ID: 1179907978

View in Genome Browser
Species Human (GRCh38)
Location 21:44434032-44434054
Sequence CAGCTGTCCTGGGGCAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179907973_1179907978 -3 Left 1179907973 21:44434012-44434034 CCGCCGGTGCTAGAGGTGGTCAG 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG 0: 1
1: 0
2: 4
3: 62
4: 468
1179907974_1179907978 -6 Left 1179907974 21:44434015-44434037 CCGGTGCTAGAGGTGGTCAGCTG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG 0: 1
1: 0
2: 4
3: 62
4: 468
1179907970_1179907978 9 Left 1179907970 21:44434000-44434022 CCTGGCTGGTGGCCGCCGGTGCT 0: 1
1: 0
2: 1
3: 9
4: 207
Right 1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG 0: 1
1: 0
2: 4
3: 62
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179907978 Original CRISPR CAGCTGTCCTGGGGCAGCCA CGG Intronic
900043320 1:489383-489405 AAGCAGTGGTGGGGCAGCCAGGG - Intergenic
900064757 1:724380-724402 AAGCAGTGGTGGGGCAGCCAGGG - Intergenic
900172465 1:1275633-1275655 CTGCTGTTCAGAGGCAGCCAAGG - Intergenic
900252533 1:1678563-1678585 CAGCTGTCCTGGTGCACCGAGGG - Intronic
900284419 1:1892130-1892152 CAGCTGTGCTGGTGCAGGCCTGG - Intergenic
900421692 1:2558566-2558588 GACCTGGCCTGGGGCAGCCGGGG - Intronic
900519980 1:3100776-3100798 CAGCTGTGCTGAGTCAGCCCAGG - Intronic
900595007 1:3476647-3476669 CTGTTGTCCTGGGACAGCCCAGG + Intronic
901056200 1:6449649-6449671 CAGGGGCCCTGGGCCAGCCAAGG + Intronic
901187471 1:7384319-7384341 CAGCTGGCCTGGTGCAGGAAAGG + Intronic
901468409 1:9438696-9438718 CAGCTGACCTGGGGGAGCTGGGG - Intergenic
901739818 1:11334735-11334757 CCCTTGTCCTGGGGCAGGCAGGG + Intergenic
901860084 1:12068708-12068730 CAGCTGTTCTGGGTCAGGCATGG + Intronic
901872474 1:12146049-12146071 CTGCTCCCCTGGGTCAGCCAGGG - Intergenic
901927795 1:12578003-12578025 CAGCCCTCCAGGGGAAGCCACGG + Intronic
902124921 1:14201439-14201461 CAGCTGCTCCGGGGCAGCCAGGG - Intergenic
902129178 1:14243926-14243948 GAGCTACCCTGGGGGAGCCAAGG + Intergenic
902329373 1:15723793-15723815 CAGCTGCCCTGTGGCTTCCAAGG + Intronic
902549698 1:17212052-17212074 CAGCTTCCCTGGGGCACACAGGG - Intronic
902605903 1:17569250-17569272 CAGCTGTTCTGGGGCACCTCTGG - Intronic
902824331 1:18962630-18962652 CAGCAGCCCTGGGGGAGCCCTGG + Intergenic
903425562 1:23251672-23251694 TACCTGTTCTGGGACAGCCATGG - Intergenic
904049882 1:27632752-27632774 CGGGGGTCCAGGGGCAGCCAAGG + Intronic
904285212 1:29449607-29449629 CAGCTGACCTGGGGGAGCCCCGG - Intergenic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
905329930 1:37187426-37187448 CAGATGACCTGGGCCAGCCTGGG + Intergenic
905396147 1:37667967-37667989 CCCCTGTCCTGGAGGAGCCAGGG + Intergenic
906510661 1:46408845-46408867 CAGCTGTCCAGAGGCTCCCAGGG + Intronic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
907629048 1:56061740-56061762 CTGGGGTCCTTGGGCAGCCAAGG - Intergenic
907666775 1:56439839-56439861 CAGCTGTCCCGGGCATGCCAGGG - Intergenic
910098372 1:83549971-83549993 CAACTGACCTGGTGCACCCAAGG + Intergenic
912413345 1:109492415-109492437 CAGCTCACCAGGGGCAGCCTGGG - Intronic
912688832 1:111788366-111788388 CATCTGTCCTGAGGAAACCACGG + Intronic
912750148 1:112280833-112280855 CAGCTTTCCGAGGGCAGGCAGGG - Intergenic
913069075 1:115283708-115283730 CAGCCTTTCTGGGGCAGCCCGGG + Intergenic
915221897 1:154381416-154381438 CAGCAGTTCTGGGGCTGGCATGG - Intergenic
915399125 1:155609951-155609973 CCGCTGACTTGGGGCCGCCAGGG - Intergenic
915416245 1:155745533-155745555 CCGCTGACTTGGGGCCGCCAGGG - Intergenic
915428463 1:155846719-155846741 AAGCTGTCCTGGGCCAGGCACGG + Intronic
915633582 1:157171205-157171227 CAGCTGGCCTGGGAAAGCCCAGG - Intergenic
915839883 1:159205255-159205277 GAACAGTCCTGGGGAAGCCAGGG - Exonic
916556767 1:165900126-165900148 CAGCTGAGCGGGGGCAGCAAAGG - Intronic
917849057 1:179044455-179044477 CAGGTGTTCTGGGGCAGAGAGGG - Intronic
920309169 1:205038486-205038508 CAGATGACCTGGGGCAGTCAAGG + Intergenic
921185409 1:212665624-212665646 CAGCTGTCCCCGGGCTGCCTGGG - Intergenic
922028208 1:221773018-221773040 TAGATGTCCTGGGGGAGCCCAGG - Intergenic
922533402 1:226361875-226361897 CAGATTACCTGGGGCAGACAAGG - Intronic
922717708 1:227885923-227885945 CAGCTGGCCTCGGGCCACCATGG - Intergenic
1062843534 10:688902-688924 CAGCGGTCCTGGCGCGGCCCGGG - Intronic
1062980334 10:1717315-1717337 CAGCTGCCCTGGGGTCCCCAGGG - Intronic
1063135226 10:3210376-3210398 CAGCTCTCCTGAGACATCCACGG + Intergenic
1063377674 10:5563788-5563810 CTACTGGCCTGGGGCAGCCTCGG + Intergenic
1064282073 10:13959956-13959978 TGCCTGTTCTGGGGCAGCCACGG - Intronic
1064475312 10:15682131-15682153 GACCTGTGCTGGGGAAGCCAGGG - Intronic
1065830203 10:29608356-29608378 CAGCTGCAGTGGGGAAGCCATGG + Intronic
1067043183 10:42969367-42969389 CTGGTGTCCTGGGGTGGCCAGGG - Intergenic
