ID: 1179911071

View in Genome Browser
Species Human (GRCh38)
Location 21:44449160-44449182
Sequence AGAGAGACGCGCCTGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179911071_1179911080 23 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911080 21:44449206-44449228 ACCCAGTGGGTGCCTCTCTCTGG No data
1179911071_1179911074 -9 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911074 21:44449174-44449196 CGTCTCTCTGAGAGAATGAGAGG No data
1179911071_1179911077 9 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911077 21:44449192-44449214 AGAGGGTGCAGGCCACCCAGTGG No data
1179911071_1179911076 -2 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911076 21:44449181-44449203 CTGAGAGAATGAGAGGGTGCAGG No data
1179911071_1179911078 10 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911078 21:44449193-44449215 GAGGGTGCAGGCCACCCAGTGGG No data
1179911071_1179911083 28 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911083 21:44449211-44449233 GTGGGTGCCTCTCTCTGGCGTGG No data
1179911071_1179911075 -8 Left 1179911071 21:44449160-44449182 CCACCCAGCAGGCGCGTCTCTCT No data
Right 1179911075 21:44449175-44449197 GTCTCTCTGAGAGAATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179911071 Original CRISPR AGAGAGACGCGCCTGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr