTTTTTTTTGAGAGGGGGTCTGG - Intergenic
915493083 1:156262462-156262484 TTTTTTTCTGAGATGGAGTCTGG - Intronic
915582941 1:156826310-156826332 TTTTTTTCTGAGATGGAGTCTGG + Intronic
920149155 1:203890317-203890339 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
921023571 1:211258706-211258728 CCAGTTCCCGAGAGAGAGTCTGG - Intronic
921458010 1:215395117-215395139 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
922275914 1:224078247-224078269 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
922340153 1:224648397-224648419 TTTTTTCCTGAGACAGAGTCTGG - Intronic
922771476 1:228186247-228186269 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
923083158 1:230679461-230679483 CTTTTCCCCTAGAGGGAATGGGG + Intronic
923676148 1:236082240-236082262 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
923812220 1:237331512-237331534 CTTTTTTTTGAGATGGAGTCTGG + Intronic
924363740 1:243267589-243267611 TTTTTTCTTGAGAGGGAGTTTGG - Intronic
1063482436 10:6387739-6387761 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1064048462 10:12040407-12040429 GTTTTTCTTGAGACGGAGTCTGG - Intronic
1065200325 10:23306515-23306537 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1065587856 10:27237963-27237985 ATTTTTTCGGAGACGGAGTCTGG + Intronic
1065950674 10:30647856-30647878 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066003131 10:31123138-31123160 TTTTTTCCCGAGATGGAGTCTGG - Intergenic
1066631807 10:37465609-37465631 CTATTTTCTGAGATGGAGTCTGG - Intergenic
1067139405 10:43644091-43644113 CTTCACCCAGAGAGGGAGTCTGG - Exonic
1069321129 10:67172961-67172983 TTTTTTCCTGAGATGGGGTCTGG - Intronic
1069687723 10:70329571-70329593 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1070038527 10:72751849-72751871 TTTTTTCCTGAGACAGAGTCTGG + Intronic
1071573550 10:86710824-86710846 CTTTTGCCCGAGACAGAGGCCGG + Intronic
1072096717 10:92188706-92188728 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG + Intronic
1072452986 10:95554061-95554083 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
1072558314 10:96543344-96543366 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1072682824 10:97518773-97518795 TTGTTTCCCGAGAGGAATTCAGG - Intronic
1073414971 10:103373182-103373204 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1074724287 10:116291579-116291601 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075395745 10:122125786-122125808 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
1075416250 10:122266728-122266750 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075925639 10:126249680-126249702 CTTTTTTTTGAGACGGAGTCTGG - Intronic
1078234576 11:9472262-9472284 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1078373211 11:10769208-10769230 TTTTTTCCCGAGACAGAGTCTGG - Intronic
1081798660 11:45841199-45841221 ATTTTTACGGAGACGGAGTCTGG - Intergenic
1081892853 11:46558535-46558557 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1083791841 11:64990800-64990822 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1084113950 11:67031050-67031072 CTTTTTCCCAAAAGTGAGCCAGG + Intronic
1084281270 11:68096026-68096048 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1084728297 11:71056474-71056496 CTTTTACCTGAAATGGAGTCTGG + Intronic
1084774302 11:71365168-71365190 CCTTTTCCAGAGAGGAAGGCTGG - Intergenic
1084989204 11:72907614-72907636 TTTTTTCTTGAGACGGAGTCTGG + Intronic
1085421618 11:76366667-76366689 TTTTTTTCCGAGACGGAGTCTGG - Intronic
1085567415 11:77526958-77526980 CTTTTTCTGGAGAGTGAGACTGG + Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1087563977 11:99830061-99830083 ATTTTTGCAGAGAGGCAGTCTGG + Intronic