1067229737 10:44397789-44397811 CAGCTAGCCAGGGGCTGCCACGG + Intergenic
1067837199 10:49648936-49648958 CCCCTGTGCTGGGGCAGCCGTGG - Intronic
1069723018 10:70561597-70561619 CAGCACTTCTGTGGCAGCCATGG + Intronic
1069815990 10:71194725-71194747 CAGCTGTCCTGTGGCAAGCTGGG + Intergenic
1069957284 10:72059898-72059920 AAGGAGGCCTGGGGCAGCCAAGG + Exonic
1070552733 10:77503619-77503641 CAGCTGTCCTTGTGCAGTCATGG + Intronic
1070777632 10:79119061-79119083 CTGCTGACGTGGGGCAGACAGGG + Intronic
1071232312 10:83602701-83602723 CAGTAGTCCTGAGGCATCCATGG + Intergenic
1071327304 10:84530041-84530063 CAATTTTCCTGGGGAAGCCAAGG - Intergenic
1073121295 10:101123792-101123814 CAACTTTCCTGGGGAGGCCACGG - Intronic
1073370965 10:102988606-102988628 CAGCTGCCCTAGAGCATCCAGGG + Intronic
1073958861 10:108902973-108902995 CAGCTGTTAGGGAGCAGCCAGGG - Intergenic
1074258732 10:111830509-111830531 CAGCTGAGCTGGTGCATCCAAGG + Intergenic
1074285186 10:112091293-112091315 AAGCTGTCCTGGGCCACACATGG - Intergenic
1074473276 10:113746409-113746431 CAGCTGTTCAGGAGCAGGCATGG - Intergenic
1074502489 10:114039353-114039375 CAACTCTCCTGGGGCAGAAATGG + Intergenic
1074592076 10:114822335-114822357 CTGCCGGCCTGGGGCAGCCAGGG - Intronic
1074776601 10:116771931-116771953 CAGCTGTGCTGTCTCAGCCACGG + Intergenic
1075335237 10:121604049-121604071 CAGCGGTCCAGGGGGAGGCAAGG + Intergenic
1075575363 10:123573509-123573531 CAGCTGTGCTGGGGCGCCCGGGG + Intergenic
1076143252 10:128096365-128096387 CTGCTGACTTGGGGCAGCCCTGG + Intergenic
1076343858 10:129767322-129767344 CCGCTGTCCAGGGCCAGCTAAGG + Exonic
1076555863 10:131321057-131321079 GGGCTGGCCTGGGGCACCCAAGG + Intergenic
1076629699 10:131844878-131844900 CTGCTGTCCTGGAGAAGCCTTGG + Intergenic
1076713708 10:132352816-132352838 CAGGTGTCGTGAGGAAGCCAGGG - Intronic
1076869685 10:133187246-133187268 CAGCTGACCAGGGGCAGCACTGG - Intronic
1076942852 10:133621348-133621370 CACCTGTCCTGTGGCAGCATCGG + Intergenic
1076969592 11:125600-125622 AAGCAGTGGTGGGGCAGCCAGGG - Intergenic
1077074438 11:694113-694135 CACCTGTCCTGGAGAAGCCCTGG - Intronic
1077108915 11:853600-853622 GAGGGTTCCTGGGGCAGCCAGGG + Intronic
1077160948 11:1112661-1112683 CAGTTGGCCTGGGCCTGCCATGG + Intergenic
1077416827 11:2427853-2427875 CAGCTGTCCTGTGGAGGACAGGG + Intergenic
1077485054 11:2834798-2834820 CTGCATTCCTGGGGCAGCCAAGG - Intronic
1077552107 11:3205065-3205087 CACCTGAGCTGGGGCAGCTAAGG + Intergenic
1077867567 11:6235286-6235308 CAGCGGTGTTGGGGGAGCCAGGG - Intronic
1078184163 11:9037603-9037625 CAGCAGCCCTGGGGCACCCTGGG - Intronic
1079391372 11:20024719-20024741 CAGTTGCCCCAGGGCAGCCAAGG - Intronic
1081070269 11:38602601-38602623 CAATTTTCCTGGGGAAGCCAAGG + Intergenic
1081700902 11:45152017-45152039 CAGAAGTCCTGGGGGAGGCAAGG - Intronic
1083490048 11:63009335-63009357 CAGCTGACCTGGGGCCTCCTTGG + Intronic
1083887655 11:65580747-65580769 CAGCTGTCCTGGGTCAGGTACGG - Intronic
1084107891 11:66992298-66992320 CAGCTGCCCTGGGGGTGGCATGG + Intergenic
1084492584 11:69486799-69486821 CAGCCGTCCTGGGGCTGGCTGGG - Intergenic
1085446466 11:76604188-76604210 CAGTGGTCCTGGGGCAGCCATGG - Intergenic
1085520736 11:77137700-77137722 CAGCTGTCCTGGGGAGTTCAGGG + Intronic
1088201462 11:107339779-107339801 CAGCTGTTGTGGGGGGGCCAAGG - Intronic
1088415749 11:109586995-109587017 CAGCAGTCCTGGAGCTGGCAGGG - Intergenic
1089340326 11:117752947-117752969 CAGCTCCCCTGGGACAGCCATGG - Intronic
1089932562 11:122328795-122328817 CAGATGTCCTGGGAGAGTCAGGG + Intergenic
1090411162 11:126510936-126510958 CAGTTGTCCTGGTGCCTCCAGGG + Intronic
1090644661 11:128758007-128758029 AAGCTGTCCTGGGGCAGCCCTGG + Intronic
1091214110 11:133889983-133890005 CAGCTGTCCTCGGGAGGCCAGGG - Intergenic
1091694473 12:2618521-2618543 CCGGTGCCCTGGGGCAGCCAGGG + Intronic
1091896942 12:4113141-4113163 CTGCAGTCCTGAGGAAGCCAGGG + Intergenic
1091918437 12:4285847-4285869 GAGTGGTCCTGGGGCAGCCCTGG + Intronic
1091951100 12:4593691-4593713 GCACTGTCCTGGGGAAGCCAAGG - Intronic
1092167970 12:6354684-6354706 CAGCTTTGCAGGGCCAGCCAGGG + Intronic
1092194602 12:6541640-6541662 CAGCTGTGGTGGGGCAGGCAGGG + Exonic
1092206672 12:6618739-6618761 CAGCAGCCCTGGGGCAGGGATGG - Intergenic
1092259299 12:6944202-6944224 CTGCTGGCCTGGGGTAGTCAAGG + Intronic
1094064222 12:26346330-26346352 CAGCTGCGCTGGGCCAGGCACGG + Intronic
1094708240 12:32935692-32935714 CAGCTCTCCTTGGGAGGCCAAGG - Intergenic
1095987765 12:48010862-48010884 CACCTATCCGGAGGCAGCCAGGG + Intergenic
1096080613 12:48830043-48830065 CAGGTCTCCTGGGGCATCTAGGG + Exonic
1096239173 12:49950474-49950496 CAGCAGCCCTGGGGTAACCAAGG + Intergenic
1096392186 12:51238298-51238320 CGACTGTCCTGGGGAAGACAGGG + Intronic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1096601541 12:52733269-52733291 CAGGTCTCCTGGGGCATCTAGGG - Intergenic
