ID: 1179908294

View in Genome Browser
Species Human (GRCh38)
Location 21:44435337-44435359
Sequence TGGTGCCTACTGGGGGGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 434}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179908278_1179908294 27 Left 1179908278 21:44435287-44435309 CCATTGCCCAGTGCTCAGGGGCC 0: 1
1: 0
2: 3
3: 24
4: 305
Right 1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG 0: 1
1: 0
2: 0
3: 54
4: 434
1179908283_1179908294 20 Left 1179908283 21:44435294-44435316 CCAGTGCTCAGGGGCCGGGAGGG 0: 1
1: 0
2: 4
3: 35
4: 369
Right 1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG 0: 1
1: 0
2: 0
3: 54
4: 434
1179908286_1179908294 6 Left 1179908286 21:44435308-44435330 CCGGGAGGGCGGCTTTGATGCTT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG 0: 1
1: 0
2: 0
3: 54
4: 434
1179908281_1179908294 21 Left 1179908281 21:44435293-44435315 CCCAGTGCTCAGGGGCCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 293
Right 1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG 0: 1
1: 0
2: 0
3: 54
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179908294 Original CRISPR TGGTGCCTACTGGGGGGATG CGG Intronic
902401112 1:16157227-16157249 TGGTGCCTACTCTTGGGAAGCGG + Intergenic
902658423 1:17885285-17885307 TGATCCCTACTGAGGGGGTGTGG + Intergenic
903379524 1:22887036-22887058 TGGTGCTTACTGGGGCAAAGGGG + Intronic
903738583 1:25545033-25545055 TGGTGCCTGCTGGTGGGGGGTGG + Intronic
903829979 1:26168977-26168999 AGGTGCCCACTGGGGGCCTGCGG - Intergenic
904747561 1:32720422-32720444 TGGGGCTTAGTGAGGGGATGGGG + Intergenic
905873365 1:41417258-41417280 TGGTGCCCTCTGGTGGCATGCGG + Intergenic
906480806 1:46197920-46197942 TGATGCCTTCTGGGGAGATGAGG + Intronic
906842686 1:49157237-49157259 TGGGGCCTTCTGGGGGGTGGGGG - Intronic
908204546 1:61832162-61832184 TGGGGCCTACTTGGGGGTAGAGG + Intronic
908819846 1:68074196-68074218 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
909403850 1:75263968-75263990 TGGGGCCTGTTGGGGGGTTGCGG + Intronic
910570726 1:88699579-88699601 TGGGGCCTACTGGAGGGTGGGGG - Intronic
911179555 1:94848640-94848662 TGGTGGGCACTGTGGGGATGAGG + Intronic
911539665 1:99143800-99143822 AGGTGCCTACTGGAGGGAGAAGG - Intergenic
912404960 1:109429478-109429500 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
913108854 1:115640601-115640623 TGGAGCCTACTGGGAGGCTGGGG + Intergenic
913320698 1:117586588-117586610 TGTGGCCTACTGGGGAGAAGAGG + Intergenic
913555526 1:119962896-119962918 TGCTCCTTTCTGGGGGGATGTGG - Intronic
915789669 1:158654655-158654677 TGGTGACTTCTCGGGGGCTGCGG + Exonic
916602882 1:166311034-166311056 TGGGGCCTACTGTGGGGTAGGGG - Intergenic
917042138 1:170816750-170816772 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
917230286 1:172829356-172829378 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
917265424 1:173216183-173216205 TGATGCCTAGGGTGGGGATGGGG - Intergenic
917510989 1:175669110-175669132 TGCTGCCTACTGGGAGAATATGG - Intronic
918581992 1:186142158-186142180 TGGGGCCTACTTGAGGGAGGAGG - Intronic
918669403 1:187196446-187196468 TGGTGCCTGTTGGGGGTTTGGGG - Intergenic
918780222 1:188690467-188690489 TGGGGCCTGCCGGGGGGGTGGGG - Intergenic
921406470 1:214785141-214785163 TGGGGCCTGTTGGGGGGGTGAGG + Intergenic
921485898 1:215715141-215715163 TGGGGCCTATTAGGGGGGTGAGG - Intronic
922650851 1:227337005-227337027 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
923431154 1:233921798-233921820 TGGGGCCTGTTGGGGGGAGGGGG - Intronic
1062944874 10:1452639-1452661 TGGGGCCTGTTGGGGGGTTGGGG + Intronic
1063546157 10:6984039-6984061 TGGGGCCTGTTGGGGGGCTGGGG - Intergenic
1064025913 10:11848700-11848722 AGGTGCAAACTGGGGGGATGAGG - Intronic
1064335883 10:14440783-14440805 TGGTGCCTAGTGGAAGGGTGAGG - Intronic
1064912179 10:20414878-20414900 TGGGGCCTACTGGTGGGGTAGGG + Intergenic
1065169766 10:23014791-23014813 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1065284200 10:24171669-24171691 TGGTGCATACCAGGAGGATGAGG + Intronic
1065529431 10:26653376-26653398 TCGTGCCTGTTGGGGGGGTGGGG - Intergenic
1067000468 10:42606672-42606694 TGGGGCCTATTGAGGGGTTGGGG + Intronic
1067297338 10:44982383-44982405 TGGTCCTTCCTGAGGGGATGGGG + Intronic
1068114262 10:52719674-52719696 TGGGGCCTACCGGGAGGGTGAGG + Intergenic
1069093132 10:64226438-64226460 TGGGGCCTACTGGGGAGTGGGGG - Intergenic
1069233439 10:66040713-66040735 TGGCGCCTACTGGAGGGTGGAGG + Intronic
1070413466 10:76166471-76166493 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1070768260 10:79068566-79068588 TGGGGCCTGCAGGGGGGCTGGGG + Intergenic
