ID: 1179908073

View in Genome Browser
Species Human (GRCh38)
Location 21:44434410-44434432
Sequence GACGGTGGCAGGGATGCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179908073 Original CRISPR GACGGTGGCAGGGATGCTGT CGG Intronic
900368987 1:2323158-2323180 GATGGTGTGAGGGCTGCTGTGGG + Intronic
901763066 1:11483068-11483090 GCCGGAGGCATGGATGCTGCGGG + Intronic
902800283 1:18825303-18825325 GATGGTGGTAGTGATGATGTTGG - Intergenic
902800315 1:18825521-18825543 GACGGTGGTAGGGGTGATGTTGG - Intergenic
902800324 1:18825569-18825591 GATGGTGGTAGTGATGATGTTGG - Intergenic
902800356 1:18825787-18825809 GACGGTGGTAGGGGTGATGTTGG - Intergenic
903227433 1:21901814-21901836 GACCGTGGCAGGGAGGCAGGTGG - Intronic
903551431 1:24159652-24159674 GAGAGTGGCAGAGCTGCTGTGGG + Intronic
903816319 1:26066936-26066958 GAGGGTGTCAGGGAGGCAGTGGG - Intronic
904408788 1:30312338-30312360 GATGGGGGCAGGGCTGCTGGGGG + Intergenic
905965647 1:42093150-42093172 GATGGTGGCAGGGCTGCCCTAGG - Intergenic
906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG + Intronic
906664736 1:47612518-47612540 CATGGGGGCAGGGATGCTTTGGG - Intergenic
909206085 1:72759512-72759534 GAGGGTGGCAGGGAGGCTCAGGG - Intergenic
911347233 1:96711686-96711708 GACAGTGTCAGGCATGCTTTAGG + Intergenic
911956385 1:104241036-104241058 GAGAGTGGCAGGGAGGCTATGGG + Intergenic
913046202 1:115075376-115075398 GGCTGTGTCAGGGATGCTGTGGG + Intronic
913300403 1:117363911-117363933 GACAGTGGGAAGAATGCTGTTGG - Intergenic
915068313 1:153244531-153244553 GATGGTGGCAGTGGTGGTGTTGG + Intergenic
916373586 1:164126668-164126690 CAAGGTGGCAGCGAGGCTGTGGG - Intergenic
916534495 1:165690788-165690810 GAAGGTGGCAGTGAAGCTGGGGG + Intronic
918447612 1:184630714-184630736 GCCAGTGGCAGGGATGATGGTGG - Intergenic
919783544 1:201239824-201239846 CACGGTGGCAGCGAGGCTGGGGG - Intergenic
919785997 1:201259177-201259199 GAGGGAGGCAGGGCTGCAGTGGG + Intergenic
919850746 1:201670535-201670557 GATGGTGGCAGTGATGGTGATGG + Intronic
919850758 1:201670681-201670703 GATGGTGGTAGAGATGCTGGTGG + Intronic
919989832 1:202702140-202702162 GAGGGTGGCAGGGGTGCCCTGGG - Intronic
920675378 1:208034524-208034546 GGCAGAGGCAGGGATGTTGTAGG + Exonic
922224324 1:223632144-223632166 GAGGCTCGAAGGGATGCTGTGGG + Intronic
923280583 1:232439308-232439330 GATGGTGGCAGGCATGCAGGGGG + Exonic
1063139970 10:3247372-3247394 GACGGTGGCAGTGAAACTGCGGG + Intergenic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1064310643 10:14208978-14209000 GCCCGTGGTAGGGAGGCTGTGGG + Intronic
1067574457 10:47400427-47400449 CACAGTGGGAGGGAGGCTGTGGG + Intergenic
1068744007 10:60508496-60508518 GCAGGTGCCATGGATGCTGTTGG - Intronic
1069057250 10:63857402-63857424 CAAGGTGGCAGTGAGGCTGTGGG - Intergenic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1071495289 10:86163760-86163782 CTCGGTGGCAGGGATGGTGGGGG + Intronic
1071544302 10:86516605-86516627 GAGGGTGGCAGGGAAGAGGTGGG - Intronic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1074044653 10:109826239-109826261 TAAGGTGGCAGCGAGGCTGTGGG + Intergenic
1075088157 10:119427912-119427934 GATGATGGCAGTGATGCTGACGG - Intronic
