ID: 1179912386

View in Genome Browser
Species Human (GRCh38)
Location 21:44456986-44457008
Sequence AAGACAGGTCCAGCAGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179912386_1179912388 -6 Left 1179912386 21:44456986-44457008 CCTGCGGCTGCTGGACCTGTCTT 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1179912388 21:44457003-44457025 TGTCTTACAACCGCATCCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1179912386_1179912393 14 Left 1179912386 21:44456986-44457008 CCTGCGGCTGCTGGACCTGTCTT 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1179912393 21:44457023-44457045 AGGATCCCCAAGGACGCCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1179912386_1179912392 13 Left 1179912386 21:44456986-44457008 CCTGCGGCTGCTGGACCTGTCTT 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1179912392 21:44457022-44457044 GAGGATCCCCAAGGACGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 123
1179912386_1179912390 4 Left 1179912386 21:44456986-44457008 CCTGCGGCTGCTGGACCTGTCTT 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1179912390 21:44457013-44457035 CCGCATCCAGAGGATCCCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179912386 Original CRISPR AAGACAGGTCCAGCAGCCGC AGG (reversed) Exonic
901123969 1:6916349-6916371 AATCCAGATCCAGGAGCCGCCGG + Intronic
902063782 1:13667014-13667036 CAGACAGGCCCAGCAGCCCTGGG + Intergenic
902214296 1:14924610-14924632 GACACAGGCCCAGGAGCCGCCGG + Intronic
902226611 1:15000212-15000234 AGGACAGGGCCAGCAGCCATGGG + Intronic
903180740 1:21603607-21603629 AAGGCAGGGCCAGAAGCCCCTGG + Intronic
903703951 1:25271425-25271447 AAGCCAGGGCCAGGAGCTGCAGG - Intronic
904567725 1:31437702-31437724 AAGACAGCTGCTGCAGCCCCAGG - Intergenic
904612028 1:31731165-31731187 ATGTGAGGTCCAGCTGCCGCAGG + Exonic
907520160 1:55018587-55018609 AAGCCTGGTCCTGCAGCCTCGGG + Intergenic
907792778 1:57683218-57683240 AAGACAGGCCCAGCAGAGGGAGG - Intronic
911867796 1:103050818-103050840 CAGACAGGTCCGTCAGCTGCAGG + Intronic
913102695 1:115584082-115584104 CAGACAGGTCCCTCAGCTGCAGG + Intergenic
917842445 1:178992814-178992836 AAGACAGGACCCTCAGCTGCAGG + Intergenic
919858355 1:201720905-201720927 AAGACAGATCTAGTAGCAGCTGG + Intronic
920250060 1:204617542-204617564 AAGCCAGGCCCAGGAGCCTCTGG + Exonic
920438469 1:205963170-205963192 GAGGCAGCTCCAGCAGCCACGGG - Intergenic
920631912 1:207660423-207660445 CAGACAGGTCCCTCAGCTGCAGG - Intronic
923161383 1:231317562-231317584 AAGTCAAGCCCAGCAGGCGCCGG - Intergenic
924443748 1:244108799-244108821 AAGAGAGCTCCAGCAACCACAGG - Intergenic
1063456381 10:6185535-6185557 ACCACAGGTCCAGCAGCACCCGG - Intronic
1065992979 10:31031304-31031326 AAGGGAGGTACAGCAGCCTCTGG - Intronic
1068662292 10:59635149-59635171 AAGGCAGATCAAGCAGCCCCAGG + Intergenic
1070538021 10:77393884-77393906 AAGACAGGACCGGCAGAAGCAGG + Intronic