1096715681 12:53489925-53489947 CAGCTGTCCTGGGCCAGGTGAGG - Intronic
1097170184 12:57108348-57108370 CCTATCTCCTGGGGCAGCCAGGG + Intronic
1098721485 12:73904276-73904298 AAGCTGTCATGGGCCAGGCATGG - Intergenic
1103496883 12:121369732-121369754 CAGTTGGTCTGGGGCAGCCTGGG + Intronic
1103703869 12:122861201-122861223 CAGAGGTCACGGGGCAGCCATGG - Intronic
1103955087 12:124571756-124571778 CAGGGCTCCTGGGGTAGCCAGGG - Intergenic
1104655625 12:130571997-130572019 CAGCTGTGCAGGAGCAGCGAAGG - Intronic
1104858529 12:131913002-131913024 GAGCTGGCCTGGGGCTGGCAGGG + Intronic
1104910341 12:132237224-132237246 CAGGTGGCCTGGGGCAGCTGAGG - Intronic
1106248703 13:27968465-27968487 CAGCAGTCCCTCGGCAGCCAAGG - Exonic
1106408958 13:29497675-29497697 AAGCTGACATGGGGCAGCCTTGG + Intronic
1106475423 13:30094225-30094247 CAGGTGCTCTGGGGTAGCCATGG + Intergenic
1106570680 13:30924604-30924626 CAGCTGCCCTGGGCCTGCCAGGG - Exonic
1106789127 13:33136903-33136925 CAGCAGGGCTGGGTCAGCCAGGG + Intronic
1108455672 13:50611322-50611344 CACATGTCCTGTGGCAGCCCCGG + Intronic
1108979520 13:56492596-56492618 CTGCTGTCCTGGGCAAGCCCAGG - Intergenic
1111002572 13:82205167-82205189 CAGCTGTGCTTGGGAAGGCAGGG - Intergenic
1112159592 13:96853750-96853772 CCGTTGGCCTGGGGAAGCCAGGG - Intergenic
1112431953 13:99358057-99358079 GAGCTGTCCTGGGGAAGGGATGG + Intronic
1113450844 13:110408211-110408233 CAGCTGTGCTGGGGCCACAAGGG + Intronic
1113792463 13:113036392-113036414 CAGATGTGCTTGGGCAACCAAGG + Intronic
1113902731 13:113805659-113805681 CCGCTGTGCTGGGGCACCCTAGG + Intronic
1114066222 14:19061866-19061888 CATCTGTCCTGTGGGAGCCCGGG - Intergenic
1114096046 14:19338158-19338180 CATCTGTCCTGTGGGAGCCCGGG + Intergenic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1119045034 14:71311220-71311242 CAGCTGCCTTGTGGCATCCAAGG - Intergenic
1119617809 14:76110344-76110366 CAGCTGTCCTGGCCCTGCCTTGG + Intergenic
1122411985 14:101530190-101530212 CAGTTGTCCTGGAGCAAGCACGG + Intergenic
1122588355 14:102826807-102826829 CAGCTGTCCTTTGGCAGCCCTGG - Intronic
1122716883 14:103701250-103701272 GAGCTGGCCCGGGACAGCCAGGG + Intronic
1122902967 14:104789347-104789369 GAGCTGCCCTGGTGCAGCCCCGG - Intronic
1122913379 14:104844503-104844525 CAGCAAGCCTGGTGCAGCCACGG + Intergenic
1123110625 14:105865353-105865375 CAGGTGTACTGGGCCAGGCAAGG - Intergenic
1123939801 15:25211320-25211342 CAGTGGTCCTGGGGCAGCCCTGG + Intergenic
1124028712 15:25989931-25989953 CAGGAGGCCTGGGGCAGGCAGGG + Intergenic
1124236487 15:27993574-27993596 CAGCTGTCCTGAGAGGGCCATGG - Intronic
1124240623 15:28024815-28024837 CAGTAGTGCTGGGGCAGCTAAGG + Intronic
1125578526 15:40770451-40770473 CAGGTGTTCAGGAGCAGCCAGGG - Exonic
1125825843 15:42675721-42675743 CTGCTGTCCTGCGGCAGCGAAGG + Exonic
1127797136 15:62448185-62448207 CAGTTGTCCTGGGGAAGGCTTGG + Intronic
1128089974 15:64912602-64912624 CAGCTGGCCTGGGGCAGCTTTGG + Intronic
1128096497 15:64960361-64960383 CAGCTGCCCTGGGGAGGGCAGGG - Intergenic
1128737541 15:70061729-70061751 CAGCTGCCCTGGGTCAGCCCTGG + Intronic
1129107283 15:73318923-73318945 CAGTTGTCATGGGGACGCCAGGG + Intergenic
1129516394 15:76160211-76160233 CTCCTGTCCTGGGGAAACCAAGG + Intronic
1130046645 15:80450925-80450947 CACCTGTCCGGTGGCCGCCATGG - Exonic
1130396022 15:83502302-83502324 CACTTGCCCTGGGGCACCCAAGG - Intronic
1130580602 15:85134280-85134302 CAGCTCTCTCTGGGCAGCCATGG - Intronic
1132348639 15:101123413-101123435 CAAATGTCCTGGGGCAGAAAAGG - Intergenic
1132598177 16:762601-762623 CCTCTGTCCTGGGCCAGCCTGGG - Intronic
1133300204 16:4777860-4777882 CAGCTGTCCTGGGGAGGCCGGGG + Exonic
1133976597 16:10603590-10603612 CCACTTCCCTGGGGCAGCCATGG + Intergenic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1135425081 16:22328417-22328439 CATCTGGGCTGGGGCAGACAGGG + Intronic
1135831502 16:25778258-25778280 CATTTGGCCTGGGACAGCCATGG + Intronic
1136236317 16:28915824-28915846 AAGTTGTCCTGGGCCAGGCACGG - Intronic
1136922898 16:34346302-34346324 CACCCTTCCTGGGGCAGCCCTGG - Intergenic
1136981675 16:35065504-35065526 CACCCTTCCTGGGGCAGCCCTGG + Intergenic
1137676930 16:50308443-50308465 CAGGTGTCCTGAGGCAGGGAGGG - Intronic
1139594920 16:67951838-67951860 CAGCTGCCCCGGGGATGCCAGGG + Exonic
1139972879 16:70787173-70787195 AAGCTGGGCTGGGGCAGGCATGG + Intronic
1140093517 16:71855926-71855948 CAGCTTTCCTGGGGTAGGGAAGG + Exonic
1141305842 16:82863188-82863210 CAGCTGTCTTGGAGTAACCAAGG + Intronic
1141407778 16:83808563-83808585 CAGCTGTCCAGAGGCAGAAATGG + Intronic
1141623541 16:85249648-85249670 CAGCTGCTCTGGGGCAGGCCTGG + Intergenic
1141691899 16:85601309-85601331 CAGCAGGGGTGGGGCAGCCATGG + Intergenic
