ID: 1179907812

View in Genome Browser
Species Human (GRCh38)
Location 21:44433340-44433362
Sequence CAGCACGAACAGCAGTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179907810_1179907812 -8 Left 1179907810 21:44433325-44433347 CCAATGCACTGCACTCAGCACGA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1179907809_1179907812 10 Left 1179907809 21:44433307-44433329 CCTCTGTGAGCTTCTTGACCAAT 0: 1
1: 0
2: 0
3: 15
4: 300
Right 1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1179907808_1179907812 13 Left 1179907808 21:44433304-44433326 CCTCCTCTGTGAGCTTCTTGACC 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1179907807_1179907812 30 Left 1179907807 21:44433287-44433309 CCAGGCAGAGCGTGTGGCCTCCT 0: 1
1: 0
2: 2
3: 13
4: 169
Right 1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179907812 Original CRISPR CAGCACGAACAGCAGTTACA GGG Intronic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
905015462 1:34775279-34775301 AAGCAGGAAGACCAGTTACAAGG + Intronic
917738320 1:177940042-177940064 CAGCACGTGCAGCAGATAGAAGG + Intronic
921899806 1:220438077-220438099 CACCACAAGCAGCAGTTACCTGG - Intergenic
1062832013 10:611881-611903 CAGCACAAACCATAGTTACATGG - Intronic
1066175157 10:32895572-32895594 CAGAAAGAATAGCAGTTACTAGG - Intergenic
1067267640 10:44759829-44759851 CAGCTAGAACAGAAGATACAAGG + Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1075486547 10:122827064-122827086 CAGCTCAGACAGCAGATACATGG - Intergenic
1076491407 10:130864068-130864090 CAGCAAGAACTGCCGTTCCAGGG - Intergenic
1076944179 10:133633027-133633049 CAGCATGAACATCAGAAACATGG + Intergenic
1084712776 11:70854374-70854396 CAGCACTAGCCACAGTTACAAGG - Intronic
1086813759 11:91343445-91343467 CAGCATAAACAGCCCTTACATGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091303054 11:134519893-134519915 CAGCACGAAAAGCAGGTTCCAGG + Intergenic
1098539718 12:71640584-71640606 GAGCAGGAACTGCAGTTGCATGG - Intronic
1099672488 12:85712224-85712246 CTGCCCAAACAGCACTTACATGG - Intergenic
1102115693 12:110401541-110401563 CAGGAGGAACAGCAAGTACAAGG + Intronic
1102130858 12:110527833-110527855 CAGCTCAAACACCAGTTTCAAGG - Intronic
1102262492 12:111452810-111452832 CACCACCAACAGCAGTTGTAAGG - Exonic
1104285596 12:127421660-127421682 CAGCAGGAAGAGCAGATACACGG - Intergenic
1107061472 13:36163976-36163998 CAGCACAAGAGGCAGTTACAGGG - Intergenic
1108349716 13:49580868-49580890 CAACACCAACAGAAATTACATGG + Intronic
1108441024 13:50452932-50452954 CAGCACTAACAGATGTTGCAAGG - Intronic
1109538966 13:63747725-63747747 TAGCACGAATGGCACTTACAGGG - Intergenic
1109544877 13:63832107-63832129 TAGCACGAATGGCACTTACAGGG + Intergenic
1109584346 13:64378450-64378472 CAGTAGGAACAGCAGTGCCAGGG + Intergenic
1111094985 13:83501371-83501393 CACCATGAGCAGCAGTTTCAGGG - Intergenic
1119998858 14:79280451-79280473 CAGCACGAGCACCATTTCCATGG + Intronic
1202927045 14_KI270724v1_random:36051-36073 CAGCATGAACATCAGAAACATGG - Intergenic
1127175535 15:56351346-56351368 CAGCACAAAATGCAATTACAAGG + Intronic
1128427738 15:67559308-67559330 CAGCACCCACTGCAGTGACAGGG - Intronic
1129615351 15:77094818-77094840 CAGCAAGACCAGCAGTGGCAGGG + Intergenic
