ID: 1179905226

View in Genome Browser
Species Human (GRCh38)
Location 21:44419107-44419129
Sequence GGGCCTAATGGCCCAGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179905222_1179905226 -5 Left 1179905222 21:44419089-44419111 CCCTGCTAGGTGTCAGCAGGGCC 0: 1
1: 0
2: 1
3: 14
4: 242
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905218_1179905226 2 Left 1179905218 21:44419082-44419104 CCTTCCGCCCTGCTAGGTGTCAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905217_1179905226 7 Left 1179905217 21:44419077-44419099 CCAGGCCTTCCGCCCTGCTAGGT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905214_1179905226 21 Left 1179905214 21:44419063-44419085 CCTTCTCTCCACTGCCAGGCCTT 0: 1
1: 0
2: 2
3: 45
4: 533
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905223_1179905226 -6 Left 1179905223 21:44419090-44419112 CCTGCTAGGTGTCAGCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905215_1179905226 13 Left 1179905215 21:44419071-44419093 CCACTGCCAGGCCTTCCGCCCTG 0: 1
1: 0
2: 5
3: 202
4: 3216
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905219_1179905226 -2 Left 1179905219 21:44419086-44419108 CCGCCCTGCTAGGTGTCAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1179905213_1179905226 22 Left 1179905213 21:44419062-44419084 CCCTTCTCTCCACTGCCAGGCCT 0: 1
1: 0
2: 5
3: 64
4: 604
Right 1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179905226 Original CRISPR GGGCCTAATGGCCCAGCAGC GGG Intronic
900122417 1:1054466-1054488 GGGCCTCATTGCCCACCTGCAGG - Exonic
900337890 1:2173843-2173865 GGGCCACATGGGCCGGCAGCAGG - Intronic
900432506 1:2609520-2609542 GGGAATAAAGACCCAGCAGCTGG - Intronic
900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG + Intronic
900974397 1:6008105-6008127 GGTCTTAATGGCCCAGCTCCAGG - Intronic
902466546 1:16622032-16622054 GGAGCTGATGGCCCAGAAGCTGG - Intergenic
902508113 1:16951014-16951036 GGAGCTGATGGCCCAGAAGCTGG + Exonic
902568859 1:17333637-17333659 GGGAGTAGGGGCCCAGCAGCTGG - Intronic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
903574387 1:24329330-24329352 GGCCCTAGTGGCCTGGCAGCAGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
913979521 1:143497270-143497292 GGGCAAAATGCCGCAGCAGCGGG - Intergenic
914883423 1:151565425-151565447 GGGAACAGTGGCCCAGCAGCTGG + Intronic
915565531 1:156710739-156710761 GGGGCTAATGGCTCAGCTTCAGG + Intergenic
916718231 1:167462651-167462673 GGGGGAAATGGCCCAGCGGCGGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1067801024 10:49359863-49359885 GGAGCTAATGGCCCTGCAGCCGG - Intergenic
1068782018 10:60929945-60929967 GGGCCTTATGGCCCAGTATGTGG - Intronic
1069744268 10:70705182-70705204 GAGCCTGGTGGCCCAGCACCGGG - Intronic
1070784743 10:79156379-79156401 CGTCCTGAGGGCCCAGCAGCAGG + Intronic
1073107636 10:101041366-101041388 GAGCCTCATGCCCCAGCAGAGGG + Intergenic