1141723279 16:85768776-85768798 AAACTGTCCTGGGGTATCCAGGG + Intergenic
1141847338 16:86619749-86619771 CAGCTCTGCGGGAGCAGCCACGG + Intergenic
1142126545 16:88413438-88413460 CATCTGTGCTGGGAAAGCCACGG - Intergenic
1142187248 16:88700483-88700505 CAGATGTCCAGGGGCTGCCCTGG - Intronic
1142259588 16:89036517-89036539 TAGCTGTCCTGAGGCCGGCAGGG - Intergenic
1142442311 16:90106686-90106708 CACCTTTCCTCGGGCAGCCTCGG - Intergenic
1142451088 16:90173522-90173544 AAGCAGTGGTGGGGCAGCCAGGG + Intergenic
1142456475 17:60173-60195 AAGCAGTGGTGGGGCAGCCAGGG - Intergenic
1143260641 17:5595954-5595976 CAGCTGTCCAGATGCAGCCATGG - Intronic
1143479459 17:7220133-7220155 CGGCGCTCCTGGGGCAGCCCCGG + Exonic
1144761789 17:17711258-17711280 CAGGGGTGCTGCGGCAGCCAGGG - Intronic
1145250243 17:21293455-21293477 CAGCTGCACAGGGGCAACCATGG - Intronic
1147118747 17:38322448-38322470 AAGCTCTTCTGGGTCAGCCATGG + Intronic
1147259366 17:39199719-39199741 CAACTGTACTGCGGCAGGCATGG - Intergenic
1147419418 17:40314738-40314760 CTTCTGTCCTGGGGCTGGCAAGG + Intronic
1148677319 17:49452805-49452827 CAGCTGTCCTGAGGCCACCAAGG - Intronic
1148776057 17:50096263-50096285 TAGCAGCCCTGGGGCAGCCAAGG - Intronic
1150086326 17:62274997-62275019 CTGCTGCCCTTGGGCAGCCGTGG - Intronic
1150842801 17:68624890-68624912 TAGGTGACCTTGGGCAGCCATGG - Intergenic
1151101771 17:71563949-71563971 CAGCTGTCCAGGGGCCCCAAAGG + Intergenic
1151517181 17:74604173-74604195 GAGCAGTCATGGGGCAGCCTAGG - Intergenic
1152134744 17:78497324-78497346 TGGCTGTCCTGGGGAAGACAGGG - Intronic
1152228171 17:79102223-79102245 AGGCTGTCCAGGGGCAGCCTGGG + Intronic
1152553285 17:81040428-81040450 CAGCTGTACAGGCACAGCCAGGG - Intronic
1152603634 17:81277980-81278002 CCCCTGCCCTGGGACAGCCATGG - Intronic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1152800812 17:82329889-82329911 CATGTGTCCTGGGTCACCCAGGG - Intronic
1152929575 17:83102982-83103004 CAGCTGTCTTGGGCCACCCAAGG - Intergenic
1153061789 18:1002735-1002757 TTGTTGTCCTGGGACAGCCAAGG + Intergenic
1153179608 18:2418151-2418173 CAGCAGATCTGGGGCTGCCAAGG - Intergenic
1154048192 18:10927422-10927444 CCGATGGCCTGGGGGAGCCAAGG - Intronic
1155996759 18:32338732-32338754 GAGCTTTCCTGGAGCAGACAGGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157289007 18:46396918-46396940 CAGCTGTGCCTGGGCAGCCTGGG + Intronic
1157580626 18:48771916-48771938 CAGCTTTCCAGCGGCAGCCACGG - Intronic
1158109350 18:53923266-53923288 CATCTGTCCTGGGCCAGAAATGG - Intergenic
1158560231 18:58507298-58507320 CAGCTGCCCTGGGGTAGGGATGG + Intronic
1160238037 18:77101217-77101239 CAGCTGCCCTGGAGAACCCAGGG - Intronic
1160646396 19:195526-195548 AAGCAGTGGTGGGGCAGCCAGGG - Intergenic
1160859193 19:1230597-1230619 CAGGGTTCCTGGGGCAGCCCTGG - Exonic
1160969618 19:1761750-1761772 CACCTGACCTTGGGCAGCCTTGG + Intronic
1161201801 19:3019335-3019357 CAGCTGAGCCTGGGCAGCCAGGG + Exonic
1161389801 19:4015084-4015106 CACCTGTCCTGGGGGACTCAGGG + Intronic
1161513151 19:4682913-4682935 CCGCTGTCCCGGGGCCGCCCTGG + Intronic
1161769672 19:6224330-6224352 CAGCTGGCCTGGGCCATGCAGGG + Intronic
1162433638 19:10643929-10643951 CAGCTGAGATGGGGCCGCCAAGG + Exonic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1162821584 19:13226579-13226601 CATCTGTCCTTGGGCACCAAGGG + Intronic
1163027408 19:14520284-14520306 CAGCTGCCCCTGGGCAGACAGGG + Intronic
1163062058 19:14768088-14768110 CAGCTGTCCTGGGGAAATCAAGG - Intronic
1163268359 19:16234566-16234588 CAGATGGCCTGGGGAAGGCAGGG - Exonic
1163272267 19:16261506-16261528 CTGGTGTCCTGAGGCAGCCTTGG + Intergenic
1163512985 19:17747275-17747297 CAGCCGGCCTAGGGCAGCCCCGG - Intergenic
1163638661 19:18449662-18449684 CAGCTGGCCCAGGGCAGCCCAGG - Intronic
1165073281 19:33267787-33267809 CAGCTGGCCTGAGGCAGCTCGGG - Intergenic
1165096472 19:33412463-33412485 CGGCTGTCCTGGAGCTGCCCTGG + Intronic
1165792202 19:38499360-38499382 CAGCAGGCCTGGGGCTGGCAGGG + Intronic
1166743505 19:45128861-45128883 CTGCTGTCCTGGAGCAGTGAGGG - Intronic
1166873099 19:45882669-45882691 CAGATGTCCTCGGGAACCCAGGG - Intergenic
1167440806 19:49507746-49507768 TAGCTGTCCTGGGGGAGCCCAGG + Intronic
1168169613 19:54576733-54576755 CACCTCTCATGGGGGAGCCAGGG + Intronic
1168642440 19:58039111-58039133 CGGCTGCCCTGGGGCAGTAAGGG - Intronic
925062695 2:905315-905337 CACCAGCCCTGGGGCAGGCACGG + Intergenic
925747080 2:7052454-7052476 GAGCTGTCCTGTGGCCTCCAAGG + Intronic
927207902 2:20621550-20621572 CACCTGCCCTGGGGGAGTCAAGG - Intronic
927484085 2:23477151-23477173 CAGCAGTCCCGGGGCTGCTATGG - Intronic
927644774 2:24870660-24870682 CAGGAGCCCTGGGGCACCCAGGG + Intronic
928452099 2:31386378-31386400 AGGCTGCCCTGGGGCTGCCAGGG - Intronic
928476132 2:31629624-31629646 CAATTTTCCTGGGGAAGCCAAGG + Intergenic