1075241880 10:120786613-120786635 GTGGGAGGCAGAGATGCTGTAGG - Intergenic
1075629355 10:123991807-123991829 GACGGTGGCAGGGGTGGTAGCGG + Intergenic
1075879599 10:125839399-125839421 GCAGGTGGCATGGGTGCTGTCGG - Intronic
1076691789 10:132227408-132227430 GACGATGGCAGTGATGGTGGTGG + Intronic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1076811458 10:132888588-132888610 GAAGGTGGCAGGGGTGCAGGCGG - Intronic
1076853032 10:133102449-133102471 GACGGGAGCAGGGAGTCTGTGGG - Intronic
1077096299 11:800527-800549 GATGCTGGTAGGGATGCTGGTGG - Exonic
1078093881 11:8284625-8284647 GACCATGGGAGGGATGCTGAGGG - Intergenic
1081748526 11:45489881-45489903 GCAGGTGGCAGGGATGGTGGAGG + Intergenic
1081990032 11:47332763-47332785 GGCTGGGGCAGGGAGGCTGTGGG - Intronic
1083328475 11:61885732-61885754 GAGTGTGGCAGGGCTGCTGAGGG + Intronic
1083994227 11:66264256-66264278 GAGGGAGGCAGGGATGAGGTTGG + Intronic
1084157666 11:67323252-67323274 CTAGGTGGAAGGGATGCTGTCGG + Intronic
1084594560 11:70109252-70109274 CGTGGTGGCAGGAATGCTGTGGG + Intronic
1085200542 11:74699225-74699247 GAAGGTGGCAGGGATGAGGGCGG + Intronic
1086358605 11:86033374-86033396 GAAGATGGCAGTGATGCAGTGGG - Intronic
1087860008 11:103141924-103141946 CAAGGTGGCAGCGAGGCTGTGGG - Intronic
1089169190 11:116500491-116500513 GAAGGTGGCCGGGAGGCTGTGGG - Intergenic
1089606864 11:119646418-119646440 GACGGTAACGGGGATGATGTTGG + Intronic
1090086093 11:123652521-123652543 TACGGTGGCAGACATGCTGATGG - Intronic
1090918436 11:131187178-131187200 GGAGGTGGGAGGGATGCTGGCGG + Intergenic
1092121533 12:6047466-6047488 GACAGTGGCAGGGATGATCTTGG - Intronic
1092254577 12:6919436-6919458 AAGTGTGGCGGGGATGCTGTTGG - Intronic
1093603314 12:21057887-21057909 GAGGGTGGCAGGGATGGGATGGG - Intronic
1094167441 12:27457031-27457053 GACAGTGGGAGGGATGGTTTTGG - Intergenic
1094779384 12:33773281-33773303 GAAGGTGGCAGTGAGGCTGGGGG + Intergenic
1096448064 12:51712768-51712790 GACGGTGGCAACTATGCTGGTGG - Intronic
1100384351 12:94091748-94091770 GTCTGTGGGAGGGAAGCTGTGGG - Intergenic
1101270111 12:103133751-103133773 TGTGGTGGAAGGGATGCTGTGGG + Intergenic
1101470543 12:104992844-104992866 GACCTTGGCAGGGATGTTTTGGG - Intronic
1101744540 12:107528780-107528802 GATGGTGGCAGTGATGGTGACGG + Intronic
1102575583 12:113854239-113854261 GTCTTTGGCAGGGATGGTGTAGG - Intronic
1102799296 12:115717577-115717599 GAAGGGGACAGGGATGCTCTGGG + Intergenic
1104910895 12:132240511-132240533 GTCGCTGGCAGTGCTGCTGTGGG + Intronic
1104988433 12:132610756-132610778 TAGGGTGGTGGGGATGCTGTGGG - Intergenic
1105886734 13:24649099-24649121 GGGGGTGGCAGGGCTGCTGGAGG - Intergenic
1107833928 13:44398567-44398589 GAAGGGGGAAGGGATGCTTTTGG - Intergenic
1108926026 13:55746382-55746404 GAAGGTGGCTAGGCTGCTGTAGG - Intergenic
1112346292 13:98592792-98592814 GATGGTGCCAGGGCTACTGTGGG + Intergenic
1112631826 13:101170008-101170030 CAAGGTGGCAGGGATACTGCTGG - Intronic
1113629659 13:111873689-111873711 GGCGGGGGCAGAGCTGCTGTTGG + Intergenic
1118911348 14:70064551-70064573 GGCGGCGGCGGGGATGCTGGGGG + Intronic
1119526319 14:75325208-75325230 GAAGGTGGCTGGGATGCAGGAGG + Intergenic