1074121262 10:110496111-110496133 TGGTGCGTACTGGAGGTATGTGG - Intergenic
1075352499 10:121736427-121736449 GGGTGCTTGCTGGGGGAATGTGG + Intergenic
1075359207 10:121814701-121814723 TGGAGCATCCTGGCGGGATGAGG + Intronic
1075385943 10:122055546-122055568 TGGGGCCTATTGGAGGGAGGAGG + Intronic
1075559853 10:123460546-123460568 AGGAGCCTGCTGGGAGGATGGGG - Intergenic
1076067452 10:127459957-127459979 TCGTGACTATTGGGAGGATGGGG - Intergenic
1076082549 10:127596591-127596613 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
1077533464 11:3107994-3108016 TGGTGGCCCCTTGGGGGATGCGG - Intronic
1077945148 11:6889175-6889197 TGTGGCCTACTGGAGGGTTGAGG + Intergenic
1078209409 11:9258279-9258301 TGGGGCCTGTTGGGGGGGTGGGG - Intronic
1078238499 11:9508483-9508505 TGCTGCCTCATGGTGGGATGAGG + Intronic
1078370558 11:10741165-10741187 TGGTGCCTACTTGAGGGTTGAGG + Intergenic
1079300400 11:19273821-19273843 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
1079500976 11:21100992-21101014 TGGGGCCTGCTGTGGGGTTGGGG - Intronic
1079611239 11:22435267-22435289 TGGTGCCTGCTGGGGGTTGGGGG + Intergenic
1079623357 11:22583265-22583287 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1080200549 11:29664532-29664554 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
1080249766 11:30219849-30219871 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
1081051004 11:38341606-38341628 TGGGGCCTATTGTGGGGTTGGGG - Intergenic
1081173917 11:39902420-39902442 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
1081842217 11:46210873-46210895 TGGGGACTACTAGGGGGAGGAGG - Intergenic
1083031812 11:59599429-59599451 TGGGGCCAACTGTGGGGTTGGGG - Intronic
1083878439 11:65536898-65536920 AGGGGGCTACTGGGGGGAAGGGG - Intronic
1084218600 11:67664727-67664749 GGGTCCCTTCTGGGGGGCTGTGG - Intronic
1084675822 11:70633800-70633822 TTCTGCCTCCTGGGGAGATGGGG + Intronic
1085897700 11:80659912-80659934 TGGTTCCTAATGGGGGGCTTGGG - Intergenic
1086381334 11:86258100-86258122 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1086946794 11:92851747-92851769 TGGTGACAGCTTGGGGGATGTGG - Intronic
1086962515 11:92993530-92993552 TGGGGCCTATTAGGGGGCTGTGG - Intergenic
1087842819 11:102937507-102937529 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1087912084 11:103765789-103765811 TGGAGCCTACTTGAGGGAGGAGG - Intergenic
1088359860 11:108978749-108978771 TGGTGCTCACTGGGAGGATGGGG + Intergenic
1089139464 11:116274433-116274455 AGGTGGCTACGGGGGGGTTGGGG - Intergenic
1089998679 11:122933929-122933951 TGTTGCCAACTTGGGGGATGAGG - Intronic
1090261093 11:125320786-125320808 TGCTGCCTCCTGGAGGGAGGTGG + Intronic
1090554821 11:127862929-127862951 TGGGGCCTGCTGGGGGGTTGGGG - Intergenic
1090591435 11:128274364-128274386 TGGAGCCTACTGGAGGGTAGAGG - Intergenic
1090946469 11:131433950-131433972 CGGTGCCTATTGTGGGGTTGGGG - Intronic
1091749318 12:3012593-3012615 GGGTGCCTGCTGTGGGGGTGGGG + Intronic
1092597786 12:10026515-10026537 TGGGGCCTGTTGAGGGGATGAGG + Intergenic
1092726507 12:11491517-11491539 TGGGGCCTACTGGGGGGTGTCGG + Intronic
1092867471 12:12776432-12776454 TTATGGCTACTGGAGGGATGTGG + Intronic
1092919157 12:13215174-13215196 AAGTGCCTACTGGGGGGCTTTGG + Exonic
1093599847 12:21008661-21008683 TGGTGCCTGTTGGGGGGGTGGGG + Intergenic
1095614298 12:44170282-44170304 TGGGGCCTGCTGGGGGGTGGGGG + Intronic
1096136956 12:49210552-49210574 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1096621029 12:52865634-52865656 TGGTGCCTGATGTGGGGATAAGG + Intergenic
1096705614 12:53420031-53420053 TGTTTCCTACTAGGGGCATGAGG - Intergenic
1097179573 12:57163650-57163672 TGGTGCTCACTGGTGGGATTTGG - Intronic
1097313278 12:58144835-58144857 TGGGGCCTACTTGAGGGCTGAGG - Intergenic
1098534966 12:71583891-71583913 TGGTGCCTGGTGGGAGAATGGGG + Exonic
1099114270 12:78604597-78604619 TGGGGGCTACTAGAGGGATGAGG + Intergenic
1099337344 12:81380113-81380135 TGCAGCCCACTGGGAGGATGAGG + Intronic
1099501636 12:83420515-83420537 TGGTGCCTGTTGTGGGGTTGGGG - Intergenic
1099571302 12:84322428-84322450 TGGTGCCTACTGGATGGTGGAGG + Intergenic
1099603234 12:84768303-84768325 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
1101091675 12:101293097-101293119 AGCTGCTTGCTGGGGGGATGGGG + Intronic
1102671888 12:114626736-114626758 TGGTGCCTACTTGAGGGGGGAGG + Intergenic
1103585055 12:121946711-121946733 TGGTGCCACCTGGGAGGCTGAGG - Intronic
1104439701 12:128784840-128784862 TGCTGCCTACGGGGGAGCTGGGG + Intergenic
1104518284 12:129448377-129448399 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1104536250 12:129620809-129620831 TGGGGCCCTCTTGGGGGATGAGG + Intronic