1070574450 10:77666989-77667011 AAGACAAATCCAGAAGCCACAGG + Intergenic
1071904537 10:90158670-90158692 CAGACAGGACCATCAGCTGCAGG + Intergenic
1073184542 10:101607803-101607825 GTGACAGGTCTAGCAGCCCCTGG + Intronic
1074601384 10:114917286-114917308 AAGGCAGGTACAGCTGCCTCTGG + Intergenic
1075263762 10:120983950-120983972 AAGTCAGGCCCAGCAGGCGGAGG - Intergenic
1077097219 11:804226-804248 CACACAGGTGCAGCAGCTGCTGG + Exonic
1077125967 11:936921-936943 AGCACAGGCCCAGCAGCCGGAGG - Intronic
1079096872 11:17516838-17516860 AGGACAGCTCCAGCAGGAGCGGG + Intronic
1079577906 11:22025839-22025861 CAGACAGGTCCCTCAGCCGCAGG - Intergenic
1082317724 11:50750331-50750353 AAGACAGGACCCTCAGCTGCAGG + Intergenic
1083773809 11:64883412-64883434 AAGGCAGGGCCAGAAGCTGCAGG - Intronic
1083847494 11:65344510-65344532 GAGACAGGAGCAGCAGCAGCAGG - Intronic
1085304230 11:75476132-75476154 AATGGAGGTCCAGCAGCCACTGG - Intronic
1087331999 11:96792771-96792793 CAGACAGGTCCCTCAGCTGCAGG + Intergenic
1089238596 11:117054272-117054294 AAGGCAGGTACAGCAACAGCAGG + Intronic
1091365382 11:135015621-135015643 AAGACATGTCCACCAGCACCAGG - Intergenic
1091601142 12:1918372-1918394 ACCCCAGCTCCAGCAGCCGCTGG - Exonic
1091604449 12:1938030-1938052 AAGGCCGGCCCAGCAGCTGCGGG + Intergenic
1096209054 12:49748361-49748383 AAGACAGGGACAGCAGGGGCTGG - Intronic
1096552549 12:52382707-52382729 AGGAAATGTCCAGCAGCCCCTGG - Intronic
1096814254 12:54191701-54191723 AACACAGCTCCAGCAGCCCGAGG - Intergenic
1097569735 12:61317642-61317664 CAGTCAGGTCCCTCAGCCGCAGG - Intergenic
1097733153 12:63151764-63151786 AATACAGGCACAGCAGCCACTGG - Intergenic
1100251644 12:92830943-92830965 AGGACAGGGCCAGCAGAAGCAGG + Intronic
1102399426 12:112615585-112615607 AAGGCAGGTCCAGGAGCAGGTGG + Intronic
1104746248 12:131212208-131212230 AAGACAGGTCCAGCAGTGCCAGG - Intergenic
1104831056 12:131751748-131751770 AAGACAGGACCTGCCGCTGCAGG + Intronic
1106243139 13:27925737-27925759 AAGGCAGGGCGAGCAGCGGCAGG + Exonic
1106475245 13:30092887-30092909 AAGACAGGTCCTGGAGTCCCAGG - Intergenic
1113853522 13:113431362-113431384 AAGAGTGGCCCAACAGCCGCTGG - Intronic
1117453601 14:55876046-55876068 AAGATAGGACCAGCATCCCCAGG + Intergenic
1120278728 14:82411554-82411576 AAGAGAAGTCCAGCAGTCTCTGG - Intergenic
1122135272 14:99629082-99629104 AAGAAAGGTCCTACATCCGCGGG - Intergenic
1124484789 15:30104262-30104284 AAGAGAGCTCCCGCAGCCGCGGG - Intergenic
1124539863 15:30573270-30573292 AAGAGGGCTCCCGCAGCCGCGGG - Intergenic
1124758788 15:32434312-32434334 AAGAGGGCTCCCGCAGCCGCGGG + Intergenic
1125153431 15:36560317-36560339 AAGAGAGGTCCACCAGCTGTTGG + Intergenic
1126315804 15:47368252-47368274 AAGGCAGCTCCATCAGCCGGTGG + Intronic
1126505223 15:49396771-49396793 CAGACAGGACCCTCAGCCGCAGG - Intronic
1128106008 15:65045398-65045420 CAGATGGGTCCAGCTGCCGCAGG + Exonic