1119658805 14:76436220-76436242 GACGGGTGCAGGGAGGCAGTTGG + Intronic
1122244585 14:100393516-100393538 GGTGCTGGCAGGGCTGCTGTGGG + Intronic
1122290647 14:100678669-100678691 GGTGGAGGCAGGAATGCTGTGGG + Intergenic
1122613431 14:103001139-103001161 GGCGGTGGCAGGGAGGCTTGAGG - Intronic
1122769563 14:104091969-104091991 GAAGGTGGCAGAGTTGCTGGGGG + Intronic
1122791098 14:104184517-104184539 GTTGGTGGCAGGGAGGCTGGTGG + Intergenic
1123038758 14:105481891-105481913 GTCGGTTGCGGGGATGATGTGGG + Intergenic
1124212795 15:27777011-27777033 GAAAGTGGCAGGGCTGGTGTGGG - Intronic
1126800192 15:52291258-52291280 GAAGGTGGCCTGGATGCTGAGGG + Intronic
1126937988 15:53733078-53733100 CATGATGGCAGTGATGCTGTGGG + Exonic
1128462861 15:67884554-67884576 GTCGGTGGCAGGGATGGCGCTGG + Intergenic
1128565857 15:68700082-68700104 GAAGGAGGCAGGGAGGCCGTGGG - Intronic
1128655921 15:69462062-69462084 GACGAAGGCGGAGATGCTGTTGG + Intergenic
1129007200 15:72383836-72383858 GACAGTGGAAAGGAGGCTGTGGG + Intergenic
1129734649 15:77952754-77952776 GGGGGTGGCAGTGCTGCTGTAGG - Intergenic
1129840941 15:78743237-78743259 GGGGGTGGCAGTGCTGCTGTAGG + Intergenic
1129851522 15:78796546-78796568 GCGGGTGGCGGGGATGGTGTTGG - Intronic
1129923356 15:79339611-79339633 GAGGGTGGCAGTGATGGTGGCGG + Intronic
1130744610 15:86637679-86637701 GAGGGTGGCAGGGGTGGTGGTGG + Intronic
1130912340 15:88279441-88279463 GACGGTGTGAGGAATGCTGCTGG + Intergenic
1132501504 16:286483-286505 GAGGGAGGCAGGGGTGGTGTGGG + Intronic
1132512047 16:348133-348155 GACCATGGCAGGGGTTCTGTTGG - Intronic
1133443774 16:5842472-5842494 CACAGTGGCAGGCATGCAGTAGG - Intergenic
1135643942 16:24145050-24145072 GAAGGTGGTAGGGAGGGTGTTGG + Intronic
1136096813 16:27962862-27962884 GACTGTGGGAGGGATGATGGGGG - Intronic
1136555005 16:31002356-31002378 GTCGGTGGCAGTGGTGCTGTGGG - Intronic
1137738680 16:50743080-50743102 GAAGGTGGCAGGGATGATGGGGG - Intronic
1138103646 16:54274823-54274845 GAATGGGGCTGGGATGCTGTGGG - Intergenic
1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG + Exonic
1140252273 16:73304605-73304627 GAAGGGGGCAGGGATGCTGTGGG - Intergenic
1140600679 16:76471562-76471584 GACGGTGCCATGGAGGCTGGAGG - Intronic
1141110415 16:81266898-81266920 GCTGGTGGGAGGGATGCTGTGGG - Intronic
1141134947 16:81459048-81459070 GACGGTGACAGTGATGGTGATGG - Intronic
1141550964 16:84806492-84806514 GATGGTGGCGGTGATGCCGTGGG + Intergenic
1141563589 16:84886414-84886436 GACTGTGCCAGGGATGGTGGTGG + Intronic
1142304332 16:89277189-89277211 GTCGGTGGCAGGGATTCTGTGGG + Intronic
1145403935 17:22569715-22569737 CATGGTGGCAGGGGTGGTGTCGG - Intergenic
1146727481 17:35168109-35168131 GACAGTGTCAGGGATCCTGCAGG + Exonic
1148700350 17:49583070-49583092 GTGGGTGGCAGGGATCCTGGGGG + Intronic
1149607731 17:57936555-57936577 GACAGTGGCTGGGATGCAGATGG + Intronic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151679058 17:75614410-75614432 GAGTGTGGCAGGGTGGCTGTGGG - Intergenic
1151747429 17:76018880-76018902 GATGGTGGCAGGGGTGAGGTGGG + Intronic
1152293087 17:79451912-79451934 CTGGGTGGCAGGGATGCTGTGGG - Intronic
1152961457 18:82788-82810 GGCAGTGGCAGGGATGAGGTGGG - Intergenic