1104576466 12:129971140-129971162 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1104652885 12:130549513-130549535 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1105667908 13:22580657-22580679 TGGGGCCTGTTGTGGGGATGGGG + Intergenic
1106349115 13:28910542-28910564 TGGGGCCTGCTGGGGGGCTGGGG - Intronic
1106701152 13:32230223-32230245 TGGGGCCTACTGGAGGGCGGAGG - Intronic
1106982249 13:35301341-35301363 TGGGGCCTGTTGGGGGGTTGGGG - Intronic
1107145148 13:37053511-37053533 TGGGGCCTGTTGGGGGGTTGGGG + Intronic
1108702340 13:52954349-52954371 TGGGGCCTGATGGGGGGTTGGGG + Intergenic
1109081344 13:57905291-57905313 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
1109589626 13:64460949-64460971 TGGTGCCTACTTGAGGGCGGAGG - Intergenic
1109905042 13:68829640-68829662 TGGAGCCTACTTGAGGGTTGAGG - Intergenic
1110000549 13:70193917-70193939 TGGGGCCTGTTGGGGGTATGGGG - Intergenic
1110825736 13:79969611-79969633 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
1112070138 13:95841038-95841060 TGGGGCCTATTGGAGGGCTGGGG + Intronic
1112644562 13:101314911-101314933 TGGTTCCCACTGGCGGGAAGAGG + Intronic
1112805275 13:103158015-103158037 TAGTGGCTATTGGGGGTATGAGG + Intergenic
1113023563 13:105916124-105916146 TGGTGCCTGCTGGGTAGGTGAGG + Intergenic
1114694884 14:24617534-24617556 TGGGGCCTATTGGGGGGTGGGGG - Intergenic
1114759155 14:25292455-25292477 TGGGGCCTATTGGGGAGTTGAGG + Intergenic
1115350597 14:32390774-32390796 TGTTGCCTTCAGGGGGTATGTGG + Intronic
1116239831 14:42325873-42325895 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1116673764 14:47878397-47878419 TGGGGCCTACTTGGGGGTGGAGG + Intergenic
1117066173 14:52014975-52014997 TGGTGCCTGCTGTGGTGAAGTGG - Intronic
1117587722 14:57228693-57228715 TGGGGCCTGTTGGGGGGGTGGGG + Intronic
1117851060 14:59970117-59970139 TGGGGCCTACTGGAGGGAGGGGG - Intronic
1118877885 14:69799776-69799798 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1119531736 14:75366355-75366377 TCGTTCTTACTGGGGGGATGAGG + Intergenic
1120149322 14:81015779-81015801 TGGTGAGGAGTGGGGGGATGAGG - Intronic
1120483132 14:85077505-85077527 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1121524407 14:94609316-94609338 TGGGGCCTGTTGGGGGGTTGGGG + Intronic
1122402382 14:101475087-101475109 TGGTGCCTCTTGGAAGGATGGGG + Intergenic
1122740434 14:103868857-103868879 TGGTGCCTGAAGGTGGGATGAGG - Intergenic
1122903110 14:104790092-104790114 TGGTGCCTTCAGGGGTGATGTGG - Intronic
1122974221 14:105164436-105164458 TGGTCCCTACTGGGAAGGTGTGG + Intronic
1123670102 15:22647876-22647898 TGGGACCTACTGGGGGGCTGGGG + Intergenic
1123987142 15:25656033-25656055 TGGTGCCTACTTGGGGGGGGGGG + Intergenic
1124526076 15:30454292-30454314 TGGGACCTACTGGGGGGTTGGGG + Intergenic
1124681561 15:31736048-31736070 TGGGGCCTACTGGAGGGCAGAGG + Intronic
1124772578 15:32553393-32553415 TGGGACCTACTGGGGGGTTGGGG - Intergenic
1125053841 15:35334558-35334580 AGGGGCCTATTGGGGGCATGGGG - Intronic
1125155093 15:36576987-36577009 CAGGGCCTACTGGGGGGTTGGGG + Intergenic
1125891708 15:43271462-43271484 TGGGGTCTACTTGAGGGATGAGG - Intergenic
1126263938 15:46729809-46729831 TTGTGCCAACTTGGGGGAGGAGG + Intergenic
1128216592 15:65938544-65938566 TGGTGTGGACTGGGGAGATGGGG - Intronic
1128606837 15:69042808-69042830 AGGTGGCTACTGGAGGGAAGGGG + Intronic
1129781659 15:78276420-78276442 TGGTGTCTACAGGGGGGTTGGGG - Intronic
1129932921 15:79427254-79427276 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1130119614 15:81036349-81036371 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1130220241 15:82013179-82013201 TGGTGCCACCTGGGTAGATGAGG + Intergenic
1130696295 15:86135019-86135041 TGGGGCCTAATGGGGCGCTGGGG + Intergenic
1131058839 15:89392063-89392085 TGGTGCCCAGTGGAGGGCTGAGG + Intergenic
1132600519 16:770709-770731 GGGAGCCGCCTGGGGGGATGGGG + Intronic
1133979064 16:10620088-10620110 TGGTGCCTGCTGGGTGAAGGGGG - Intergenic
1134064572 16:11219587-11219609 TGGTGACTTCTGGGGGGCTGGGG - Intergenic
1134400761 16:13907712-13907734 TGGTGCCTTTGGTGGGGATGAGG - Intergenic
1134675462 16:16086990-16087012 AGGTGCCTGCTGGCGGGGTGGGG + Exonic
1134773541 16:16831949-16831971 TGGGGCCTGTTGGGGGGGTGGGG - Intergenic
1135168820 16:20165189-20165211 TGGTGCCTCTTGGGGTGATGTGG + Intergenic
1135575102 16:23579712-23579734 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1135658481 16:24272999-24273021 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1136034719 16:27530498-27530520 TGCTGCCTTTTGGGGGGATTTGG - Intronic