1090815253 11:130288360-130288382 TTTTTTCCCGAGACAGAGTCTGG - Intronic
1091570805 12:1683771-1683793 CTTTTTTCTGAGACAGAGTCTGG + Intergenic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1092459640 12:8674873-8674895 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
1092740869 12:11628202-11628224 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093546228 12:20352471-20352493 CTTTTTTTCGAGATGGAGTCTGG + Intergenic
1096228480 12:49884210-49884232 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1097381286 12:58898669-58898691 TTTTTTCTTGAGACGGAGTCTGG + Intronic
1098042326 12:66364876-66364898 CTTTTTCCAGAGAGGGTCTGTGG - Intronic
1099623181 12:85030526-85030548 CTTCTTCCCCACAGAGAGTCAGG + Intronic
1100258489 12:92908833-92908855 TTTTTTCCTGAGACAGAGTCTGG + Intronic
1100264189 12:92959997-92960019 TTTTTTCCTGAGACTGAGTCTGG - Intergenic
1100622985 12:96298273-96298295 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1100985972 12:100201941-100201963 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1101507380 12:105359757-105359779 TTTTTTCTGGAGAAGGAGTCTGG - Intronic
1102180519 12:110909249-110909271 TTTTTTTCCGAGACGGAGTTTGG + Intergenic
1102503337 12:113368066-113368088 TTTTTTCCTGAGACAGAGTCTGG - Intronic
1102728395 12:115086610-115086632 TTTTTTTTCGAGACGGAGTCTGG + Intergenic
1102774180 12:115504705-115504727 CTGTCTCCCCAGAGGAAGTCAGG - Intergenic
1104773592 12:131379792-131379814 GTGTTTCCCGAGATGCAGTCTGG - Intergenic
1105601661 13:21893261-21893283 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105909736 13:24852148-24852170 TTTTTTTCTGAGACGGAGTCTGG + Intronic
1105970692 13:25426932-25426954 TTATTTTCCTAGAGGGAGTCTGG - Intronic
1106866326 13:33968137-33968159 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1108340499 13:49495085-49495107 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
1108394988 13:49983190-49983212 ATTTTTTCTGAGATGGAGTCCGG - Intergenic
1108677872 13:52753103-52753125 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1110210630 13:72968170-72968192 CTTTTTTTGGAGACGGAGTCTGG - Intronic
1111263235 13:85771773-85771795 TTTTTTCCTAAGAGGCAGTCTGG - Intergenic
1112912446 13:104504032-104504054 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1115834012 14:37377105-37377127 CTTCTACCCGGGAAGGAGTCAGG + Intronic
1116660693 14:47706747-47706769 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1117011102 14:51471487-51471509 TTTTTTTTCGAGACGGAGTCTGG - Intergenic
1119241402 14:73063159-73063181 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1119994857 14:79242053-79242075 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1121001938 14:90457240-90457262 TTTTTTCCTGAGAGGAAATCTGG - Intergenic
1121045456 14:90784543-90784565 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1122415548 14:101547975-101547997 CTTTTCCCTGAGAGGGAGCCAGG - Intergenic
1123416444 15:20099124-20099146 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1123501011 15:20880323-20880345 CTTTATCCCAGGAGAGAGTCAGG - Intergenic
1123525782 15:21106229-21106251 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1123558263 15:21454037-21454059 CTTTATCCCAGGAGAGAGTCAGG - Intergenic
1123594493 15:21891303-21891325 CTTTATCCCAGGAGAGAGTCAGG - Intergenic
1124634092 15:31353900-31353922 CTTTTTCCCCAGAAGCAGCCTGG - Intronic
1124816619 15:33000435-33000457 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1126892688 15:53223068-53223090 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1126917775 15:53484609-53484631 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