1153617571 18:6948530-6948552 AATGCAGGCAGGGATGCTGTGGG + Exonic
1154489528 18:14908993-14909015 GAAGGAGACAGGGAAGCTGTCGG + Intergenic
1156387418 18:36618725-36618747 GGAGGTGGCAGGGATGGGGTGGG - Intronic
1156453763 18:37281385-37281407 GACGGTTGCAGGGGCACTGTGGG + Intronic
1156826352 18:41434502-41434524 GAAGGAGGGAGGGATGATGTGGG + Intergenic
1157427997 18:47600580-47600602 GACAGTGGCAGTGGTGGTGTTGG - Intergenic
1160095065 18:75863705-75863727 GATGGTGGCAGGGATGGCGATGG - Intergenic
1160449077 18:78949613-78949635 GAAGGTGCCAGGGCTGCTTTAGG - Intergenic
1160510780 18:79452243-79452265 GTCGGAGGCAGGGATGGGGTGGG + Intronic
1161118174 19:2511084-2511106 GAGGGTGGACGGGATGGTGTGGG + Intergenic
1161187462 19:2931009-2931031 GACGGTGGTGGGGATGCTTGTGG + Intergenic
1161219870 19:3113591-3113613 GCCGGGGGCAGGGATGCGGTGGG + Intronic
1162105504 19:8367338-8367360 GAAGGGGGCAGGGGTTCTGTGGG + Intronic
1162142459 19:8592799-8592821 CTCGGCGGCCGGGATGCTGTTGG + Exonic
1162822192 19:13229714-13229736 AACTGAGGCTGGGATGCTGTTGG + Intronic
1163241039 19:16064140-16064162 GGAGGTGGCTGGGATGCTGATGG + Intergenic
1163720844 19:18897467-18897489 GAAGGTGGCTGCGACGCTGTTGG + Intergenic
1165429908 19:35766761-35766783 GCTGGTGCCGGGGATGCTGTAGG - Exonic
1165458814 19:35931870-35931892 GACGGTGCTGGGGATGCTGAGGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167621510 19:50563452-50563474 GATGGTGGAGGGGATGCTGCTGG + Intronic
1168316507 19:55486857-55486879 GGGGGTGGGAGGGATGCTGGAGG + Exonic
1202649149 1_KI270706v1_random:165142-165164 GATTGTGGCAAGGATGCTGCTGG + Intergenic
925135231 2:1522117-1522139 CACGGTGGCAGGGCCGGTGTCGG - Intronic
925309960 2:2875304-2875326 CAAGGTGGCAGGGCTGCTGGGGG - Intergenic
926313035 2:11688252-11688274 GGAGGTGGCAGGGTTGATGTAGG - Intronic
926420178 2:12688199-12688221 GATGGCAGCAGGGTTGCTGTAGG - Intergenic
927475962 2:23414358-23414380 CGGGGTGGGAGGGATGCTGTGGG + Intronic
929799081 2:45084005-45084027 GAGGGTGGCATGGGTGCTGTTGG - Intergenic
930571140 2:53088570-53088592 GGGGGTGGCTGGGATGCTGATGG - Intergenic
932187698 2:69713061-69713083 GAGAGTGGCAGAGCTGCTGTGGG + Intronic
934551030 2:95261742-95261764 GGAGGTGGGAGGGATGCTGTGGG + Intergenic
935858869 2:107305311-107305333 CGGGGTGGCTGGGATGCTGTTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940414443 2:153403519-153403541 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941619525 2:167760564-167760586 GACGGTGACTGTGATGTTGTTGG - Intergenic
943716236 2:191155227-191155249 CAAGGTGGCAGGGAAGCTGGAGG - Intergenic
946163515 2:217849870-217849892 GGTGGTGGCAGGGAGGCTGAAGG + Intronic
946725239 2:222655744-222655766 GTCGGTGCCAGGCACGCTGTAGG + Intronic
946727137 2:222671836-222671858 GACGGTGGCCGTGCTGCAGTGGG + Exonic
948352295 2:237350921-237350943 GTTGGTGGCAGGGATGGTGGTGG + Intronic
948518502 2:238521311-238521333 GATGGTGACAGTGATGGTGTTGG + Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948854287 2:240722856-240722878 GAAGGTGGCAGGGCTGGGGTGGG - Intronic
1170515413 20:17124452-17124474 GAGGGTGGCAGGGATAGTGAGGG + Intergenic