1136690318 16:32024104-32024126 TGGGCCCTACAGGGTGGATGGGG + Intergenic
1136790907 16:32967668-32967690 TGGGCCCTACAGGGTGGATGGGG + Intergenic
1136878908 16:33886264-33886286 TGGGCCCTACAGGGTGGATGGGG - Intergenic
1137011924 16:35329948-35329970 AGGTGCTTACTGGGTGGCTGTGG + Intergenic
1137016287 16:35378730-35378752 TGGTGCTCACTGGGCGGTTGTGG + Intergenic
1137495270 16:48964604-48964626 TGGTGGCAACTGGGGGGAACTGG + Intergenic
1137669167 16:50269396-50269418 TGGTCCTTACTGGGAAGATGAGG + Intronic
1137716091 16:50599101-50599123 TGAGGCCTTCTGGGGTGATGAGG + Intronic
1138158422 16:54728749-54728771 TGGTCCCTATGGTGGGGATGAGG + Intergenic
1138882176 16:61030302-61030324 TGGGGCCTACAGGTGGGATGGGG - Intergenic
1138882502 16:61032568-61032590 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1140018297 16:71210491-71210513 TTGTGCCTACTTGAGGGAGGAGG + Intronic
1140775253 16:78243517-78243539 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1141590757 16:85067130-85067152 TGGTGCCTCCAGGGGAGAAGAGG - Exonic
1203093112 16_KI270728v1_random:1229125-1229147 TGGGCCCTACAGGGTGGATGGGG + Intergenic
1142986792 17:3700189-3700211 TTGTGCCCAGTGGGGAGATGAGG + Intergenic
1143130226 17:4672962-4672984 TGGAGCCCACTGAGGGCATGGGG + Exonic
1143834308 17:9677889-9677911 AGGAGCCCACTGGGGTGATGGGG - Intronic
1145276836 17:21436691-21436713 CGGGGCCTCCTGGGGAGATGGGG + Intergenic
1145713120 17:26994521-26994543 TGGGGCCTCCCGGGGAGATGGGG + Intergenic
1147120113 17:38330762-38330784 TGGTGCCTGATGGGTGGATGAGG + Exonic
1147153174 17:38530240-38530262 TGGGCCCTACAGGGTGGATGGGG + Exonic
1148797535 17:50204205-50204227 GGCTGCAGACTGGGGGGATGGGG + Intergenic
1148866050 17:50629249-50629271 TGGTCCCTACTGGGAAGAGGAGG - Intergenic
1150193614 17:63270820-63270842 TGGGGCCTACTGGTGGGAGGAGG - Intronic
1150876337 17:68975006-68975028 TGGGGCCTGTTGGGGGGATGGGG - Exonic
1151084524 17:71365145-71365167 AGGTGCCTACTGTGGGAATGTGG + Intergenic
1151608026 17:75152862-75152884 TGGTGATTACTGGGAGGATGGGG - Intronic
1152067171 17:78118219-78118241 TGGTCCCCACTGCAGGGATGAGG + Intronic
1153373177 18:4343637-4343659 TGGTGCCTGTTGGGGGGTCGGGG + Intronic
1153738317 18:8096107-8096129 TGATGCCTACTCAGTGGATGTGG + Intronic
1153844175 18:9033457-9033479 TGGGGTCTCCTGGGGGAATGGGG + Intergenic
1155102267 18:22623288-22623310 TGGAGCCTACTGGGGGCACCGGG - Intergenic
1156208885 18:34916891-34916913 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
1157421554 18:47551544-47551566 GGGGGCCTGCTGGAGGGATGTGG + Intergenic
1157441952 18:47718398-47718420 TGGTTCCTTCTGGGGGCATGGGG + Intergenic
1157978212 18:52350514-52350536 CGGGGCCTACTGGGGAGTTGGGG + Intronic
1158022855 18:52864686-52864708 TGGGGCCTGTTGGGGGGATTGGG - Intronic
1159377733 18:67615449-67615471 TGCAGACTACTGGAGGGATGAGG - Intergenic
1159548362 18:69869491-69869513 TGGAGCCTACTGGAGGGCAGAGG + Intronic
1160874838 19:1292153-1292175 TGGCGCCTGCAGGGGGGAGGGGG - Intronic
1161041187 19:2111509-2111531 GGGTGCCTAATGTGGGGCTGCGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161767110 19:6213954-6213976 GGGTGGCTTCTGGGGGGGTGGGG + Exonic
1162287163 19:9747435-9747457 TGGGGCCTGCTGGGGGGAGGGGG - Intergenic
1162321359 19:9972898-9972920 TGGTGAGTCCTGGGGGGAAGTGG - Exonic
1163094280 19:15044649-15044671 TGGTGACTACTAGAGGGAGGAGG - Intergenic
1163472241 19:17504438-17504460 AGGTGCCTATAGTGGGGATGGGG - Exonic
1163948329 19:20561352-20561374 TGGTGCCTACTCCTGGGAGGAGG + Intronic
1164898542 19:31898387-31898409 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1165781177 19:38435012-38435034 TGGTGTCTGCTGAGGGGCTGGGG - Intronic
1165972973 19:39649023-39649045 TGGGGCCTACTTGAGGGTTGAGG + Intergenic
1166988773 19:46678245-46678267 GCGGGCCTACTGGAGGGATGTGG - Intronic
1166995699 19:46718745-46718767 TGGGGCCTGCTGGGGGACTGGGG + Intergenic
1167251643 19:48401589-48401611 TGGAGCCCACTGGGGGATTGGGG + Intronic
1167339901 19:48909088-48909110 TGGTTCCTTCTGGGGCTATGAGG + Intronic
1167790073 19:51670291-51670313 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1168445076 19:56404428-56404450 AGGTGCCCACTGGAGGGAGGAGG + Exonic
925371868 2:3351564-3351586 TGGTGCCTACAGGGGAGTTGGGG - Intronic
925891023 2:8434660-8434682 TGGAGCCTGTTGGGGGGTTGGGG - Intergenic
926403861 2:12527976-12527998 TGGGGCCTACAGGGGTGTTGGGG + Intergenic
926848215 2:17165623-17165645 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
927076824 2:19586896-19586918 TGGGGCCTACTGGGTTGAGGGGG + Intergenic
929153690 2:38771045-38771067 GGGTGCCAACTGAGGAGATGAGG + Intronic