1133650796 16:7812661-7812683 CATCACAAACAACAGTAACAGGG - Intergenic
1141510805 16:84510890-84510912 CATCAAAAACAGCAGCTACATGG + Intronic
1141888968 16:86913805-86913827 CCACACTCACAGCAGTTACAAGG - Intergenic
1144998356 17:19286293-19286315 CAGGAAGAACAGCAGTTAATTGG - Intronic
1150117490 17:62566638-62566660 CAGTGTAAACAGCAGTTACATGG + Intronic
1153050966 18:902915-902937 GAGCAGGAACAGCATTTAGAAGG + Intergenic
1153443328 18:5145557-5145579 AAGCACGAAAAGAAGTAACATGG - Exonic
1153507132 18:5812486-5812508 CAGCAAGAACAGCATTTAAATGG + Intergenic
1155124112 18:22854205-22854227 CAGCAAGAACAGCAGCTACTGGG - Intronic
1159090041 18:63837736-63837758 CAGCAATAACAGCTGTTTCAGGG - Intergenic
1166163999 19:40973797-40973819 CAGCACTAACAGCACACACAGGG - Intergenic
927743564 2:25594049-25594071 CAGCAGGAGCAGCAGTGAGACGG + Intronic
929072860 2:38051099-38051121 CATCACCAACACCAGTGACAAGG + Intronic
931682579 2:64764004-64764026 TAGCACAAACAGCAGGTACATGG + Intergenic
938405118 2:131028182-131028204 CAGCACCACCAGCAGCCACATGG - Intronic
940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG + Intronic
944189363 2:196984869-196984891 CAGCAGGAACAGCAATTACTAGG - Intronic
944526182 2:200622375-200622397 CAGCAAGAACAGCAGTCAACAGG + Intronic
947303882 2:228721870-228721892 CAGGACTAAAAGCAGTTGCAGGG - Intergenic
1169919639 20:10721073-10721095 CAGCAAGAACAGATTTTACAAGG - Intergenic
1170069556 20:12350808-12350830 CTTCCCTAACAGCAGTTACAAGG + Intergenic
1176715628 21:10346918-10346940 CAGAAGAAACAGCAGGTACAAGG - Intergenic
1179897106 21:44369247-44369269 CAGCCTGAGCAGCAGCTACAAGG + Exonic
1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG + Intronic
1180161737 21:46001268-46001290 CAGCACGAACAGGAGGTCGATGG - Exonic
1180602719 22:17033035-17033057 CAGAAGAAACAGCAGGTACAAGG + Intergenic
1181374653 22:22447334-22447356 CAGCAGGAACAGCAGAAAAAAGG + Intergenic
1182171640 22:28236027-28236049 CAGCAAGATCAGCAGTCACCTGG - Intronic
1183350452 22:37331874-37331896 CAGCACCCCCAGCACTTACAGGG + Intergenic
1183815985 22:40300991-40301013 CAGCAAGAGCAGCAGGTACGTGG + Exonic
1184011884 22:41755025-41755047 CAGGAGGAACAGCAGCTGCAGGG + Intronic
953087996 3:39691981-39692003 CAGCAAGAGCAGCAGTAAGAGGG + Intergenic
953824747 3:46241425-46241447 CAGCACATACAGCAGGCACATGG + Intronic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
957801524 3:85089951-85089973 CAGCACAAACAACAGCAACAAGG - Intronic
960962575 3:123082649-123082671 GAGCAAGGACAGCAGTAACACGG - Intronic
962074861 3:132070914-132070936 CAGGAAGAACTCCAGTTACAGGG - Intronic
964317652 3:155461382-155461404 TAGCTCCAACTGCAGTTACATGG - Intronic
966275607 3:178162907-178162929 CAGCAAGATCAGTACTTACAGGG + Intergenic
969636054 4:8370160-8370182 CAGCCCGAGCAGCAGGCACAAGG + Intronic
982103970 4:151995500-151995522 CAGCACGATCAGCAGAAGCATGG + Intergenic
985447547 4:190033570-190033592 CAGCATGAACATCAGAAACATGG + Intergenic
985615929 5:922095-922117 CAGCACCAACAGAAGGTACCTGG - Intergenic
987068220 5:14310016-14310038 AAGCACAAACAGGAGTGACACGG - Intronic
991320341 5:65366740-65366762 CTGCAAGAACAGCAGTCAGATGG - Intronic
995305220 5:110639040-110639062 GAGGACGAACAGCAAATACAGGG + Intronic