931401361 2:61934249-61934271 CAGCTGTCCTGGAAGGGCCATGG + Intronic
932267548 2:70381351-70381373 CAACTGTCCTGGAGAAGGCAGGG + Intergenic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
933951944 2:87338509-87338531 AAGCTGTGCTGGGGCTTCCATGG - Intergenic
934236186 2:90234843-90234865 AAGCTGTGCTGGGGCTTCCATGG - Intergenic
934794032 2:97085579-97085601 CAGCAGTCAAAGGGCAGCCAGGG + Intronic
935144026 2:100381773-100381795 CAGCTGTCATGGGGCTGCCCAGG + Intergenic
935363415 2:102266935-102266957 AAACTGTCCTGGGGAAGGCAAGG + Intergenic
935742813 2:106165685-106165707 GAGCTGTCTTCGGGAAGCCATGG - Intronic
936047051 2:109196274-109196296 CTGCTGGCCTGGAGCAGCCCAGG - Intronic
936524373 2:113232919-113232941 CGGCGGTCATGGGGCAGGCAAGG - Intronic
937246910 2:120499502-120499524 CAGCTGTGCTGGTCCTGCCAAGG - Intergenic
937902086 2:127027704-127027726 CAGGAGTCCTGGGCCAGCCTGGG - Intergenic
937924065 2:127154173-127154195 CAGCTCTCTTCAGGCAGCCAGGG + Intergenic
938369887 2:130762383-130762405 CAGCTGCCCTGTGGCAGCCGTGG - Exonic
938721336 2:134069694-134069716 CACCTCTACAGGGGCAGCCATGG + Intergenic
939824571 2:146999124-146999146 CAATTTTCCTGGGGAAGCCAAGG + Intergenic
942084015 2:172427787-172427809 CAGCTGCCCGGCGGCGGCCATGG - Exonic
942121417 2:172781618-172781640 CAGTCGTCCTGGGGTACCCATGG + Intronic
942208674 2:173648949-173648971 CCTGGGTCCTGGGGCAGCCATGG + Intergenic
942580593 2:177412388-177412410 CAATTTTCCTGGGGAAGCCAAGG - Intronic
943890022 2:193275252-193275274 CTGCTATCCTGGCCCAGCCAGGG - Intergenic
944281379 2:197902202-197902224 CAGCTATCCTAGGACAGCCAAGG + Intronic
945255173 2:207797230-207797252 CTGCTCTCCTGGCCCAGCCAGGG + Intergenic
946280925 2:218664939-218664961 CAGATCTCCTGAGGCAGCCTGGG - Intronic
946500843 2:220245674-220245696 TAGCTGACCTAGGGCAGACATGG - Intergenic
947668574 2:231922779-231922801 CAGCTATCCAGGGTCATCCAGGG - Intronic
947828776 2:233124597-233124619 CAGCTGTTCAGGTGCAGCCAGGG - Intronic
948459805 2:238123678-238123700 CAGCTGTCCTGGGACACCGGGGG - Intronic
948836776 2:240629685-240629707 CTGCTGTCATGGGGCAGGAAAGG - Intronic
948896480 2:240930173-240930195 CAGGGGGCCTGGGGCAGCCCCGG + Exonic
949077298 2:242069054-242069076 CAGCTTTCCTGGGTCACCAATGG + Intergenic
1169722823 20:8697747-8697769 CAGTTGTCATGGTGAAGCCATGG - Exonic
1170844934 20:19954393-19954415 GCCCTATCCTGGGGCAGCCAAGG - Intronic
1170868982 20:20187282-20187304 CAGCTGTCATGAGGCAGGAATGG + Intronic
1171193525 20:23179082-23179104 CTCCTGTGCTGGGGCAGGCATGG + Intergenic
1171727794 20:28641487-28641509 AAGCTGTCCTGGGCCACACATGG - Intergenic
1172834728 20:37865754-37865776 CAGATGCCCAGGAGCAGCCATGG + Intronic
1174249416 20:49207331-49207353 CTTCTGTCCTGGAGGAGCCAGGG + Intergenic
1174451053 20:50620731-50620753 CTGCTCTCCAGTGGCAGCCATGG - Intronic
1175246170 20:57583454-57583476 CAGCTGACCTGGGGTACGCAAGG + Intergenic
1175520655 20:59600614-59600636 CCTCTGCCCAGGGGCAGCCAGGG - Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1175970711 20:62685298-62685320 AAGGTGTCGGGGGGCAGCCAGGG - Intronic
1175988554 20:62776453-62776475 CACCTGTCCCTGGGCAGCCACGG + Intergenic
1176045528 20:63090849-63090871 CAGGTGTCCTGGGGAAGGGAAGG - Intergenic
1176084275 20:63288983-63289005 CAGCACTCCTGGAGCAGCCTGGG + Exonic
1176237164 20:64058798-64058820 CATCTGTGCCGGGTCAGCCACGG + Intronic
1176239390 20:64068915-64068937 CAGCTGTCTGGGGGGAGACAAGG - Intronic
1176266712 20:64213102-64213124 TAGCTGCTCTGGGGCAGCCCAGG - Intronic
1177598117 21:23273265-23273287 CAGCTGTCTAGGGACTGCCAAGG + Intergenic
1177692749 21:24532190-24532212 CCTGTGACCTGGGGCAGCCAAGG + Intergenic
1178256989 21:31062558-31062580 CAGCTTTCCTTGGGCTGCAAGGG + Intergenic
1178690113 21:34743458-34743480 CTGCTGTCCAGGGTCAGCCACGG + Intergenic
1179066011 21:38025550-38025572 CAGTTCTGCTGGGGAAGCCATGG - Intronic
1179248036 21:39650078-39650100 CACCTCCCCTGGGGCAGGCAGGG - Intronic
1179600034 21:42471378-42471400 CACCTGTCCTGTGGCCGCCCAGG - Intergenic
1179809901 21:43864385-43864407 CCGCTGTCCTGGGGCTGAGAGGG + Intergenic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1179931176 21:44571981-44572003 CAGCTGTCCTGCGTCTGCCCAGG - Intronic
1180049242 21:45323864-45323886 CAGCATTCCTGGGGCCACCAGGG + Intergenic
1180484700 22:15784457-15784479 CATCTGTCCTGTGGGAGCCCGGG - Intergenic
1180704325 22:17799606-17799628 CTCCTGGCCTGGGGCAGCCTTGG + Intronic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1181953164 22:26569337-26569359 AAGGTGTCCTGGGGCAGGGAGGG + Intronic
1182750142 22:32634851-32634873 AAGCTGTCCTGGGCCACACATGG - Intronic
1182760842 22:32721234-32721256 CACCTCCCCTGGTGCAGCCATGG + Intronic
1183031522 22:35110064-35110086 TAGATGTTCTTGGGCAGCCAGGG + Intergenic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
