ID: 1179910591

View in Genome Browser
Species Human (GRCh38)
Location 21:44445594-44445616
Sequence TCTCCCGGCGCCCAGAGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179910580_1179910591 27 Left 1179910580 21:44445544-44445566 CCTGGGCCCTGTGGGCCCCGCGA No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data
1179910588_1179910591 -7 Left 1179910588 21:44445578-44445600 CCTGCTCCTCACGGTTTCTCCCG No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data
1179910584_1179910591 12 Left 1179910584 21:44445559-44445581 CCCCGCGACGGAAGCTCTGCCTG No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data
1179910582_1179910591 21 Left 1179910582 21:44445550-44445572 CCCTGTGGGCCCCGCGACGGAAG No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data
1179910583_1179910591 20 Left 1179910583 21:44445551-44445573 CCTGTGGGCCCCGCGACGGAAGC No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data
1179910586_1179910591 10 Left 1179910586 21:44445561-44445583 CCGCGACGGAAGCTCTGCCTGCT No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data
1179910585_1179910591 11 Left 1179910585 21:44445560-44445582 CCCGCGACGGAAGCTCTGCCTGC No data
Right 1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179910591 Original CRISPR TCTCCCGGCGCCCAGAGCAG CGG Intergenic