1171307440 20:24118518-24118540 GAGGCTGGCATGGATGGTGTGGG + Intergenic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1173847639 20:46198117-46198139 GACAGTGGCAGTGTTGCTCTGGG + Intronic
1174313833 20:49681572-49681594 GGAGATGGCAGGGAGGCTGTTGG - Intronic
1174567845 20:51479860-51479882 GAGGGTGGCAGGGAAGCGGGTGG - Intronic
1175648313 20:60694940-60694962 GAAGGTGGGGGGGATGCTTTAGG + Intergenic
1176086608 20:63298105-63298127 GCTGGTGGGAGGGATGCTGTGGG - Intronic
1176602669 21:8807400-8807422 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1178525522 21:33325190-33325212 TACGGGGGCGGCGATGCTGTTGG + Intronic
1179177216 21:39017161-39017183 GACAGTGGCAGGGAAACTGGCGG - Intergenic
1179908031 21:44434248-44434270 GACGGTGGCGGGGACGCTGGCGG + Intronic
1179908039 21:44434284-44434306 GACGCTGGCAGGGATGGTGACGG + Intronic
1179908049 21:44434332-44434354 GACGCTGGCAGGGATGGTGACGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1179908080 21:44434434-44434456 GACTATGGCGGGGATGCTGCTGG + Intronic
1180344954 22:11698957-11698979 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1180352781 22:11817904-11817926 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1180385466 22:12174453-12174475 GATTGTGGCAGGGATGCTGCTGG - Intergenic
1180959864 22:19757654-19757676 GCGGGTGGTAGGGATGCTGGTGG - Intronic
1180972525 22:19822841-19822863 GGCGGTGGCAGTGCTGCTGAAGG - Intronic
1181805121 22:25369950-25369972 GACGGTGCCTGGCATGCAGTGGG - Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1183244112 22:36680378-36680400 GATGGTGGCAGTGATGGTGGTGG - Intronic
1183310599 22:37107504-37107526 GACGGTGGCCTGGATGATGGTGG - Intronic
1184108678 22:42383059-42383081 GTCGGTGGCAGGGCAGCTGCAGG + Exonic
1184242135 22:43216893-43216915 GGGGGTGGGAGGGAAGCTGTTGG - Intronic
1184264337 22:43339048-43339070 GAGGCTGCCAGGGCTGCTGTAGG - Intronic
1184399736 22:44267031-44267053 GACGGTGCCTGGTATGTTGTTGG + Intronic
1185060760 22:48605476-48605498 GGTGGTGGCAGGGATGGTGATGG + Intronic
1185276255 22:49951273-49951295 GACGGGGGCGGGGAGGCTGGGGG + Intergenic
950601043 3:14035734-14035756 GGCAGTGGCAGAGAGGCTGTTGG + Intronic
950716435 3:14850798-14850820 GTGGGTGGGAGGGATGGTGTTGG + Intronic
951001838 3:17571935-17571957 GACAATGACAGGGATGCTGCAGG + Intronic
952173447 3:30835272-30835294 GAGGGTGACAGAGATGCTTTAGG + Intronic
953937911 3:47062319-47062341 GAACGAGGAAGGGATGCTGTTGG - Exonic
954367303 3:50153447-50153469 GAGGATGGAAGGGATGGTGTTGG + Intergenic
955082055 3:55666643-55666665 TGGGGTGGCAGGGATGCTATTGG + Intronic
955082172 3:55667987-55668009 TGGGGTGGCAGGGATGCTATTGG - Intronic
956679658 3:71766665-71766687 GAGGCTGGCAGGGATGCATTTGG - Intergenic
960619887 3:119627620-119627642 GGCGGGGGCAGGGGTGGTGTGGG - Intronic
963978485 3:151509905-151509927 TAAGGTGGCAGGGAGGCTGGGGG + Intergenic
965161598 3:165140089-165140111 CAAGGTGGCAGTGAGGCTGTGGG - Intergenic
969357860 4:6641186-6641208 GAAGATGGCAGAGATGCTGGTGG + Exonic
969501708 4:7557276-7557298 GACGGTGGCAGGGATGGCTGGGG + Intronic
969538463 4:7770930-7770952 GAGAGTGGCAGTGAGGCTGTAGG - Intronic
969641853 4:8403501-8403523 CAGGGTGACAGGGATGCAGTGGG - Intronic