1128522648 15:68385960-68385982 GAGACAGGCCCAGGAGGCGCAGG - Intronic
1128738822 15:70069630-70069652 AGGACCGGTCCAGCAGACTCTGG + Intronic
1133234388 16:4381108-4381130 GTGACAGGTCCAGGAGCTGCAGG - Exonic
1133732601 16:8589844-8589866 AGCCCAGGACCAGCAGCCGCGGG + Intergenic
1136508911 16:30723877-30723899 GAGGGAGGTCCAGGAGCCGCTGG - Exonic
1136514394 16:30759229-30759251 AAGACAGATCCAGCCGCACCTGG + Exonic
1139545606 16:67648254-67648276 AAGGCTGGTGCAGCAGCCTCGGG - Exonic
1142211023 16:88808540-88808562 AAGCCAGATCCAGCACCCCCTGG + Exonic
1142935242 17:3324576-3324598 CAGACAGGACCATCAGCTGCAGG + Intergenic
1145933361 17:28701298-28701320 AAGGCAGATACAGCAGCAGCTGG - Intronic
1146399224 17:32490199-32490221 AAGTCTGTGCCAGCAGCCGCAGG - Exonic
1152073402 17:78145126-78145148 CAGGCTGGTCCAGCAGCCCCAGG + Intergenic
1152375964 17:79919188-79919210 CAAACAGGTCCAGCTGCAGCTGG + Intergenic
1152613647 17:81328313-81328335 AAGACAGGTGCATCAGCCCCGGG + Intronic
1152736701 17:82000808-82000830 AAGACAGGGCCAGGGGGCGCCGG - Intronic
1154111255 18:11570314-11570336 AAGACTGGTCCAGAGGCTGCAGG - Intergenic
1156093820 18:33505105-33505127 AAGACAGGTCAAGCAGTGGGGGG - Intergenic
1156340046 18:36202543-36202565 AAGACCTGTCCAGCTGCCTCTGG - Intronic
1156373082 18:36488931-36488953 GAGACAGGTTCAGGAGCCGAGGG + Intronic
1156566849 18:38201125-38201147 AAAACAGGTGCAGCAGCCCTAGG + Intergenic
1157669918 18:49519567-49519589 AAGACAGGGGCAGCAGGAGCTGG + Intergenic
1159631241 18:70751772-70751794 CAGACAGGACCCTCAGCCGCAGG + Intergenic
1160065747 18:75572871-75572893 GAGACAGCTCCAGCAGCCTGAGG - Intergenic
1160483831 18:79269854-79269876 AAGGCAGGGCCAGCAGGCGCAGG - Intronic
1161152987 19:2719433-2719455 CAGAGAGGTCCAGCAGCCTGAGG + Intronic
1162207338 19:9065706-9065728 GAGACATGTCCAGCAGCTCCAGG + Intergenic
1165093183 19:33397086-33397108 AGGGCAGGCCCAGCAGCTGCAGG - Intronic
1165405924 19:35631133-35631155 TCGACAGGTCCAGCAGACTCTGG + Exonic
1166044946 19:40224532-40224554 AAGCCACGCCCAGCAGCTGCAGG + Exonic
1167713676 19:51127184-51127206 AAGGCAGCTCCAGCACCCCCGGG - Exonic
1168442589 19:56382887-56382909 AAGACAGCTGCAGCAGCTTCAGG + Exonic
1168677331 19:58288300-58288322 AAGACAGTACCAGCAGACTCAGG - Intronic
925158313 2:1663722-1663744 ATGACAGGACCAGGTGCCGCCGG + Exonic
925370137 2:3338705-3338727 AAAACAAGTCCAACAGCCGTTGG + Intronic
926759532 2:16265604-16265626 AAGAAAGTTCCAGCATCCGGAGG - Intergenic
927554205 2:24021246-24021268 AAGACAGATCCAGGAGCAGGTGG - Intronic
928363489 2:30684276-30684298 AGGACAGGTCCCGGAGCTGCTGG + Intergenic
930020383 2:46998300-46998322 AGGCCAGATCCAGCAGCCGGGGG - Intronic
932955829 2:76350390-76350412 CAGACAGGACCCTCAGCCGCAGG + Intergenic
932999595 2:76905274-76905296 CAGACAGGACCCTCAGCCGCAGG - Intronic
935356194 2:102202163-102202185 AACACAGGTCCATGAGCAGCAGG - Intronic
937290215 2:120777530-120777552 CAGGCAGGTGCAGCAGCAGCTGG + Intronic