1074065196 10:110007662-110007684 GGGCCTGCAGGCCCGGCAGCCGG - Intronic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1075263485 10:120981856-120981878 GGGCCTCCTGCCCCAGGAGCAGG + Intergenic
1079556966 11:21771225-21771247 GGGCACAATTTCCCAGCAGCTGG + Intergenic
1080020035 11:27550732-27550754 GTGCCTAATGTGTCAGCAGCAGG - Intergenic
1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG + Intronic
1083723942 11:64618787-64618809 GGCCTTTCTGGCCCAGCAGCTGG + Intronic
1083746028 11:64736899-64736921 GGACCTGGTGGCCCTGCAGCTGG - Exonic
1084150158 11:67284384-67284406 GGGCCTGGTGCCGCAGCAGCCGG - Intronic
1085645715 11:78221217-78221239 GGGCGTAACTGCCCAGCACCTGG - Intronic
1089194868 11:116688316-116688338 GTGCCTAGTGCCCCTGCAGCAGG + Intergenic
1089655142 11:119941748-119941770 GGGCCTGCTGACCCAGCAGGAGG - Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1093125480 12:15322894-15322916 GGGCACGATGGCCCAGCCGCGGG + Intronic
1095291243 12:40482625-40482647 GGGACTACTGGACCAACAGCTGG + Exonic
1099305957 12:80956159-80956181 GGGCCTCATGGCAGAGCACCTGG - Intronic
1103938223 12:124487621-124487643 GGGCCTCATAGCCTAGCCGCAGG - Intronic
1104176173 12:126334717-126334739 GATCCTAATGGCCCAACAGAAGG - Intergenic
1108182456 13:47854616-47854638 GGGCCACATGGCCAAGCAACTGG - Intergenic
1112256044 13:97832113-97832135 AGGCCTAATGGCCTAGCATTTGG - Intergenic
1115773189 14:36687583-36687605 CTGCCTACTGGCCCAGAAGCTGG - Intronic
1121431637 14:93892161-93892183 GGGGCTAACAGCCCAGCAGGAGG - Intergenic
1124615097 15:31235879-31235901 GGAGCTTATGGCCCAGGAGCGGG + Intergenic
1126756053 15:51925812-51925834 GGATGTAATTGCCCAGCAGCGGG + Intronic
1132642815 16:985379-985401 GGCCCTGAGGGCCCAGCCGCGGG + Exonic
1134589128 16:15437829-15437851 GCGCCTATTGTCCCAGCTGCCGG + Intronic
1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG + Exonic
1136845016 16:33569414-33569436 GTGACTGATGTCCCAGCAGCAGG - Intergenic
1137597460 16:49734336-49734358 GGGCCCAGAGGCCCAGCACCTGG + Intronic
1138300137 16:55919142-55919164 GGGACTCATTGCCCAGCAGAAGG - Intronic
1139778185 16:69330222-69330244 GGGCCTAAGCGCGCCGCAGCTGG - Exonic
1203106724 16_KI270728v1_random:1418067-1418089 GTGACTGATGTCCCAGCAGCAGG - Intergenic
1203155184 16_KI270728v1_random:1869712-1869734 GTGACTGATGTCCCAGCAGCAGG - Intergenic
1143579759 17:7818642-7818664 GGGCCTGGAGGCCCAGCTGCTGG + Exonic
1144826663 17:18109075-18109097 GGGCCTCATGGCCAGGCATCAGG - Intronic
1145261589 17:21357843-21357865 GCTGCTAATGGCCCTGCAGCTGG - Intergenic
1146650157 17:34601611-34601633 GGCCCTGATGGCCCAGCTGCTGG - Intronic
1148156035 17:45425694-45425716 GCGGCCAATGCCCCAGCAGCAGG + Intronic
1150329364 17:64282624-64282646 GAGCCAAGTGGCCCCGCAGCTGG - Intergenic
1150387701 17:64774303-64774325 GCGGCCAATGCCCCAGCAGCAGG + Intergenic
1151391763 17:73791912-73791934 GGCCCTAGAGGCTCAGCAGCTGG + Intergenic