1183469146 22:37996506-37996528 AAGCTCTCCAGGGGCTGCCAGGG - Intronic
1183578219 22:38706024-38706046 CAGCTCCCCGGGGGCGGCCAGGG + Exonic
1183616292 22:38947768-38947790 CATTGGTCCTGGGGCTGCCAGGG + Intergenic
1183648254 22:39139086-39139108 CAGCTCTCCTGGGACATTCAAGG - Intronic
1184490824 22:44807791-44807813 CAGCAGTCCTGGGCCTTCCAGGG + Intronic
1184735769 22:46396986-46397008 CATGTGTCCTGGGGCAGCCTGGG - Intronic
1185003352 22:48260170-48260192 CTGCTGTTCAGGGGCAGCCATGG + Intergenic
1185250674 22:49800019-49800041 CGGCTGTCCTGAGGCTGGCAGGG - Intronic
949355867 3:3179786-3179808 CTGCTCCCCTGGGGCCGCCAGGG - Intergenic
950680894 3:14584420-14584442 CAGCAAGCCTGGGGCAGCGATGG - Intergenic
951492726 3:23290802-23290824 CAGCAGTTCTGGGGAGGCCAAGG + Intronic
952181480 3:30920894-30920916 CAGCTGTCCTCTGCCAGCAAGGG - Intergenic
953265222 3:41380618-41380640 CAGTTGGCCTGGGACAGTCAAGG + Intronic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
954029024 3:47804764-47804786 CATCTGCCCTGAGGCAGCTATGG + Intronic
954392454 3:50274795-50274817 CAGCTGTCCGGGAGCACCAATGG + Intronic
954415696 3:50392259-50392281 CAGCTATGCTCGGGCTGCCAGGG - Intronic
954622185 3:52002589-52002611 CAGTTGGCCTCAGGCAGCCAAGG + Intergenic
955432164 3:58857629-58857651 TAGCAGTTCTAGGGCAGCCAAGG - Intronic
955631596 3:60981108-60981130 CAGAAGTACTGGGGCAGCCAGGG - Intronic
959593289 3:108102312-108102334 CAGTTGTCCTGGACCAGCCGGGG - Intergenic
960269554 3:115658947-115658969 GAGCAGCCCTGGGTCAGCCAAGG + Intronic
960971551 3:123143488-123143510 CGGCTCCCCTGGGGCTGCCAGGG + Intronic
961020897 3:123505993-123506015 GAGCTGGCCTGGGGCGGCCAGGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
962813082 3:138975311-138975333 CAGCTCTGCTGGGGAAGCCAGGG + Intergenic
962839422 3:139220527-139220549 CAGCTTTGCTGGGGCAGCGTTGG + Intronic
962865461 3:139444906-139444928 CCGCTGGCCTGGGCAAGCCAGGG - Intergenic
962866431 3:139451459-139451481 CTCCTCTCCTGGGGCAGACAGGG - Intergenic
962955458 3:140262356-140262378 CAACTGCCCAGGGGCAGGCATGG + Intronic
963034527 3:141013856-141013878 GATCTTTCCTGGTGCAGCCAGGG - Intergenic
963856642 3:150260555-150260577 CAGCTGTCCTGCGTCAGGAAAGG - Intergenic
963915428 3:150855023-150855045 CAGTTTTCCTGGGGAAGCCAAGG + Intergenic
964436568 3:156659419-156659441 CAGCTGCCTTGGTGCAGGCATGG - Intergenic
965601469 3:170458723-170458745 CACCTGTCCAGGGGCAGTCCAGG + Intronic
966254263 3:177899496-177899518 CAGCAGGCCTGGGCCAGCCCAGG + Intergenic
967051061 3:185785008-185785030 CAGCTGACGTGGGACAGGCACGG + Intronic
967719992 3:192806008-192806030 CAGCAGTCTTGGTACAGCCAGGG - Intronic
967818114 3:193815921-193815943 CACCTGGCCTTGGGCAGACAAGG - Intergenic
968362583 3:198157650-198157672 CACCTTTCCTCGGGCAGCCTCGG - Intergenic
968371285 3:198224000-198224022 AAGCAGTGGTGGGGCAGCCAGGG + Intergenic
968509388 4:988691-988713 CAGCTGCCCTGGGGAAACCGGGG - Exonic
968521402 4:1036213-1036235 TAACTGTGCTGGGGCACCCATGG + Intergenic
968531508 4:1094317-1094339 CAGCTGTCCGGTGACATCCAAGG + Intronic
968595485 4:1480137-1480159 CAGCAGCAATGGGGCAGCCATGG + Intergenic
968703526 4:2067570-2067592 CGCCTGCCCTGGGGCACCCAGGG + Exonic
968975845 4:3821702-3821724 CAGCAGGGCTGGGGCAGGCAGGG + Intergenic
969429374 4:7145266-7145288 CAGCTGCCCAGGGGCAGCAGGGG - Intergenic
969476872 4:7426959-7426981 CAGGCTTCCTGGGGCAGCCATGG + Intronic
969483598 4:7459623-7459645 CATCTGTCCTGGCCCAGCCTGGG + Intronic
969548832 4:7850694-7850716 CTGCTGGTGTGGGGCAGCCATGG + Intronic
969613281 4:8238583-8238605 CGGCAGGCCTGGGGCTGCCAGGG + Intronic
969621502 4:8281095-8281117 CAACTCTCCAGGGGCAGCCAGGG - Intronic
970586533 4:17519748-17519770 CAGCTTTCCTAGGGCAGCACTGG + Intronic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
971282365 4:25251367-25251389 CCGCTGCCCTGGTGCAGGCATGG + Intronic
973027597 4:45292763-45292785 CCACTGTGCTGGGGCAGCCGAGG + Intergenic
975224082 4:71849220-71849242 CAGTTGTCCCGTGGTAGCCATGG - Intergenic
975890270 4:79019203-79019225 CAGCTGTCCTTGAGAAGTCAGGG + Intergenic
975916691 4:79333598-79333620 CATCTGTCCTTGGGAGGCCAAGG + Intergenic
978139947 4:105307050-105307072 AAGCTGGGCTGGGACAGCCAAGG + Intergenic
980158481 4:129133609-129133631 CTGCTGCCCTGGTACAGCCAAGG + Intergenic
980680406 4:136152589-136152611 CAGCACTCCTGGCTCAGCCAGGG + Intergenic
981567077 4:146113211-146113233 CCGCTGTCCTGCGGCAGCCATGG - Intergenic
982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG + Intergenic
985481070 5:111282-111304 CAGCTTCCCTGGGGCAGCTCTGG + Intergenic
985575731 5:672633-672655 CAGGGGTCCTGAGGCACCCATGG + Intronic
986802257 5:11273950-11273972 TAGATTTCCTGGGGCGGCCAGGG + Intronic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