1127448939 15:59097866-59097888 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1128000378 15:64185848-64185870 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1128956109 15:71947267-71947289 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129586545 15:76873237-76873259 CTTTTTCGGGAGATGGAGTCTGG - Intronic
1130000777 15:80044883-80044905 TTTTTTTTCGAGACGGAGTCTGG + Intergenic
1130726519 15:86444818-86444840 CTTTTTCCCAAGATGGAATGTGG - Intronic
1131140908 15:89976474-89976496 CCTTTTCCCGAGAGAGCGTAAGG - Intergenic
1132120722 15:99173054-99173076 CTTTTTGCCTAGAGGGATTCTGG - Intronic
1202966612 15_KI270727v1_random:181176-181198 CTTTATCCCAGGAGAGAGTCAGG - Intergenic
1133059038 16:3162377-3162399 GTTTTTTCTGAGATGGAGTCTGG + Intergenic
1134230273 16:12423580-12423602 CTTCTTCTCGAGATGGAGTCTGG + Intronic
1135019822 16:18954203-18954225 TTTTTTCCCCCGAGAGAGTCTGG + Intergenic
1135346824 16:21695904-21695926 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1135730210 16:24888806-24888828 TTTTTTTCTGAGACGGAGTCTGG + Intronic
1136557546 16:31016685-31016707 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1137464940 16:48699234-48699256 CTTTTTCCAGACAGGGTATCTGG + Intergenic
1138049410 16:53760636-53760658 TTTTTTCCTGAGACTGAGTCTGG + Intronic
1140379434 16:74473223-74473245 CTTTTTATTGAGACGGAGTCTGG + Intronic
1140529498 16:75651675-75651697 TTTCTTTCCGAGATGGAGTCTGG - Intronic
1141088601 16:81114506-81114528 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
1142391012 16:89799980-89800002 CTTTTTTCCGAGACGGAGTCTGG - Intronic
1142748300 17:1971948-1971970 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1142770635 17:2094259-2094281 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1143197041 17:5083876-5083898 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1143390238 17:6555888-6555910 CTCCTTCCCGAGAAGGAATCTGG + Intronic
1143828355 17:9630972-9630994 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1145286380 17:21509069-21509091 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
1146729540 17:35182099-35182121 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1146853192 17:36240993-36241015 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1146869100 17:36364874-36364896 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1147071974 17:37965509-37965531 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1147083501 17:38045035-38045057 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1147099446 17:38169006-38169028 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1149156910 17:53642013-53642035 CTTTTTCCAGACAGGCAGTTTGG + Intergenic
1150082461 17:62252302-62252324 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1151519984 17:74621029-74621051 TTTTTTTTCGAGAGGGAGTCTGG - Intronic
1151605712 17:75134119-75134141 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1151824601 17:76517127-76517149 TTTTTTCCTGAGACAGAGTCTGG - Intergenic
1153331751 18:3880929-3880951 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1153713134 18:7819936-7819958 CTTTTCCCCAAGAGGCAGCCAGG + Intronic
1154066073 18:11108600-11108622 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1154253173 18:12761114-12761136 TTTTTTTCCGAGACGGAGTCTGG - Intergenic
1156546674 18:37970327-37970349 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1156546960 18:37973236-37973258 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