972789814 4:42360584-42360606 GAAGCTGGCAGGGATGCTCCTGG + Intergenic
973375318 4:49282285-49282307 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973376219 4:49288298-49288320 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973377139 4:49294453-49294475 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973378058 4:49300589-49300611 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973379006 4:49306887-49306909 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973380087 4:49314763-49314785 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973381003 4:49320918-49320940 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973382093 4:49327956-49327978 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973385623 4:49512571-49512593 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973993640 4:56435721-56435743 GGCGGGGTCACGGATGCTGTAGG + Intronic
974109543 4:57510907-57510929 GATGGTGGCAGAGAGGCTTTTGG + Intergenic
978545901 4:109872685-109872707 GAGGGTGGTAGGAATGCTGTAGG + Intergenic
981684140 4:147434500-147434522 GAGGGTGGCAGGGATGGGGGTGG - Intergenic
981822436 4:148901539-148901561 GAAGGAAGCAGGGAGGCTGTAGG - Intergenic
984377606 4:178953365-178953387 GGTGGTGGCAGTGGTGCTGTTGG - Intergenic
984377690 4:178953700-178953722 GGCGGTGGCAGTGATGGTGGTGG - Intergenic
985667050 5:1186779-1186801 AAAGGTGCCAGGGATGCTGATGG - Intergenic
985680354 5:1252814-1252836 CAGGGTGGCAGGGATGATGGGGG - Intergenic
985967415 5:3348173-3348195 TAAGGAGGGAGGGATGCTGTGGG - Intergenic
987043649 5:14086363-14086385 GATGGTGGCAGGGATCCTTGTGG - Intergenic
987174268 5:15291471-15291493 AACGGGGGCAGGGATGCTACTGG - Intergenic
989571599 5:42951132-42951154 GCCGGTGGCAGGGGAGCTGCCGG - Intergenic
989977298 5:50601844-50601866 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
990253728 5:53943376-53943398 GAAGGTGGAAGGGATACTGAAGG + Intronic
991052935 5:62291953-62291975 CAAGGTGGCAGCGAGGCTGTGGG + Intergenic
992380741 5:76234619-76234641 GACGGTGGCAGTGATTCTGTGGG - Intronic
994405966 5:99345334-99345356 GAAGGTGGCAGCGAGGCTGGGGG - Intergenic
994565621 5:101442468-101442490 GAAGGTGGCAGCGAGGCTGGGGG + Intergenic
999415816 5:151395117-151395139 CAAGGTGGCAGTGAGGCTGTGGG - Intergenic
999568955 5:152897092-152897114 GATGGTGGCAGGTAGGCTCTGGG - Intergenic
1000093926 5:157954207-157954229 GATGGTGGTAGGGCTGATGTGGG + Intergenic
1003928641 6:10901632-10901654 GACGTGGGGATGGATGCTGTTGG - Intronic
1005046863 6:21651525-21651547 GACGGGGGCAGGGGTGGTGAGGG + Intergenic
1006421128 6:33934935-33934957 GAAGGTGGCAGAGCTGCTGAAGG - Intergenic
1007369722 6:41418378-41418400 GAGGGTGGCAGGGGTGATGGTGG - Intergenic
1007498985 6:42281001-42281023 GACGGTGGGAGGGATGATGAAGG + Intronic
1010603658 6:77862504-77862526 CAAGGTGGCAGCGATGCTGGGGG + Intronic
1011303088 6:85896671-85896693 CAAGGTGGCAGCGAGGCTGTGGG - Intergenic
1011376727 6:86695086-86695108 CACGGTGGCAGCGAGGCTGGGGG - Intergenic
1011507796 6:88067609-88067631 GGCGGTGGCAGGGGTGATGGGGG + Intergenic