937865602 2:126749147-126749169 AGGACAGGTCGCGCAGCCTCGGG - Intergenic
941239862 2:163023891-163023913 AAGAAAGGAACAGCAGCCACAGG - Intergenic
943303490 2:186231240-186231262 AAGACAGGACCCTCAGCTGCAGG - Intergenic
947760508 2:232600414-232600436 GGGACAGGTGCAGGAGCCGCTGG - Intergenic
949030133 2:241791534-241791556 CTGACAGGTCCAGGAGCCCCAGG + Intronic
1169743446 20:8919539-8919561 AAGACAGGACCAGCATTCACTGG + Intronic
1170572712 20:17641458-17641480 TAGACAGGTCCTGCAGTCACAGG - Intronic
1171455854 20:25271775-25271797 CAGACAGGGCCAGTAGCAGCCGG + Intronic
1172310348 20:33913296-33913318 GAGCCAGGTTCAGCAGCAGCAGG - Intergenic
1174057658 20:47809752-47809774 AAGGCAGATCCAGGAGCCCCAGG - Intergenic
1175218136 20:57402243-57402265 AAGACAGCTCCAACTGCTGCTGG + Intronic
1175871208 20:62210312-62210334 CAGACAGGTCCCTCAGCCCCTGG - Intergenic
1176012465 20:62906390-62906412 ATGACAGGAGCAGCAGCCACTGG + Intronic
1176480412 21:7281155-7281177 AAGACAGGACCCTCAGCTGCAGG - Intergenic
1178921739 21:36743344-36743366 GAGTCATGTCCAGCAGGCGCTGG - Intronic
1179260144 21:39750798-39750820 GAGCCAGTTCCACCAGCCGCTGG + Intronic
1179912386 21:44456986-44457008 AAGACAGGTCCAGCAGCCGCAGG - Exonic
1182058389 22:27379079-27379101 GAAGCAGGTCCAGCAGCCACTGG + Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184228344 22:43143465-43143487 AAGAAAGGTTCCGCAGACGCTGG + Intergenic
1184768274 22:46583751-46583773 AAGTCAGCACCAGTAGCCGCGGG - Intronic
949215492 3:1562237-1562259 AAGACAGGTAGAGCAGCAGCTGG - Intergenic
949261241 3:2105181-2105203 AAGACAGCTGCAGCAGTGGCAGG - Intronic
949632489 3:5943800-5943822 CAGTCAGGTCCCGCAGCTGCAGG + Intergenic
949876899 3:8632233-8632255 CAGCCAGTTCCAGCAGCCGAGGG - Intronic
950234023 3:11303015-11303037 AAGACTGGACCAGCAGCCCTGGG - Intronic
951570577 3:24058718-24058740 CAGACAGGACCCTCAGCCGCAGG + Intergenic
951572898 3:24084167-24084189 CAGACAGGACCCTCAGCCGCAGG + Intergenic
953472706 3:43180611-43180633 AAGACAGGTCCAGCAGAAGTTGG + Intergenic
953522948 3:43659989-43660011 CAGACAGGCCCCTCAGCCGCAGG - Intronic
954548233 3:51456837-51456859 CAGACAGGTCCCTCAGCTGCAGG - Intronic
958200797 3:90312293-90312315 AAGACAGGACCCTCAGCTGCAGG + Intergenic
962620211 3:137170492-137170514 AACCCAGGTCATGCAGCCGCAGG - Intergenic
966773105 3:183521374-183521396 AAGACTGGCCCAGCACCCTCTGG - Intronic
970500222 4:16669373-16669395 GAGACAGGTACAGCTGCCTCTGG + Intronic
973245426 4:48005630-48005652 CTGACAGGTCCAGGAGCCCCAGG - Intronic
974954345 4:68619647-68619669 CAGACAGGTCCCTCAGCTGCAGG - Intronic
975319466 4:72994058-72994080 GAGTCAGGACCAGCAGCCTCTGG - Intergenic
977042540 4:92032049-92032071 CTGACAGGTCCAGGAGCCCCAGG - Intergenic
977541222 4:98320695-98320717 CAGACAGGTCCCTCAGCTGCAGG - Intronic
977571811 4:98636871-98636893 AAGAGAGGTTCAGCAACTGCAGG + Intronic