1156949696 18:42880234-42880256 GTATTTCCAGAGATGGAGTCAGG - Intronic
1157424828 18:47576022-47576044 TTTTTTTCCGGGAGGGAGGCAGG + Intergenic
1160751790 19:737858-737880 GCTTTTCCCGGGAGGGAGGCAGG + Intronic
1161239762 19:3215776-3215798 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
1161417982 19:4158483-4158505 CTTTTTTTCGAGACAGAGTCTGG - Intronic
1161424298 19:4194172-4194194 TTTTGTTCCGAGATGGAGTCTGG + Intronic
1161535165 19:4814670-4814692 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1161699254 19:5785959-5785981 GTTTTTTCTGAGACGGAGTCTGG + Intronic
1162094643 19:8303126-8303148 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1162406813 19:10479683-10479705 CTTCTTCCCGAGAAGGGGCCTGG + Intergenic
1162513434 19:11133875-11133897 TTTTTTCCTGAGATGGAGCCTGG + Intronic
1162604948 19:11699426-11699448 CTTTTTTTCGAGACAGAGTCTGG - Intergenic
1163318014 19:16554806-16554828 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1163567040 19:18058134-18058156 CTTTTTTCTGAGACGGAGTTTGG - Intergenic
1163956616 19:20648386-20648408 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1164070611 19:21764626-21764648 TTTTTTCCCCACACGGAGTCTGG - Intronic
1164991820 19:32690192-32690214 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1165021148 19:32925499-32925521 TTTTTTTTCGAGACGGAGTCTGG + Intronic
1166089777 19:40501225-40501247 TTTTTTCAAGAGATGGAGTCTGG - Intronic
1166403903 19:42505445-42505467 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1166785768 19:45365777-45365799 TTTTTTTTTGAGAGGGAGTCTGG - Intronic
1166964957 19:46523874-46523896 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1167076316 19:47251834-47251856 TTTTTTCTTGAGACGGAGTCTGG + Intergenic
1167353082 19:48987810-48987832 TTTTTTCTTGAGACGGAGTCTGG + Intronic
1167968429 19:53168042-53168064 TTTTTTTTTGAGAGGGAGTCAGG - Intronic
1168483086 19:56737802-56737824 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1168607556 19:57771834-57771856 TTTTTTCCCAAGATGGAGTCTGG + Intronic
925838177 2:7965785-7965807 TTTTTTCCTGAGAAGGAGTCTGG - Intergenic
926244292 2:11111823-11111845 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
927126724 2:20019068-20019090 CTTCTTCCCTAGAAGGAGCCTGG - Intergenic
927487985 2:23502405-23502427 GGTTCTCCCGGGAGGGAGTCGGG + Intronic
929652927 2:43700216-43700238 CCTTTTCCAGAGAGTGAGTTAGG - Exonic
931658915 2:64538292-64538314 CTTTTTCCTGAGAGGTAGAAAGG - Intronic
931758219 2:65393341-65393363 CTTTTTTTTGAGATGGAGTCTGG + Intronic
932193296 2:69759842-69759864 CTTTTTTTTGAGACGGAGTCTGG + Intronic
932234455 2:70109765-70109787 GTTTTTTTTGAGAGGGAGTCTGG - Intergenic
932905536 2:75746083-75746105 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
934932855 2:98442453-98442475 CTTTTTCCCAAGAGGGTTTTGGG + Intergenic
937102650 2:119283484-119283506 TTTTTTCTTGAGAGGGAGTCTGG + Intergenic
938340458 2:130532644-130532666 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
938349372 2:130588091-130588113 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
939339256 2:140872248-140872270 GTTTTCCCCGAAAGGGAGCCTGG - Intronic
940039468 2:149345102-149345124 CTTTTTTCAGAGATGGGGTCGGG - Intronic
943189558 2:184658459-184658481 TTTTTCCTCGAGATGGAGTCTGG - Intronic
944711548 2:202339323-202339345 CTTGCTCCCTAGAGGGAGTGGGG + Intergenic
944714188 2:202362398-202362420 CTTTTTTTCCAGAGGGAGTCTGG + Intergenic
945685622 2:212966078-212966100 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
946487533 2:220114927-220114949 CTTTTTCCAGGGAGGCAGTGCGG + Intergenic