929455082 2:42059718-42059740 TTGTGCCTCCTTGGTGGATGCGG - Intergenic
930710327 2:54544929-54544951 TGGGGCCTACTGGGGAGTGGGGG - Intronic
932007380 2:67940286-67940308 TGAAGGCTACTGGGGGGATCTGG - Intergenic
932472096 2:71966342-71966364 TGGTCTCTAGTGGGGGGATCAGG - Intergenic
932809476 2:74812265-74812287 TGGGGCCTACTGGAGGGCAGAGG - Intergenic
933924103 2:87076419-87076441 TGCCGCCGACTGGGGGGAGGGGG + Intergenic
933957718 2:87385026-87385048 TGGGGCCTACTGCAGGGGTGGGG - Intergenic
934089111 2:88535616-88535638 TCCTGCCTACTCGGGGGCTGAGG + Intergenic
934241839 2:90276943-90276965 TGGGGCCTACTGCAGGGGTGGGG - Intergenic
934271333 2:91539745-91539767 TGGGGCCTACTGCAGGGGTGGGG + Intergenic
936042725 2:109161922-109161944 TGGTGCCTCCTGGGGAGGGGAGG + Intronic
938558903 2:132452630-132452652 TGGGGCCTATTGGGGGGTGGGGG - Intronic
939242521 2:139579513-139579535 TGGGGCCTGCTGGGGGGTTCTGG + Intergenic
940629967 2:156225776-156225798 TGGAGCCTGCTGGGGGGTGGTGG + Intergenic
940708487 2:157133320-157133342 TGGGGCCTACTTGAGGGTTGAGG + Intergenic
941987414 2:171522743-171522765 TGGCACCTCCTGGGGGGGTGCGG + Intronic
942111898 2:172690839-172690861 TGGGGCCTGTTGGGGGGGTGGGG + Intergenic
942522228 2:176816571-176816593 CGGGGCCTGTTGGGGGGATGGGG + Intergenic
942621782 2:177851903-177851925 TGGGGCCTACTGGAGGGTGGAGG - Intronic
942908555 2:181213071-181213093 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
943096180 2:183431976-183431998 TGGGGCCTGTTGGGGGGATAGGG + Intergenic
943642845 2:190378226-190378248 CAGTGCCTGGTGGGGGGATGGGG - Intergenic
945117007 2:206417861-206417883 TGGGGCCTGCTGTGGGGTTGGGG - Intergenic
945139830 2:206673085-206673107 TGGGGCCTACTGGAGGGCAGAGG - Intronic
946155597 2:217804707-217804729 TGAGGCCTGCTGGAGGGATGGGG - Intronic
946890958 2:224276105-224276127 TGGGGCCTGTTGTGGGGATGTGG - Intergenic
947131977 2:226937596-226937618 TGGTGCCTATTGGAGGGTGGAGG - Intronic
947327025 2:228990846-228990868 TGGGGCCTACTTGAGGGAGGAGG + Intronic
947855212 2:233319280-233319302 TGATGCCTGCTGGGGGCAGGGGG + Intronic
948120193 2:235523915-235523937 TCATCCCTACTGGAGGGATGAGG - Intronic
948331283 2:237167954-237167976 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
949008003 2:241661154-241661176 TGGTGGCTCCCGGGAGGATGTGG + Intronic
1170937337 20:20821694-20821716 TGGTGCCCAAGGGGTGGATGTGG - Intergenic
1171331752 20:24346027-24346049 TGGTGCCTACTGGCGGGTGGAGG + Intergenic
1172803562 20:37595451-37595473 TGGTTACCTCTGGGGGGATGTGG - Intergenic
1173096107 20:40030011-40030033 TGGGACTTACTGGGTGGATGAGG - Intergenic
1174272237 20:49378046-49378068 TGGTGAGTACTGGGAGGATGGGG + Intronic
1174907424 20:54566104-54566126 TAGTGCCTGCTGGGGTGGTGGGG - Intronic
1176066997 20:63203070-63203092 GGGTGCCTGCTGGGGGACTGGGG + Exonic
1176072308 20:63233762-63233784 TGGGGCCCACTGGGGAGTTGGGG - Intergenic
1176081448 20:63275366-63275388 GGGAGCCTCCTGGGGGTATGGGG + Intronic
1176197095 20:63842429-63842451 AGGTGCGTCCTGGGGGGAAGAGG + Intergenic
1176723989 21:10414741-10414763 TGCTGCCCACTGGGTGGCTGGGG - Intergenic
1177192614 21:17868755-17868777 TAGGGTCTACTGGGGGGGTGGGG + Intergenic
1178050488 21:28741553-28741575 TGGGGCCTAGTGGAGGGTTGTGG - Intergenic
1179450889 21:41467569-41467591 GGGTGGACACTGGGGGGATGGGG + Intronic
1179654174 21:42834903-42834925 TGGAGCCTACAGAGGGGATGGGG - Intergenic
1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG + Intronic
1180305234 22:11067915-11067937 TGCTGCCCACTGGGTGGCTGGGG - Intergenic
1180628977 22:17214159-17214181 TGCTCCCTACTGGGGGCAGGCGG - Intronic
1181042985 22:20201609-20201631 GGGGGCCTGCTGGGGGGCTGGGG + Intergenic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1181163450 22:20971090-20971112 TGGAGCCTTCTGGGAGGAGGTGG + Intronic
1183383135 22:37500482-37500504 TGGTGGATAGTGGGGGGCTGGGG - Intronic
1184647371 22:45903547-45903569 GGCTGACTGCTGGGGGGATGGGG - Intergenic
949194226 3:1286350-1286372 TGGGGCCTACTGGGGGTTGGGGG - Intronic
950331822 3:12161865-12161887 AGGGGCCTCCTGGGGAGATGTGG + Intronic
951015356 3:17725869-17725891 TGGGGCCTACTTGAGGGTTGAGG - Intronic
951092924 3:18596892-18596914 TGGTGCATTCTGGGGGCATGGGG + Intergenic
951325459 3:21297178-21297200 TGGTTCCTTGTGTGGGGATGGGG - Intergenic
952569739 3:34700475-34700497 TGGTGCCTACTTGAGGGTGGAGG + Intergenic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
953064464 3:39456326-39456348 TGCTGCCTGGTGCGGGGATGGGG - Intergenic
954763589 3:52895428-52895450 TGGTGGGTCCTGGGGTGATGTGG - Intronic
955839243 3:63094563-63094585 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