990545257 5:56815683-56815705 CAGCAGTCCCGCGGCAGCCGCGG - Exonic
990891928 5:60659532-60659554 CAATTTTCCTGGGGAAGCCAAGG + Intronic
994753348 5:103764887-103764909 CAGCTGTAGTGGGGGAGGCATGG - Intergenic
995625444 5:114071289-114071311 CAGCTGTGATGGGGCTACCATGG - Intergenic
999295924 5:150459381-150459403 GAGCTGGCCTGCGGCAGGCAGGG - Intergenic
1000184249 5:158843577-158843599 CATCTGTCGTGGGGAAGACACGG + Intronic
1001902873 5:175445477-175445499 GAGCTTGCCTGGGGCAACCAGGG - Intergenic
1001984356 5:176061157-176061179 CCGTGGTCCTGGGGCAGCCCGGG + Intronic
1002166774 5:177352403-177352425 CAGCTTTCCTGGGCCTTCCATGG - Intergenic
1002233121 5:177782908-177782930 CCGTGGTCCTGGGGCAGCCCTGG - Intronic
1002256154 5:177959676-177959698 CAGCGGTGATGGGGCAGCCATGG - Intergenic
1002262859 5:178006873-178006895 CCGTGGTCCTGGGGCAGCCCGGG + Intronic
1002575667 5:180172426-180172448 CAGGGGTCATGAGGCAGCCAAGG + Intronic
1002594182 5:180311623-180311645 CAGCTGTCCAGTGGCAGCTCTGG + Intronic
1002730523 5:181329546-181329568 AAGCAGTGGTGGGGCAGCCAGGG + Intergenic
1002969442 6:1998825-1998847 CAGCTGTCCCTTGGCATCCATGG - Intronic
1003062669 6:2875422-2875444 CCGCTGCCCTGGGGCTGCCCTGG - Intergenic
1003960943 6:11208618-11208640 CAGCAGTCAGGAGGCAGCCATGG + Intronic
1004013854 6:11714493-11714515 CAGGTGACATGAGGCAGCCACGG - Exonic
1004236464 6:13879089-13879111 CAGTTTTCCTGGGGAAGCCGAGG + Intergenic
1006088716 6:31615435-31615457 CAGCTGGCCTAGGGTAGCCCGGG + Intronic
1006288647 6:33117236-33117258 CAGGGCTCCTGGGGCAGCCGTGG + Intergenic
1006437409 6:34033159-34033181 AAGCAGCCCTGGTGCAGCCATGG - Intronic
1006514621 6:34539088-34539110 CAGCTCTCATGGGACAGCCCTGG - Intronic
1006515073 6:34541231-34541253 CTGCTGTGATGGGGCACCCATGG + Intronic
1006740701 6:36306454-36306476 CAGAGTTCCTGGGGCAGCTAAGG - Intronic
1007442818 6:41878238-41878260 CAGGTGTTCTGGGGCAGGCTGGG + Intronic
1007498679 6:42279372-42279394 CAGCTGTCCTGGGCAGGGCAGGG + Intronic
1007614908 6:43174164-43174186 CACCTGTCCTGGGCCAGAAAGGG - Intronic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1009843694 6:69109328-69109350 CAGTTGTCCTGGGGCAATGAGGG + Intronic
1010893134 6:81337980-81338002 CAGTTTTCTTGGGGAAGCCAAGG + Intergenic
1011540269 6:88420709-88420731 CAGTTTTCTTGGGGAAGCCAAGG - Intergenic
1013021873 6:106228902-106228924 CAATTTTCCTGGGGAAGCCAAGG + Intronic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1015279865 6:131421545-131421567 AAGCTGTCCTGGGGGAAGCAAGG - Intergenic
1015559888 6:134503166-134503188 CAGCTGCCCTGGTGCACCCTTGG + Intergenic
1017720869 6:157242281-157242303 AAGCTGCCCTGGGGCAGCATGGG - Intergenic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018038714 6:159903354-159903376 CAGCTGTCCAGGTGCCGACATGG - Intergenic
1018619227 6:165714543-165714565 GGGCTGGGCTGGGGCAGCCAGGG + Intronic
1019253099 7:31057-31079 CACCTTTCCTCGGGCAGCCTCGG + Intergenic
1019427914 7:986054-986076 CTGCTGCCCTGGGGCTGCCCCGG - Intronic
1019481701 7:1269949-1269971 CAGCTCAGCTGGGGCAGCCTCGG - Intergenic
1019564773 7:1673873-1673895 GAGCTGTCCTGGGGCAGCTGGGG + Intergenic
1019615524 7:1957922-1957944 CAGCTGAGCAGGGGCCGCCACGG - Intronic
1019888020 7:3922232-3922254 CAGCTAAGCTCGGGCAGCCATGG + Intronic
1020365642 7:7378084-7378106 GAGATGTCCACGGGCAGCCAAGG + Intronic
1024534796 7:50421254-50421276 AAGCTGCCCAGGTGCAGCCAGGG + Intergenic
1024619692 7:51146921-51146943 CACCCCTCCTGGGGCTGCCAGGG - Intronic
1027269118 7:76510645-76510667 CAGCTGTCATGGGGCTACCCTGG + Exonic
1028857961 7:95613295-95613317 CCACTGTACTGGGGGAGCCAAGG - Intergenic
1029327623 7:99823443-99823465 GATCGGTCCTTGGGCAGCCATGG - Intergenic
1029979332 7:104863510-104863532 AAGCTGTCCTGAGGCAGCTCAGG - Intronic
1030336934 7:108338082-108338104 CAATTTTCCTGGGGAAGCCAAGG + Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1032725444 7:134586449-134586471 CAATTTTCCTGGGGAAGCCAAGG + Intergenic
1032829356 7:135607688-135607710 CACCTGTCATGGGGCAGAGATGG - Intronic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1034400041 7:150856310-150856332 AGGCTGTCCTGGGGCAGCTGGGG - Intronic
1034468256 7:151242435-151242457 CAGGTGTCCTGGGGTGGGCATGG - Intronic
1035048487 7:155984438-155984460 CAGCTGGAGTGGGACAGCCAGGG - Intergenic
1035242852 7:157543465-157543487 AGGCTGTCCTGGGACAACCACGG + Intronic
1035535851 8:390938-390960 CAGCTTTCCTGGGTCACCAATGG + Intergenic
1035725498 8:1823286-1823308 CAGCTGCCCTGGACCAGCCAAGG - Intergenic
1036086195 8:5615835-5615857 CAGCTGTCCTGGCCGTGCCAAGG + Intergenic
1036605688 8:10303614-10303636 GAGGGGTCCTGGGGCAGTCAGGG - Intronic
1037562734 8:20089169-20089191 CCTCTGTCTTGGGGCAGCCCTGG + Intergenic
1039548845 8:38429211-38429233 GAGCTGTGCGAGGGCAGCCAGGG - Intronic