946856282 2:223953144-223953166 TTTTTTTCCGAGACAGAGTCTGG + Intergenic
947180160 2:227404378-227404400 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
948331983 2:237176835-237176857 CTGTTTTCTGAGAGGGACTCAGG - Intergenic
948492844 2:238324615-238324637 CTTTTTTTTGAGACGGAGTCTGG + Intronic
949061846 2:241964842-241964864 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
1168761954 20:355391-355413 ATTTTTTTCGAGACGGAGTCTGG + Intronic
1169415625 20:5413626-5413648 CTTTTACCCAAGAGAGGGTCAGG - Intergenic
1169805038 20:9550470-9550492 CTTATTCCCAAGATGGAGTGTGG - Intronic
1170127967 20:12986967-12986989 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
1170237696 20:14126002-14126024 CTTTTTCCCTTCAGGGTGTCAGG + Intronic
1170892959 20:20391571-20391593 ATTTGTCCCAAGAGTGAGTCTGG + Intronic
1171546888 20:26009528-26009550 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1172256068 20:33518831-33518853 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1173609119 20:44353818-44353840 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1174296883 20:49552041-49552063 GTTTCTCCCCAGAAGGAGTCTGG - Intronic
1175143751 20:56880584-56880606 CTTTTTCACGAGGGTGGGTCAGG + Intergenic
1175778470 20:61667491-61667513 CTGTTTCCAGAGAGGGTGGCCGG + Intronic
1178077793 21:29028445-29028467 TTTTTTCCTGAGACGGAGTCTGG + Intronic
1178198358 21:30374824-30374846 TTTTTTTCCGAGACGGAGTCTGG + Intronic
1178697203 21:34803533-34803555 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1179487266 21:41718348-41718370 CTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG + Intronic
1180065906 21:45412246-45412268 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1180209047 21:46282935-46282957 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1182561918 22:31166659-31166681 CTTCTTCTCGAGACAGAGTCTGG + Intronic
1183236616 22:36623491-36623513 CATTTTCCAGAGAGGGAAACTGG - Intronic
1183679923 22:39322122-39322144 TTTTTTTCCGATACGGAGTCTGG + Intergenic
1184056265 22:42052292-42052314 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1184185441 22:42861783-42861805 TTTTTTCTCGAGGCGGAGTCTGG + Intronic
1184594112 22:45503685-45503707 CTCTGTCCCGGGAGGGAGGCAGG - Intronic
1185387713 22:50543894-50543916 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
950898258 3:16473410-16473432 TTTTTTCCTGAGATAGAGTCTGG + Intronic
952147661 3:30550690-30550712 CTTTTTCCAGAAAGCGAGTCGGG + Intergenic
953465221 3:43113994-43114016 CCTTTTCCCAAGAGGGAGGTGGG + Intergenic
953609059 3:44432523-44432545 CTCTTGCCTGAGAGAGAGTCTGG + Intergenic
953889619 3:46742573-46742595 CTTTTTGCCTAGGGGGATTCTGG - Exonic
954505186 3:51063871-51063893 CTGTTACACCAGAGGGAGTCGGG + Intronic
955635694 3:61027096-61027118 CTTTTTTTTGAGATGGAGTCTGG + Intronic
962475078 3:135748254-135748276 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
965502573 3:169473754-169473776 GTTTTTTCTAAGAGGGAGTCTGG - Intronic
966095846 3:176202156-176202178 TTTTTTCCTGAGACGGAGTCTGG + Intergenic
966196789 3:177322030-177322052 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
966765112 3:183454315-183454337 CTTGTTGCCCAGAAGGAGTCAGG + Intergenic
967178056 3:186878517-186878539 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
968499515 4:941448-941470 TTTTTTCTTGAGATGGAGTCTGG + Intronic
968772573 4:2517055-2517077 TTTTTTCCTAAGACGGAGTCTGG + Intronic
971215808 4:24661423-24661445 CTTTTTCTGGAGACCGAGTCTGG + Intergenic
971913615 4:32829061-32829083 TTTCTTCCCCAAAGGGAGTCTGG + Intergenic
972257658 4:37375578-37375600 TTTTTTTCCGAGACGGAGTCTGG + Intronic