956902507 3:73731119-73731141 TGGAGCCTATTGGGGGCAGGGGG - Intergenic
956933493 3:74072831-74072853 TTGTGCCAGCTGGGGTGATGCGG - Intergenic
957906396 3:86561772-86561794 TGGGGCCTGCTGGGGAGGTGGGG - Intergenic
958620087 3:96547542-96547564 AGGTGAATACTGGGGGGTTGGGG - Intergenic
958688346 3:97427905-97427927 TGGGGCCTACTTGAGGGTTGAGG + Intronic
959019912 3:101177686-101177708 TGGGGCCTACTGGAGGAAAGAGG - Intergenic
959449499 3:106481355-106481377 TGATCCCAACTAGGGGGATGCGG + Intergenic
960125764 3:113996859-113996881 TGGGGCCTGCTGGGGGGTGGGGG + Intronic
960550948 3:118975855-118975877 TGGGGACTACTGGGGGGCAGGGG + Intronic
960697041 3:120406451-120406473 TGGTGCCCACTTGGGCCATGTGG - Intronic
960730912 3:120725785-120725807 TGGGGCCTATTGTGGGGAGGAGG + Intronic
960733099 3:120747400-120747422 TGGGGCCTATTGTGGGGAGGAGG - Intronic
961384494 3:126516257-126516279 TGGTGGGTGCTGGGGTGATGAGG - Intronic
961384554 3:126516420-126516442 TGGTGGGTGCTGGGGTGATGAGG - Intronic
961669686 3:128519824-128519846 TGCTGCATACTGGGAGGATGGGG + Intergenic
962438273 3:135386508-135386530 TGGGGCCTGCTGTGGGGTTGGGG + Intergenic
962468492 3:135683633-135683655 TGGGGCCTACTTGAGGGTTGAGG + Intergenic
963166523 3:142210124-142210146 TGGTCCCTAACAGGGGGATGGGG + Intronic
963407345 3:144882938-144882960 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
964029104 3:152115857-152115879 TGGGGCCTGTCGGGGGGATGGGG - Intergenic
964505661 3:157396087-157396109 TGGGGCCTGCAGCGGGGATGGGG - Intronic
964677896 3:159304015-159304037 TGGGGCCTGCTGTGGGGTTGGGG - Intronic
964759570 3:160121918-160121940 TGGGGCCTATTGGGGGGTGGGGG + Intergenic
965457305 3:168918770-168918792 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
966091036 3:176136563-176136585 TGGTGCCGACTTGGGGGTGGAGG - Intergenic
967054768 3:185822927-185822949 TGGTGCCTAATTGGGGGTCGGGG - Intronic
968388292 4:166003-166025 TGGGGCCTGCTGTGGGGTTGGGG - Intergenic
969036498 4:4258053-4258075 TGGGGCCTACTGGAGGGCAGCGG + Intergenic
970321138 4:14876766-14876788 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
970631605 4:17952893-17952915 TGGGGCCTACTTGAGGGAGGAGG - Intronic
970911221 4:21278355-21278377 TGGGGCCTACTGGAGGGTGGAGG - Intronic
971624428 4:28899782-28899804 TGGGGCCTACTGGAGGCTTGAGG + Intergenic
973149712 4:46872309-46872331 TGGTGCCTACTTGAGGGTGGAGG + Intronic
975235020 4:71984215-71984237 TGGGGCCTATTGAGGGGTTGGGG - Intergenic
975877035 4:78853440-78853462 TGGGGCCGACATGGGGGATGAGG + Intronic
975950205 4:79761415-79761437 TGGGGCCTGCTGGGGGGTGGGGG - Intergenic
976136672 4:81945098-81945120 TGGGGGCTACTGTGGGGAGGTGG + Intronic
976624220 4:87161711-87161733 TGGTGACAACTGGCTGGATGTGG - Exonic
977154207 4:93552786-93552808 TGGGGCCTATTGGGGGGTGGGGG - Intronic
977669219 4:99676747-99676769 TGGAGCCTATTGGGGGAGTGGGG + Intergenic
978036807 4:104004892-104004914 CGGGGCCTACTGGGGGTTTGGGG + Intergenic
978459418 4:108934322-108934344 CGGGGCCTGTTGGGGGGATGGGG + Intronic
978717702 4:111866098-111866120 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
979016432 4:115440655-115440677 TGGGGACTACTGGGGGGGTGAGG - Intergenic
979824836 4:125220407-125220429 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
980824683 4:138059327-138059349 TGGGGCCTACTTGAGGGTTGAGG - Intergenic
980908030 4:138968077-138968099 TGGGGACTACTGGAGGGAGGAGG + Intergenic
982113635 4:152078666-152078688 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
982600049 4:157437678-157437700 TGGGGCCTACTGGAGGGGAGAGG - Intergenic
983251699 4:165353252-165353274 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
983466879 4:168105270-168105292 TGGGGCATACTGGAGGGAGGTGG - Intronic
983688387 4:170437638-170437660 TGGGGCCTATTGGGGGGTGGGGG + Intergenic
985562729 5:599339-599361 TGGGGCCTCCTGGAGGGTTGGGG - Intergenic
987010380 5:13756859-13756881 TGGGGCCTACTGGAGGGTGGAGG - Intronic
987353147 5:17039199-17039221 TGGAGTCTATTGGGGGGATGGGG - Intergenic
988005669 5:25407359-25407381 TGGCGCCTACTGGAGGGTGGAGG - Intergenic
988055446 5:26088415-26088437 TGGTGCCTGTTGGGGGGTGGGGG + Intergenic
989548642 5:42705558-42705580 TGGGGCCTACTGGAGGGTAGTGG - Intronic
989801760 5:45550484-45550506 CGGTGCCTATTGTGGGGTTGGGG + Intronic
990291500 5:54356441-54356463 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
992095549 5:73359273-73359295 AGGTGACTGCTGGGAGGATGTGG + Intergenic
992315896 5:75554660-75554682 TGGGGCCTACTGGAGGGTGGAGG - Intronic
992648137 5:78831332-78831354 TGGAGGGTGCTGGGGGGATGAGG - Intronic