1039588648 8:38728569-38728591 CATCTCTCCTGGGGAAGCCACGG - Intronic
1039661393 8:39471004-39471026 CAGCTGTCCTCTGCCAGCGAGGG - Intergenic
1040295045 8:46144721-46144743 CAGCCTTCCTGGGCCAGCCCAGG + Intergenic
1040304018 8:46202780-46202802 CAGCACTCCTGGGGCAGCCCTGG - Intergenic
1040325517 8:46339562-46339584 CAGCTTTCCCGGGAAAGCCATGG - Intergenic
1040329972 8:46380922-46380944 CAGCCTTCCTGGGTCAGCCCGGG - Intergenic
1040332111 8:46391001-46391023 CAGCCCTCCTGGGACAGCCCTGG - Intergenic
1040334601 8:46409661-46409683 CAGCCCTCCTGGGACAGCCCTGG - Intergenic
1040334780 8:46410515-46410537 CAGCCTGCCTGGGGCAGCCCTGG - Intergenic
1040339496 8:46433293-46433315 CAGCTGGCCAGGGACAGCCCTGG - Intergenic
1040340268 8:46436974-46436996 CAGCTCACCTGGGACAGCCCTGG + Intergenic
1040417397 8:47207436-47207458 CAGCTGCCCTGGAGCAGCCCTGG - Intergenic
1041632431 8:60103250-60103272 CAGCTGGCCTGGGTGAGGCAGGG - Intergenic
1042055763 8:64763708-64763730 CAGTTTTCCTGGGGAAGCCGAGG + Intronic
1042372348 8:68006160-68006182 CAACTGCCCTGGTGCAGCCCTGG + Intronic
1042509766 8:69598680-69598702 AAGCTGTTTTGGGCCAGCCATGG - Intronic
1042746992 8:72119205-72119227 CAACAATCCTGGGGCAGCCATGG - Intergenic
1042819898 8:72918769-72918791 CAGCTGGCCAGTGGCAGCCAGGG + Intronic
1045053021 8:98343769-98343791 CAGCTTTCCTAGTGCAGCCTGGG + Intergenic
1045501109 8:102745122-102745144 CTGCTGGCCTGGAGCAGCCAGGG + Intergenic
1047529316 8:125660778-125660800 TAGCTGTCCTGAGGCTGGCATGG + Intergenic
1048015363 8:130491788-130491810 CAGCTTTCTTGGGGAAGCGAGGG + Intergenic
1049137908 8:140922165-140922187 CAACTGTCCTGGGGCATCACTGG - Intronic
1049231999 8:141489292-141489314 CAGTTGTCCTGGGGCCATCAAGG - Intergenic
1049422483 8:142523104-142523126 CAGCAGGCCTGTGGCAGGCAGGG + Intronic
1049446118 8:142632397-142632419 CATTTGTCCTGGGGCCACCAGGG - Intergenic
1049757773 8:144318415-144318437 CATCTGTCTCGGGCCAGCCACGG - Intronic
1049761922 8:144335646-144335668 CAGGTGTCCTGGTGCAGTCAAGG + Intronic
1049798165 8:144505808-144505830 CAGCAGTGCTGGGTGAGCCAAGG - Intronic
1049805774 8:144538145-144538167 CAGCAAGGCTGGGGCAGCCATGG + Intronic
1052856692 9:33411311-33411333 CTGCTGTGCAGGGGCAGTCATGG + Intergenic
1053721945 9:40955596-40955618 AAGCTGTCCTGGGCCACACATGG + Intergenic
1056554249 9:87676011-87676033 CAGGAGACCTGGGGCATCCAGGG - Intronic
1056717264 9:89042458-89042480 CTGCGGTCTTGGGGCAGCAAGGG - Intronic
1056796048 9:89659666-89659688 CATCTCCCCTGGGCCAGCCAAGG - Intergenic
1057024596 9:91725452-91725474 CAGCTGCCCTGGGGCTGCCCCGG + Intronic
1057206107 9:93173568-93173590 CAGGTGTGCTGGGGCAGCTTGGG - Intergenic
1057208398 9:93186408-93186430 TAGCTGTCCTGGGACAGCCTAGG + Intronic
1058762930 9:108153532-108153554 CAGCCTTCCTGGGGCAGGAAGGG + Intergenic
1058941854 9:109820865-109820887 TTTCTGTCCTGGGGCAGCCATGG + Intronic
1059761586 9:117342844-117342866 CATCTCTTCTGGGGAAGCCAAGG + Intronic
1060793715 9:126501533-126501555 CATCTGTCCCGGGTCAGCCTGGG + Intronic
1061288747 9:129639120-129639142 CTGTTGTCCTGGGGCACCCTGGG + Intronic
1061577881 9:131518894-131518916 AAGCTGTCCCGGGGCTACCACGG + Exonic
1061621215 9:131812471-131812493 CTGCTGCTTTGGGGCAGCCAGGG - Intergenic
1061672606 9:132197573-132197595 CAGCTGTCCCGGGGAGGCCCAGG + Intronic
1061806365 9:133139718-133139740 CCGCTGCCCTTGGGGAGCCAGGG - Intronic
1061935088 9:133853108-133853130 CTGCTGTCCTGGGCCTGCCACGG - Intronic
1061939872 9:133878199-133878221 CTGCTGACATGTGGCAGCCAGGG + Intronic
1062103596 9:134740789-134740811 CAGCTGCCGTGGAGGAGCCAAGG + Intronic
1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG + Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062318635 9:135979879-135979901 CGGCTGTGCTGGTTCAGCCATGG - Intergenic
1062429328 9:136520006-136520028 CAGCTTCCCTGGGGCTGCGAGGG - Intronic
1062539771 9:137036373-137036395 GAGCTGCCCTGGGGCCCCCAGGG - Exonic
1062616145 9:137396905-137396927 CAGCTGTCCTGGGGCTGCCTTGG - Intronic
1062747271 9:138221309-138221331 CACCTTTCCTCGGGCAGCCTCGG - Intergenic
1062754934 9:138282056-138282078 AAGCAGTGGTGGGGCAGCCAGGG + Intergenic
1203421193 Un_KI270448v1:7856-7878 AAGCTGTCCTGGGCCACACATGG + Intergenic
1203421766 Un_KI270521v1:7372-7394 AAGCTGTCCTGGGCCACACATGG + Intergenic
1203578843 Un_KI270745v1:26225-26247 AAGCAGTGGTGGGGCAGCCAGGG + Intergenic
1186247161 X:7626425-7626447 GGGCTGTCCTGGGAAAGCCAAGG - Intergenic
1189392647 X:40589645-40589667 CAGTAGCCATGGGGCAGCCAAGG + Intronic
1192554711 X:72080359-72080381 CAGCTATGCTGAGGCAGCCTGGG + Intergenic
1200067770 X:153512378-153512400 CTGCTGCACAGGGGCAGCCAGGG + Intergenic
1200084017 X:153594119-153594141 CAGCTGTGCTTAGGAAGCCATGG - Intronic
1201458256 Y:14194525-14194547 CAGCTGCCCTCTGGCAGCAAGGG - Intergenic