1011533527 6:88351230-88351252 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1012279118 6:97308171-97308193 GATGGTGGCAGTGGTGCTGGTGG + Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1014185232 6:118427221-118427243 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1015149911 6:130025422-130025444 GACTGTGGCAGCTATGCAGTGGG + Intronic
1017720203 6:157238480-157238502 GAGGGTGGCAGTGATGGTGGTGG + Intergenic
1017935925 6:159005019-159005041 GAGGGTGGAATGGATGGTGTGGG + Intergenic
1018635044 6:165853961-165853983 CACGGTGGCGGGGAGGCTCTGGG + Intronic
1019011124 6:168844274-168844296 GTCGGTGGCGGGGAGGATGTTGG - Intergenic
1019694536 7:2437925-2437947 GAGGCTGGCAGGGCTGCCGTAGG + Intergenic
1020622365 7:10533630-10533652 GAAGGTGGCAGCGAGGCTGGGGG + Intergenic
1022510893 7:30934218-30934240 GGCCTTGGCAGGGATGGTGTAGG - Intergenic
1022518137 7:30988602-30988624 GAGGGAGGGAGGGATGGTGTGGG - Intronic
1022823703 7:33987224-33987246 GAGGGTGGCAGTGCTCCTGTGGG + Intronic
1022977785 7:35574909-35574931 GAGTGTGGCAGGGAGGCTGAGGG - Intergenic
1023522398 7:41061368-41061390 TGCGGTGCCAGGGATGCTGAGGG + Intergenic
1023642770 7:42277066-42277088 GAGGGTGGCAGGGTTGATATTGG + Intergenic
1025184146 7:56844096-56844118 CAAGGTGGCAGCGATGCTGGGGG - Intergenic
1026023768 7:66729656-66729678 GATGGTGGCAGTGATGATGGTGG - Intronic
1026888396 7:73967918-73967940 GATGGTGGCAGTGATGATGGTGG - Intergenic
1027186110 7:75971769-75971791 GACTGTGGCAGGAAGGCTCTGGG + Intronic
1028497872 7:91482384-91482406 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
1029443596 7:100601149-100601171 GACAGGGGCAGGGATGGGGTGGG + Intergenic
1030066013 7:105659771-105659793 GACGTGGGCATGGAAGCTGTGGG - Intronic
1030978371 7:116155438-116155460 GATGCTGGCAGGTTTGCTGTAGG - Intronic
1032487591 7:132299679-132299701 GAAGGTGGAATGGATGCTGGAGG - Intronic
1033606003 7:142928982-142929004 GAGGGGAGCTGGGATGCTGTGGG - Intronic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1033962215 7:146928861-146928883 CAAGGTGGCAGGGAGGCTGGGGG + Intronic
1034279739 7:149844747-149844769 GACAGTGGCAGGGATGTGGATGG - Intronic
1034913221 7:155015488-155015510 GACGGAGACAGGGATGTTTTGGG + Intergenic
1037426233 8:18757644-18757666 GATGGTGGCTCGGATGCTGGTGG - Intronic
1038521735 8:28238835-28238857 GACGTGGGCAAGGATGCTGAAGG - Intergenic
1039300194 8:36200965-36200987 CACGGTGGCAGCGAGGCTGGGGG - Intergenic
1040858880 8:51978655-51978677 TAGGGTGGGAGGGATGGTGTTGG + Intergenic
1041321828 8:56621566-56621588 AAGGGTAGCAGGGATGCTTTTGG + Intergenic
1043565933 8:81547730-81547752 GACACTGGCAGGAATTCTGTGGG - Intergenic
1043870292 8:85424555-85424577 CAAGGTGGCAGCGAGGCTGTGGG - Intronic
1044644493 8:94424045-94424067 GATGGTGGCAGGGAGGGTCTTGG - Intronic
1044838156 8:96315509-96315531 CATGGTGGCAGGGTTGTTGTAGG - Intronic
1045242150 8:100411951-100411973 GGCTGTGGCTGGGAAGCTGTAGG - Intergenic
1046554792 8:115761512-115761534 GACAGTGGGAGGGAGTCTGTTGG - Intronic
1046557179 8:115789875-115789897 GAATGGGGCAGGGATGGTGTTGG - Intronic
1049720664 8:144114033-144114055 GACGGTGCCAGGGATGAGGGTGG - Exonic
1054982018 9:71217806-71217828 GGCTGTGGAGGGGATGCTGTGGG - Intronic