972939195 4:44176802-44176824 GTTTTTCAGGAGGGGGAGTCAGG - Intronic
973985485 4:56348137-56348159 CTTTTTTTTGAGATGGAGTCTGG - Intronic
973995646 4:56456101-56456123 TTTTTTCTTGAGACGGAGTCGGG + Intronic
975404592 4:73975539-73975561 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
975490586 4:74984078-74984100 CTTTTTCCTCAGAGGGTGTCTGG + Intronic
976243974 4:82989174-82989196 TTTTTTCTTGAGAGAGAGTCTGG - Intronic
976387208 4:84474828-84474850 CTTTTTCCTAAGAGGGAAGCTGG - Intergenic
976751311 4:88453407-88453429 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
976765767 4:88595860-88595882 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
977188198 4:93967084-93967106 CTTTTTTCAGAGACAGAGTCTGG + Intergenic
977987756 4:103404584-103404606 CTTCCCCCCGAGACGGAGTCTGG + Intergenic
978357227 4:107890218-107890240 TTTCTCCCCGAAAGGGAGTCTGG + Intronic
978554190 4:109960631-109960653 GTTTTCCCCGAGATAGAGTCTGG - Intronic
978738893 4:112115356-112115378 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
980648254 4:135674521-135674543 TTTTTTACGGAGATGGAGTCTGG - Intergenic
984042995 4:174760530-174760552 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
984170770 4:176356903-176356925 CTTTTTCCCACAAGGAAGTCTGG + Intergenic
984292412 4:177812277-177812299 CTTTCCCCCGAAAGGGAGTGTGG - Intronic
984333833 4:178361690-178361712 CTTTTTCTTGAGACAGAGTCTGG + Intergenic
984989678 4:185368164-185368186 CTTTTTTTTGAGACGGAGTCTGG - Intronic
985306118 4:188542477-188542499 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
985319263 4:188690600-188690622 CTTTTTCTTGAGACGGAGTCTGG - Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
988377832 5:30460207-30460229 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
990722484 5:58712534-58712556 TTTTTTCTCGAGACAGAGTCTGG + Intronic
991721069 5:69494204-69494226 TGTTTTTCCGAGACGGAGTCTGG + Intronic
992130442 5:73686528-73686550 TTTTTTTTCGAGACGGAGTCTGG + Intronic
992341316 5:75826383-75826405 CTCTTTCCAGAGAGGTAGACAGG + Intergenic
993254978 5:85579203-85579225 CTTTATCCAGAGAAGGAGTAGGG - Intergenic
994359917 5:98839027-98839049 ATTTTTTTTGAGAGGGAGTCTGG - Intergenic
994737071 5:103568482-103568504 TTTTCCCCCGAGATGGAGTCTGG - Intergenic
995143294 5:108758259-108758281 TGTTTTCCTGAGAGGGAGTGTGG + Intronic
995796367 5:115945680-115945702 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
996554002 5:124759037-124759059 TTTTTTCTTGAGACGGAGTCTGG + Intergenic
997156861 5:131570954-131570976 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
998678987 5:144443413-144443435 TTTTTTCTGGAGAGAGAGTCTGG + Intronic
1000400682 5:160824031-160824053 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1000767835 5:165314500-165314522 TTTTTTCCTGAGACAGAGTCTGG + Intergenic
1001874833 5:175190811-175190833 TTTTTTCTTGAGAGGGAGTCTGG - Intergenic
1001980210 5:176033175-176033197 CTTTTTCCCCAGAGGCACTGGGG + Intronic
1002237173 5:177810488-177810510 CTTTTTCCCCAGAGGCACTGGGG - Intergenic
1004331409 6:14725274-14725296 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1004754230 6:18594125-18594147 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005113762 6:22314107-22314129 CTTTTTCAGGAGAGGAAATCAGG - Intergenic
1005192688 6:23243756-23243778 GTTTTTCCTGAAAGGGAATCTGG - Intergenic
1007572123 6:42900395-42900417 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1007613788 6:43168298-43168320 CTTTGTCACCACAGGGAGTCAGG - Intergenic
1007677861 6:43612811-43612833 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1008190362 6:48448475-48448497 TTTTTCTCCGAGACGGAGTCTGG - Intergenic