993035392 5:82750517-82750539 TGGGGCCTGATGGGGGGTTGGGG - Intergenic
993673145 5:90786238-90786260 TGGGGCCTATTGGGGGGTGGGGG + Intronic
994388841 5:99165389-99165411 TGGGGCCTGCTGGGGGGTGGGGG - Intergenic
994654574 5:102574885-102574907 TGGTGGTTACTGGAGGGTTGGGG - Intergenic
995293179 5:110484149-110484171 TGGAGATTACTGGGGGGAAGGGG + Intronic
995578449 5:113568527-113568549 TGGGGCCTACTGGGGGTGTGTGG - Intronic
995783210 5:115799986-115800008 TGTTGCTTACTGGGGGCATTTGG - Intergenic
996106888 5:119515849-119515871 TGGGGCCTACTGGAGGGTAGAGG + Intronic
997049224 5:130358901-130358923 TGGGGCCTATTGGAGGGTTGGGG + Intergenic
997230253 5:132237350-132237372 TGGTGTCTACTGAAGGGAAGGGG - Intronic
997599164 5:135127613-135127635 TGGTGACTTGTGTGGGGATGAGG + Intronic
997610411 5:135212023-135212045 TGGTGCTACCTGGCGGGATGAGG + Intronic
997843725 5:137266447-137266469 TGATGCTTGCTGGGGGAATGGGG + Intronic
999261858 5:150243301-150243323 TGGTTCCGATTTGGGGGATGTGG - Intronic
1000362089 5:160457059-160457081 CGGGGCCAACTGGGGGGTTGGGG + Intergenic
1000689646 5:164300353-164300375 TGGTGCCTACAGGCAGCATGAGG - Intergenic
1000774797 5:165406321-165406343 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1004579165 6:16931465-16931487 TGGTGCCTTTTGGAGGGAGGAGG + Intergenic
1004826647 6:19429111-19429133 TGGTGCCTGTTGGGGGGTAGAGG - Intergenic
1005270009 6:24153558-24153580 TGGTGCCTCCTGGAGGTGTGCGG - Intronic
1006389876 6:33751978-33752000 TGGTGTGGTCTGGGGGGATGTGG - Intergenic
1007055756 6:38882548-38882570 TGGGGCCTACTTGAGGGTTGGGG + Intronic
1007789485 6:44300966-44300988 TGGTGCCTTCTGGGGTGGGGAGG + Intronic
1009739712 6:67728756-67728778 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
1010252605 6:73723729-73723751 TGGGGCCTACTGGAGGGTAGAGG + Intronic
1010839563 6:80632743-80632765 TGGTGCCTACTTGAGGGTGGAGG + Intergenic
1011385215 6:86789286-86789308 TGATGCCTATTTGGGGGAAGTGG + Intergenic
1011979340 6:93352923-93352945 TGGGGCCTACTGTGGGGTGGAGG + Intronic
1014846324 6:126281908-126281930 TGGGGCCTACTGGAGGGTGGGGG - Intergenic
1015262994 6:131259952-131259974 TGGGGCCTGTTGGGTGGATGAGG - Intronic
1016138739 6:140581981-140582003 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
1016768246 6:147819314-147819336 TGGGGCCTACTTGGGGGTGGAGG + Intergenic
1017002300 6:150005019-150005041 TGGAGCCTAATCGGGGGCTGGGG - Intergenic
1017801211 6:157897929-157897951 AGGTGACTCCTGGTGGGATGGGG - Intronic
1018211229 6:161484012-161484034 TGGGGCCTGCTGGGGGGTTGTGG + Intronic
1018700646 6:166423435-166423457 CAGTGCCTACTTGGGGGCTGAGG + Intronic
1019417571 7:934463-934485 TGGGGGCTGCTGTGGGGATGGGG - Intronic
1020013151 7:4817135-4817157 AGGAGCCTTCTGGGGGGCTGAGG - Intronic
1020970613 7:14932836-14932858 TGGTACCTAGTGGGAGGCTGGGG + Intronic
1021306101 7:19034400-19034422 TGGTGCCTGCAGCGGGGTTGTGG - Intronic
1021421915 7:20455190-20455212 TGGTTCCTACTGACTGGATGTGG - Intergenic
1022764417 7:33394388-33394410 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1023228357 7:37996623-37996645 TGGGGCCTACTGGGGGGTGGGGG - Intronic
1024660275 7:51486516-51486538 CGGGGCCTACTGGGGGGTGGGGG - Intergenic
1024816955 7:53282553-53282575 TGGGGCCTATTGTGGGGTTGGGG - Intergenic
1024832711 7:53480294-53480316 TGGGGCCTGTTGGGGGGTTGAGG - Intergenic
1026149777 7:67778054-67778076 TGGGGCCTATTGGGGGGTAGGGG - Intergenic
1026498573 7:70923757-70923779 TGGTGCATCCTGGGAGGAGGGGG + Intergenic
1027353425 7:77334411-77334433 TGGGGCCTGTTGGGGGGTTGGGG + Intronic
1028043413 7:86087868-86087890 TGGTGCCCACTTGGAGTATGGGG - Intergenic
1028346280 7:89787923-89787945 TGGTGCCTACTTGAGGGTGGAGG - Intergenic
1028513006 7:91645549-91645571 TGGGGCCTGCTGGGGGGTAGGGG - Intergenic
1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG + Intergenic
1029488754 7:100858958-100858980 TGCTGCCTCCTGGGGGTTTGGGG + Intronic
1030019667 7:105260871-105260893 TGGAGCCTATTGGGGGGTGGGGG + Intronic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1031506633 7:122592825-122592847 TGGGGCCTTCCAGGGGGATGGGG + Intronic
1032750070 7:134830565-134830587 TGGGGCCTATTGGAGGGTTGAGG - Intronic
1034085252 7:148316492-148316514 TGGTGCCTAATGGGGATGTGAGG + Intronic
1035035536 7:155891789-155891811 TGGTGGCTGTTGTGGGGATGGGG + Intergenic
1035554976 8:560678-560700 TGGGGCCTGTTGGGGTGATGGGG + Intergenic
1036695484 8:10971823-10971845 TGGAGCCCACTGTGGGAATGAGG + Intronic
1037217186 8:16470239-16470261 TGGGGCCTATTGGGGGGTGGAGG - Intronic
1037311362 8:17560110-17560132 TGGTGACTACTGGGGGAAATTGG + Intronic