1152730378 17:81967050-81967072 GGGCCTCAGAGGCCAGCAGCTGG - Intergenic
1154311833 18:13272864-13272886 GGGCCTCATCGGCCAGCACCAGG - Intronic
1154348294 18:13562640-13562662 GTCCCTAATGGCCCAGCCCCTGG + Intronic
1155774126 18:29737562-29737584 TGGCAAAATGGCACAGCAGCAGG + Intergenic
1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG + Intergenic
1160793287 19:932777-932799 GGCCCCACTGGCCCAGGAGCAGG - Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1165307099 19:35009485-35009507 GGGGCTCCTGGCCCAGCACCCGG - Intronic
1165384203 19:35500930-35500952 GGGCCTACGGGCATAGCAGCAGG - Intronic
1166340813 19:42135517-42135539 GGACCACATGGCCCTGCAGCAGG - Intronic
1166390642 19:42407187-42407209 GTGCTTGATGGCCCAGCAGTAGG + Exonic
1167790527 19:51676032-51676054 GGGCCTCATTACCCAGAAGCAGG + Intergenic
925910533 2:8570825-8570847 AGGCCAAGTGGCCCTGCAGCCGG + Intergenic
927576418 2:24205408-24205430 GGGCCCAACAGCCCAGCATCTGG + Intronic
928098502 2:28420646-28420668 GGGCCTAATGGACGAGGAGGAGG - Intergenic
931061592 2:58535405-58535427 GGAGCTAATGTCCCTGCAGCTGG - Intergenic
934038726 2:88110167-88110189 GGGCCTAATGTCCTGGCAGTGGG - Intronic
936094934 2:109524136-109524158 GGGCCTAGTGGCGCAAGAGCAGG + Intergenic
936654785 2:114472430-114472452 GGGCCTATTGGCCTATCACCAGG + Intronic
945214522 2:207419502-207419524 GGGCATAAAAGCCCAGCAGCTGG - Intergenic
946160566 2:217833296-217833318 GGGCCCAATTGCCCAGGAACTGG - Intronic
946383138 2:219362766-219362788 GTGCCTCATGACACAGCAGCTGG + Intergenic
948850108 2:240701652-240701674 GGGGCTGATTGCCCAGCACCTGG - Intergenic
1172026167 20:31950327-31950349 GGGCCTGAGGGCCCTGCAGAAGG - Exonic
1172036178 20:32012225-32012247 AGGCCTATTGGCCCAGAAACTGG - Intronic
1172770180 20:37377633-37377655 GGTCCACATGGCCCTGCAGCTGG - Intronic
1174353583 20:49984137-49984159 GGGCCAAGTGCCCAAGCAGCTGG + Exonic
1175265938 20:57703554-57703576 GGGCCTCTTGGGCCAGCAACGGG + Intronic
1175477362 20:59286318-59286340 GGGGCAGAGGGCCCAGCAGCTGG + Intergenic
1176411185 21:6450397-6450419 GGGCCTATCAGCCCAGCTGCAGG + Intergenic
1177239964 21:18443687-18443709 GGGACTATTGGGCCAGTAGCTGG - Intronic
1177792739 21:25737634-25737656 GGCCCTAATGGCGTATCAGCAGG - Intronic
1179686678 21:43058719-43058741 GGGCCTATCAGCCCAGCTGCAGG + Intronic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1183591857 22:38783637-38783659 TGTCCTGCTGGCCCAGCAGCTGG + Intronic
1184392767 22:44214437-44214459 GAGCCTACTGGCCCAGCACAGGG - Intronic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
954378713 3:50208175-50208197 GGGCCTACTGCCCCCTCAGCTGG + Intronic
960052786 3:113253772-113253794 GGCCCTAATTGTCCAGCAACAGG - Intronic
960091008 3:113637971-113637993 GGCCCTGATAGCACAGCAGCGGG - Intergenic
961000690 3:123371999-123372021 CTGCATAATGGCCCAGCAGAAGG - Intronic
961453394 3:127012801-127012823 GGGCCCAGTTGCCCAGCAGTTGG + Intronic