995850219 5:116537084-116537106 CAGCTCCAACAGCAGTTAGAAGG + Intronic
998044784 5:138977876-138977898 CAGCAGGAATAGCCGTTGCAAGG - Intronic
998538870 5:142960534-142960556 CAGATCAAACAGCAGATACAGGG + Intronic
1006059981 6:31412362-31412384 CAGCAGCAACAGCAGAAACATGG - Exonic
1006483317 6:34316682-34316704 CAGAGGGAACAGCAATTACAAGG + Intronic
1011787069 6:90858859-90858881 CAGCAAATACAGCACTTACAAGG + Intergenic
1019058946 6:169242165-169242187 CACCAGGAACAGCAGGGACAGGG + Intronic
1019814543 7:3189943-3189965 CAGCAAGACCAGCACATACATGG - Intergenic
1020231483 7:6322362-6322384 CAACACGAACAGTAGTTTTAGGG - Intergenic
1023473816 7:40554947-40554969 CAGAAGGAATAGCAGTTTCATGG - Intronic
1024334892 7:48197083-48197105 CAGCACAAACAGAATTTACTGGG - Intronic
1024778727 7:52821568-52821590 CAGCACCCACAGCTGTTTCATGG + Intergenic
1025222724 7:57129370-57129392 AAGCACAATCAGCATTTACAGGG - Intronic
1025266163 7:57459528-57459550 AAGCACAATCAGCATTTACAGGG + Intronic
1025633514 7:63301043-63301065 AAGCACAATCAGCATTTACAGGG - Intergenic
1025649182 7:63447114-63447136 AAGCACAATCAGCATTTACAGGG + Intergenic
1025742570 7:64210426-64210448 AAGCACAATCAGCATTTACAGGG + Intronic
1025747598 7:64257850-64257872 AAGCACAATCAGCATTTACAGGG + Intronic
1025978327 7:66387196-66387218 CACCACGCCCAGCAATTACAAGG - Intronic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1032197278 7:129796615-129796637 CAGCAGGAACAGCCGGTCCATGG + Intergenic
1033230908 7:139596751-139596773 CATCACCATCAGCAGTGACACGG - Exonic
1034104858 7:148481670-148481692 CAGAAGGAACAGCTGTCACACGG + Intergenic
1034884906 7:154791780-154791802 CAGCATCAACAGCAGTGACATGG - Intronic
1037313052 8:17576670-17576692 CACCCCCACCAGCAGTTACAGGG + Exonic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1039201940 8:35104791-35104813 CAGCAAGAAGAGCAGTGACAGGG + Intergenic
1039475539 8:37837640-37837662 CAGCAGCAGCAGCAGTGACAGGG - Intronic
1039765281 8:40621914-40621936 CAGAACTAACAGCAGTTATGGGG + Intronic
1039913560 8:41843504-41843526 CAGCACATACAGCAGGCACATGG + Intronic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041837498 8:62232900-62232922 CAAAAGGAACAGCAGCTACACGG - Intergenic
1047397663 8:124516974-124516996 CTGTAAGAACAGAAGTTACATGG + Intronic
1051408283 9:16762543-16762565 CAACACCAACAGCAGTTCCCAGG + Intronic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1057158881 9:92870752-92870774 CAGCATGAAGAGCAGAAACAAGG + Intronic
1057756219 9:97838808-97838830 AAGCAAGAAAAGCAGATACAAGG + Intergenic
1059980682 9:119768572-119768594 AAGCTGTAACAGCAGTTACAAGG - Intergenic
1062303930 9:135891244-135891266 CAGCATGAGCAGCAGAAACAGGG + Intronic
1187717759 X:22120178-22120200 GGGCACTAACAGCAGTAACAGGG - Intronic
1188637041 X:32446658-32446680 CAGCAGCAACAGCAATTATATGG + Intronic
1189064838 X:37796326-37796348 CACCATGAATAGCAATTACATGG - Intronic
1196099421 X:111831959-111831981 CATCAGGGACAGCAGTGACAAGG + Intronic
1196737332 X:118991330-118991352 CAGCACTAATCTCAGTTACATGG + Intronic
1197427098 X:126310974-126310996 CAGCATGAAGAACAGTTATATGG + Intergenic
1198107420 X:133474822-133474844 CAGCACAAAAAGCAGATAGAAGG - Intergenic
1199026628 X:142946941-142946963 CAGCACTCACAGCAGTTAAGAGG + Intergenic