1010150464 6:72726220-72726242 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1010231916 6:73542375-73542397 TTTTTTCTGGAGACGGAGTCTGG + Intergenic
1012708450 6:102565733-102565755 TTTTTCCCTGAGATGGAGTCTGG + Intergenic
1013316829 6:108951360-108951382 CTATTTCCCGGGGTGGAGTCAGG + Intronic
1015117273 6:129663575-129663597 CTGTTTCCTGACTGGGAGTCAGG - Intronic
1015360733 6:132336307-132336329 CTTTTTCCAGAGATGGATTACGG - Intronic
1015522057 6:134141259-134141281 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1015791687 6:136969795-136969817 CTTTTCCCCAAGATGGAGCCTGG - Intergenic
1016165297 6:140935074-140935096 GTTTTTCACGAGATGGGGTCTGG + Intergenic
1016428475 6:143958520-143958542 CTGTGTCCCGAGAGGCAGACAGG - Intronic
1016457681 6:144247919-144247941 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1016819642 6:148335284-148335306 TTTTTTCCTGAGACAGAGTCTGG - Intronic
1017002233 6:150004727-150004749 CTTCTTCCCGAGGGCGAGTAGGG + Intergenic
1018290228 6:162285285-162285307 TTTTTTTCCGAGAGGGCCTCTGG + Intronic
1019091647 6:169540439-169540461 TTTTTTCTTTAGAGGGAGTCTGG + Intronic
1019391911 7:793005-793027 CTTTTTTTTGAGACGGAGTCTGG - Intergenic
1020877944 7:13721693-13721715 TTTTTTTTTGAGAGGGAGTCTGG - Intergenic
1021212387 7:17871015-17871037 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
1021497222 7:21289166-21289188 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1022077364 7:26985346-26985368 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1022261087 7:28705594-28705616 CATTTTCCCCAGAGGGACTTGGG - Intronic
1023438188 7:40159818-40159840 CTTTCTTCTGGGAGGGAGTCTGG + Intronic
1023928262 7:44687107-44687129 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1025167771 7:56727952-56727974 TTTTTTACAGAGATGGAGTCTGG - Intergenic
1025277582 7:57597083-57597105 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
1025518287 7:61683618-61683640 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1025542613 7:62112266-62112288 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1026626207 7:71994862-71994884 TTTTTTTTCGAGACGGAGTCTGG + Intronic
1030878555 7:114846882-114846904 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031409493 7:121423828-121423850 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1031630960 7:124042383-124042405 CTTTTTTCAGAGAGGCAGTGTGG - Intergenic
1032172984 7:129601256-129601278 TTTTTTTTCGAGATGGAGTCTGG + Intergenic
1032540312 7:132697494-132697516 CTTTTTCCCCAGAGGCAGGTAGG + Intronic
1032888671 7:136169803-136169825 TTTTTTTTCGAGACGGAGTCTGG + Intergenic
1033342914 7:140505956-140505978 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1033782039 7:144683197-144683219 TTTTTTCCTGAAATGGAGTCTGG + Intronic
1034429149 7:151032229-151032251 CCTTCTCCTCAGAGGGAGTCAGG - Intronic
1034657853 7:152743494-152743516 TTTTTTTCCAAGATGGAGTCTGG - Intergenic
1035871641 8:3141807-3141829 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1036222906 8:6935499-6935521 GTTTTTCCCGAGAAGTAGTGAGG + Intergenic
1036288554 8:7466564-7466586 CTTTTTCTTGAGACGGAGTCTGG + Intergenic
1036332921 8:7844964-7844986 CTTTTTCTTGAGACGGAGTCTGG - Intergenic
1036647553 8:10621336-10621358 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1037382375 8:18300155-18300177 TTTTTTTTTGAGAGGGAGTCTGG + Intergenic
1038987834 8:32832811-32832833 CTCCTTCCCAAGATGGAGTCTGG + Intergenic