968186941 3:196639578-196639600 CGGCCTAGCGGCCGAGCAGCGGG - Intergenic
968538893 4:1152200-1152222 TTGCCTCATGGCCCATCAGCTGG - Intergenic
968589163 4:1449130-1449152 GTGCCTCACGCCCCAGCAGCAGG - Intergenic
971303803 4:25463278-25463300 GGGCCTGGTGGCCAGGCAGCAGG - Intergenic
972511450 4:39771386-39771408 CGGCCTAGTGGCCGGGCAGCTGG + Intronic
973160964 4:47015959-47015981 TGGCCAAATGCCACAGCAGCTGG + Intronic
983660697 4:170128043-170128065 GGCCCTCATGGTGCAGCAGCAGG + Intergenic
987843983 5:23257894-23257916 GGGCCTGATGGCACAGCAAGTGG + Intergenic
989269314 5:39513389-39513411 AGGCCTATTGTTCCAGCAGCTGG - Intergenic
992742821 5:79791094-79791116 TGGGCTGATGGCCCAGCAGTAGG + Intronic
997587208 5:135050519-135050541 GTGCCGGGTGGCCCAGCAGCAGG + Intronic
999308266 5:150534819-150534841 GGGCCTCATGGCCCAGTGGGTGG + Intronic
999716662 5:154366575-154366597 GGGCCTATTGTCTCAGCAGCTGG - Intronic
1008299522 6:49818104-49818126 GGGCATATTCGCCCAGCAGCTGG + Intergenic
1016171510 6:141024011-141024033 GGGCCTACTGCCCCAGCTGCTGG + Intergenic
1017861270 6:158399609-158399631 GTGCCTGATCTCCCAGCAGCTGG - Intronic
1018023862 6:159789277-159789299 GGGCCTCGGGGCCCCGCAGCCGG - Intronic
1019357394 7:587754-587776 GGGCCTCCTGCCCCAGCAGCTGG - Intronic
1019577831 7:1746054-1746076 CGGCCTCGGGGCCCAGCAGCGGG - Exonic
1020130008 7:5554563-5554585 AGTCCTTACGGCCCAGCAGCAGG + Intronic
1021810179 7:24395453-24395475 ATGCCTAAAGGCCCAGCAGCAGG + Intergenic
1024152809 7:46590012-46590034 GGGCCTGATGGTCCAGCCCCTGG + Intergenic
1024474842 7:49799171-49799193 TGGCCCAGTGGCCCAGCAGGTGG + Intronic
1027185045 7:75965984-75966006 GGGCCCAGTGGCCCAGCACCCGG - Intronic
1029524809 7:101088104-101088126 GGCCCTGCTGGCCCAGAAGCAGG + Exonic
1029575734 7:101402143-101402165 GGGACTAATTGTCCGGCAGCCGG - Intronic
1029899172 7:104021902-104021924 GAGCCTCAGGGCCCAGAAGCAGG + Intergenic
1044895939 8:96891396-96891418 GTGCCTAATTTGCCAGCAGCCGG - Intronic
1045052919 8:98343117-98343139 GGGACTAAGGTCCCAGTAGCTGG - Intergenic
1045862614 8:106829989-106830011 GGGCCAAAAGGCCCAGAAGTGGG + Intergenic
1052002242 9:23298769-23298791 GTGCTTTATGGCCCAGCAGATGG - Intergenic
1059446913 9:114343718-114343740 GGTCCTAATGGGCCGGCAGTGGG + Exonic
1187652316 X:21422210-21422232 GCTCCTAAAGGCCTAGCAGCAGG - Intronic
1189727631 X:43984178-43984200 TGGATTCATGGCCCAGCAGCTGG + Intergenic
1192269869 X:69568897-69568919 GGGCCTCATGACCAAGCAACAGG + Intergenic
1193984107 X:88219478-88219500 GGTCCAAATGGAACAGCAGCCGG - Intergenic
1195363345 X:104105886-104105908 GTGCCTAAAGGCTCAGCACCTGG + Intronic
1198312432 X:135435566-135435588 GGAGCTGATGGCCCAGAAGCTGG + Intergenic
1198719652 X:139602609-139602631 GGGCCTACTGTACTAGCAGCTGG + Intronic
1199894018 X:152115359-152115381 GGACCTGGTGACCCAGCAGCAGG + Intergenic
1200000052 X:153055802-153055824 GGGCCTCAGGTCCCAGCAGCGGG + Intergenic