1038677762 8:29638843-29638865 TGGGGCCTATTGGGGGGTCGGGG + Intergenic
1040377745 8:46842803-46842825 TTCTGCCTACTGGGGACATGGGG + Intergenic
1041146822 8:54884792-54884814 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
1041548610 8:59075732-59075754 TAGTGCCTACTAGAGGGATGAGG + Intronic
1044053392 8:87538397-87538419 TGGGGCCTGCTGGGGGGTGGGGG - Intronic
1045318757 8:101065489-101065511 TGGTGGCTACTGGGAGGCTGAGG - Intergenic
1045495924 8:102708535-102708557 CGGGGCCTATTGGGGGGTTGGGG - Intergenic
1045963145 8:107992392-107992414 TGGTGCCTATTGGAGGGCAGAGG + Intronic
1046507326 8:115152769-115152791 TGGTTCCTTCTGAGGCGATGAGG - Intergenic
1046715186 8:117559410-117559432 TGGGGCCTATTGGGGGGTGGGGG - Intergenic
1046733174 8:117747903-117747925 TGGGGCATACTGGGGGGAGTGGG + Intergenic
1048150474 8:131888786-131888808 TGTTGCCAGCTGGGGGGATGTGG - Intergenic
1049450736 8:142660148-142660170 AGCTGCCTACTGGGAGGCTGGGG - Intronic
1051115702 9:13691983-13692005 TGGGGCCTATTGGAGGGAGGAGG - Intergenic
1051199834 9:14604879-14604901 TGGTGGCTGCTGTGGGGAGGGGG - Intergenic
1051482905 9:17578942-17578964 TGGCGCCAACTGCGGGGATGTGG - Intergenic
1051891992 9:21951886-21951908 TGGTGCCTACTTGAGGGCGGAGG + Intronic
1055130428 9:72768311-72768333 TGGGGCCTGTTGGGGGGTTGGGG + Intronic
1055481880 9:76716813-76716835 TGGGGCCTGTTGGGGGGTTGGGG - Intronic
1055966444 9:81869481-81869503 TGGTGCCTACTTGAGGGTGGGGG - Intergenic
1056979088 9:91291298-91291320 TGGTGTCTGTTGGGGGGGTGGGG + Intronic
1057637330 9:96781755-96781777 TGCTGCATCCTTGGGGGATGGGG + Intergenic
1057885163 9:98824256-98824278 TGGTGGCTCCTTGGTGGATGGGG + Intronic
1058656708 9:107228917-107228939 TGTTGACTCCTCGGGGGATGGGG + Intergenic
1059160145 9:112026378-112026400 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1059311088 9:113389550-113389572 TGGTGCCTAGGAGGGGGCTGAGG + Intronic
1061053027 9:128207150-128207172 AGGAGCAGACTGGGGGGATGGGG + Intronic
1061209706 9:129183717-129183739 GGGTGGAGACTGGGGGGATGGGG + Intergenic
1061882470 9:133575144-133575166 TGGGGGCTGCTGGGGGGCTGGGG - Exonic
1185920036 X:4081295-4081317 TGGGGCCTACTGGAGGGTGGGGG - Intergenic
1187136690 X:16554553-16554575 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1188950715 X:36370253-36370275 TGGGGCCTGCTGGGGGGTGGGGG - Intronic
1190289339 X:48981897-48981919 TGATACCTTCTGGGGGGCTGTGG - Intronic
1190600139 X:52083382-52083404 TGGGGCCTACTGGAGGGCAGAGG - Intergenic
1190603537 X:52117095-52117117 CGGGGCCTACTGGGGGGTGGAGG + Intergenic
1191065945 X:56348029-56348051 TGGGGCCTGTTGGGGGGAGGGGG - Intergenic
1191190814 X:57665234-57665256 TGGTGCCTGCTGGGAGGGTGGGG + Intergenic
1191632685 X:63339074-63339096 TGGAGCCTACTTGAGGGAGGAGG + Intergenic
1192075745 X:67994349-67994371 TGGGGCCTGTTGGGGGGGTGAGG + Intergenic
1192241766 X:69336769-69336791 TGGGGCCTACTTGAGGGTTGGGG - Intergenic
1192418188 X:71003486-71003508 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1193110778 X:77727667-77727689 TGGGGCCTGTTGGGGGGTTGGGG + Intronic
1193615279 X:83680172-83680194 TGGGGCCTGTTGGGGGGCTGGGG - Intergenic
1194039850 X:88927415-88927437 TGGGGCCTGTTGGGGGGTTGGGG - Intergenic
1194057034 X:89148275-89148297 AGGGGCCTACTTGGGGGTTGAGG + Intergenic
1194287332 X:92026034-92026056 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1194347102 X:92779320-92779342 TGGGGCCTACTGGAGGGTTGAGG + Intergenic
1195052321 X:101108324-101108346 TGGTGCCTCCTGGGAGGCTGAGG - Intronic
1195298555 X:103504168-103504190 TGGGGCCTACTGGAGGAGTGGGG + Intronic
1196592349 X:117501080-117501102 TGGGGCCTGTTGGGGGGCTGGGG + Intergenic
1197479956 X:126970426-126970448 TGGGGCCTGTTGGTGGGATGGGG + Intergenic
1197598643 X:128499378-128499400 TGGAGCCTACTTGAGGGAGGAGG - Intergenic
1197687369 X:129455443-129455465 TGGGGCCTGTTGGGGGGGTGGGG + Intronic
1197926154 X:131648529-131648551 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1198670128 X:139070975-139070997 TGAGGCCTACTGGGGGGTGGAGG + Intronic
1198683865 X:139207387-139207409 TGTTGCTTACTGGAGGGATGTGG - Intronic
1198757699 X:139998194-139998216 TGGGGCCTGTTGGGGGGCTGGGG - Intergenic
1198771216 X:140132118-140132140 TGGGGCCTGTTGGGGGGTTGGGG + Intergenic
1199718019 X:150520388-150520410 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1199791383 X:151158451-151158473 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1199940939 X:152627236-152627258 TGGTGCCTAATGGGTTGAGGTGG - Intergenic
1200655428 Y:5895958-5895980 TGGGGCCTACTGGAGGGTTGAGG + Intergenic
1201543429 Y:15133854-15133876 TGGGGCCTGCTGTGGGGTTGGGG - Intergenic