1055824375 9:80306126-80306148 GGGGGTGGCAGGGATGGTTTCGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1056596698 9:88013655-88013677 GATGGTGGCAGGGAGGGTGGGGG - Intergenic
1056716963 9:89039609-89039631 GACGATGGCGGTGATGCTGATGG - Intronic
1058882489 9:109297633-109297655 GATTGCCGCAGGGATGCTGTGGG - Intronic
1060024826 9:120162173-120162195 CAGGGTGCCAGGGCTGCTGTGGG - Intergenic
1060273101 9:122161296-122161318 GAGGGTGGTAGGAATGCTATGGG + Intronic
1060785333 9:126448099-126448121 GAGGCTGGCAGGGATGTGGTGGG - Intronic
1061192447 9:129089558-129089580 AACGGTGGCAGGGAGGGTGTGGG - Exonic
1061459919 9:130729326-130729348 GAAGGTGGGAGGCATCCTGTGGG - Intronic
1061974137 9:134059904-134059926 GACCATGGCAGGGAAGCGGTGGG + Intronic
1062347702 9:136123008-136123030 GACGGGGACAGGGAGGCTATGGG - Intergenic
1062612088 9:137379964-137379986 GAGGCTGGCAGGGGTGCAGTGGG - Intronic
1062656547 9:137606730-137606752 GACAGAGGAAGGGAGGCTGTGGG - Intronic
1203699032 Un_GL000214v1:120521-120543 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203699990 Un_GL000214v1:126831-126853 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203700895 Un_GL000214v1:132815-132837 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203479730 Un_GL000224v1:1395-1417 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203480698 Un_GL000224v1:7691-7713 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203481659 Un_GL000224v1:14021-14043 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203550191 Un_KI270743v1:160649-160671 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1203567692 Un_KI270744v1:105532-105554 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203568753 Un_KI270744v1:112517-112539 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203569331 Un_KI270744v1:116769-116791 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203570280 Un_KI270744v1:123050-123072 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1185734966 X:2489483-2489505 GCAGGTGGCCGAGATGCTGTCGG - Exonic
1185739613 X:2520673-2520695 GATGATGGCAGTGATGATGTTGG - Intergenic
1186648760 X:11536128-11536150 GAGGGTGGAATAGATGCTGTAGG + Intronic
1186663685 X:11696493-11696515 GAAGGTGTCAGGCATGCAGTAGG - Intergenic
1187932512 X:24306351-24306373 GCTGGAGGCAGGGCTGCTGTGGG - Intergenic
1188270597 X:28135397-28135419 GATGGTGGGAGGAATGGTGTTGG - Intergenic
1189290725 X:39883842-39883864 GATGGTGGCGGAGATGATGTGGG + Intergenic
1191273464 X:58510777-58510799 GAAGGTGGCAGAGAGGCTGGTGG + Intergenic
1193360889 X:80577092-80577114 GACAGTGGCAGAGGGGCTGTTGG + Intergenic
1195886583 X:109645072-109645094 CAAGGTGGCAGGGAGGCTGGGGG + Intronic
1195983661 X:110606243-110606265 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1196478793 X:116121618-116121640 CAAGGTGGCAGTGAGGCTGTGGG + Intergenic
1200086129 X:153606834-153606856 GAAGATGGCAGAGATGCTGGTGG + Intergenic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic
1201522241 Y:14888244-14888266 CAAGGTGGCAGCGACGCTGTGGG - Intergenic
1201527538 Y:14953171-14953193 CAAGGTGGCAGCGATGCTGGGGG + Intergenic