1039868650 8:41528009-41528031 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1039941246 8:42093149-42093171 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1040045017 8:42953550-42953572 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1042304645 8:67318223-67318245 TTTTTTCTTGAGACGGAGTCTGG - Intronic
1042844272 8:73154724-73154746 CTTTTTTTTGAGACGGAGTCTGG - Intergenic
1043856577 8:85272265-85272287 TTTTTTCCTGAGACAGAGTCTGG + Intronic
1044719062 8:95128384-95128406 TTTTTTCTTGAGACGGAGTCTGG - Intergenic
1044997946 8:97855014-97855036 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1045269713 8:100651303-100651325 CTTTGTCCCAAGAGGCACTCAGG - Intronic
1047236144 8:123043272-123043294 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1047323416 8:123811881-123811903 TTTTTCCCCGAGATGGAGTCTGG + Intronic
1047490018 8:125366508-125366530 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1047731589 8:127733405-127733427 CTTTTTGTAGAGAGGCAGTCTGG - Intergenic
1048793584 8:138127834-138127856 CTTTTTTTTGAGACGGAGTCTGG - Intergenic
1050083608 9:1940974-1940996 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1051840643 9:21393536-21393558 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1053060297 9:35025373-35025395 TTTCTTCCCGAAAGGGAGTCTGG + Intergenic
1053521994 9:38789951-38789973 TTTTTTCTTGAGATGGAGTCTGG - Intergenic
1054194159 9:62013939-62013961 TTTTTTCTTGAGATGGAGTCTGG - Intergenic
1054644248 9:67574752-67574774 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
1054946944 9:70805520-70805542 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1056528518 9:87466689-87466711 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1056534816 9:87518121-87518143 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1056927350 9:90846247-90846269 CTTGTTCCCTCGAGGGGGTCTGG + Intronic
1057208614 9:93187533-93187555 GTTTTCCATGAGAGGGAGTCTGG + Intronic
1058434755 9:104952129-104952151 TTTTTTTCTGAGAAGGAGTCTGG + Intergenic
1059335330 9:113565253-113565275 CTTTCATCCGAGATGGAGTCCGG - Intronic
1060126458 9:121052438-121052460 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1060635787 9:125199149-125199171 TTTTTTCTTGAGACGGAGTCTGG + Intergenic
1060643801 9:125261404-125261426 TTTTTTTTCGAGACGGAGTCTGG - Intergenic
1061372698 9:130206766-130206788 CATTTTCCCAAGAGAGAGGCAGG - Intronic
1061746983 9:132747457-132747479 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1203652431 Un_KI270751v1:139847-139869 CTTTTTCCCAAGAGGAAGAATGG - Intergenic
1185511707 X:668572-668594 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1187888528 X:23911961-23911983 TTTTTTTTTGAGAGGGAGTCTGG + Intronic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1191616957 X:63180247-63180269 TTTTTTTCCAAAAGGGAGTCTGG + Intergenic
1191619340 X:63198676-63198698 TTTTTTTCCAAAAGGGAGTCTGG - Intergenic
1191997498 X:67111911-67111933 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192196496 X:69032174-69032196 CATTTTCCAGAGAAGGATTCTGG - Intergenic
1194935424 X:99941685-99941707 CTTTTTTCTGACAGGGAGTCTGG - Intergenic
1195088240 X:101433955-101433977 TTTTTTTCCGAGATGGGGTCTGG + Intronic
1196629568 X:117921839-117921861 CTCTTTCCCTAGAGGGAGAGTGG - Intronic
1196963257 X:121026685-121026707 CCCATTCCAGAGAGGGAGTCAGG + Intergenic
1197965676 X:132058337-132058359 GTTTTGCCCTAGAGTGAGTCTGG - Intergenic
1198452878 X:136785232-136785254 TTTTTTCTTGAGATGGAGTCTGG - Intergenic
1199410742 X:147519533-147519555 TTTTTTTCGGAGATGGAGTCTGG + Intergenic
1199862583 X:151815176-151815198 CTTTTTCCCAAGAACCAGTCAGG - Intergenic
1201914166 Y:19164813-19164835 TTTTTTTCTGAGATGGAGTCTGG - Intergenic