978150386 4:105427092-105427114 CAGACAGGTCCCTCAGCTGCAGG - Intronic
981407877 4:144392471-144392493 CAGACAGGACCCTCAGCCGCAGG - Intergenic
981479940 4:145228323-145228345 AAGTCAGGTCCCTCAGCTGCAGG + Intergenic
985484401 5:140506-140528 CGGACAGGTCCAGGAGCTGCAGG + Exonic
986035201 5:3930370-3930392 AAGAGATGTCCAGCAGCCTTAGG - Intergenic
987279655 5:16400205-16400227 AAGTCAGGTCCCTCAGCTGCAGG + Intergenic
989123809 5:38031684-38031706 AAGACAGGGCCAACACCAGCAGG - Intergenic
991555506 5:67890393-67890415 CAGACAGGACCCTCAGCCGCAGG - Intergenic
991958195 5:72016660-72016682 AAGACAGATCCTGGAGCAGCTGG + Intergenic
992926480 5:81592765-81592787 CAGACAGGACCATCAGCTGCAGG - Intronic
993046414 5:82872095-82872117 CAGACAGGACCCGCAGCTGCAGG + Intergenic
995385141 5:111580729-111580751 AAGACAGGACCCTCAGCTGCAGG + Intergenic
995480470 5:112587204-112587226 AAGTCAGGTCCCTCAGCTGCAGG - Intergenic
995669937 5:114591425-114591447 AAGACAGCTGCAGCAGCTCCAGG + Intergenic
996513319 5:124342091-124342113 AAGACAGGACCAGCAGGCCAGGG + Intergenic
999357987 5:150955294-150955316 AAGACAGGCCCTGCAGCCCCAGG - Intergenic
999583212 5:153062542-153062564 CAGATAAGTCCAGCAGCCGGTGG - Intergenic
1000343709 5:160296863-160296885 AAGACAGGTCCAGTTGCCCAAGG - Intronic
1001310197 5:170604802-170604824 AAGACAGGTTCAGCCCCCCCAGG + Intronic
1002196437 5:177504093-177504115 GATCCAGCTCCAGCAGCCGCCGG + Exonic
1002333435 5:178461326-178461348 AAGACAGGCCCATCACCCACAGG + Intronic
1002564071 5:180100212-180100234 GAGACAGGGCCACCAGCAGCCGG - Intergenic
1004113383 6:12743544-12743566 CTGACAGGCCCAGCAGCCCCAGG - Intronic
1005322685 6:24670376-24670398 CTGACAGGTCCAGGAGCCCCTGG - Intronic
1006121694 6:31810775-31810797 GAGCCACGTCCAGCAGCAGCAGG + Exonic
1006122720 6:31816926-31816948 GAGCCACGTCCAGCAGCAGCAGG - Exonic
1006124583 6:31829120-31829142 GAGCCACGTCCAGCAGCAGCAGG - Exonic
1006495130 6:34417317-34417339 AAGCCAAGTACAGCAGCAGCCGG + Intronic
1010837982 6:80613001-80613023 AAGACAGGTCCCTCAGCTGCAGG - Intergenic
1015717157 6:136204795-136204817 AAGACAGGTCCAGGAGCTTTGGG + Intergenic
1017043257 6:150324728-150324750 AGGACAGGCCCAGCAGCTGGTGG + Intergenic
1018236659 6:161732408-161732430 AAGACAGGAACAGCAGACACTGG - Intronic
1019162772 6:170080319-170080341 AAGACAGGTACAGCCCCAGCTGG + Intergenic
1021520703 7:21536762-21536784 AAGTCAGGCACAGCAGCTGCTGG + Intergenic
1024092106 7:45952617-45952639 CAGACAGGTCCCTCAGCTGCAGG + Intergenic
1024821965 7:53342402-53342424 CTGACAGGTCCAGGAGCCCCAGG + Intergenic
1025320935 7:58092366-58092388 CAGACAGGACCCTCAGCCGCAGG - Intergenic
1025590979 7:62859696-62859718 AAGACAGGACCCTCAGCTGCAGG - Intergenic
1026774472 7:73222851-73222873 AAGACCGATCCAGAATCCGCTGG - Intergenic
1027015330 7:74776240-74776262 AAGACCGATCCAGAATCCGCTGG - Intronic
1027072701 7:75169715-75169737 AAGACCGATCCAGAATCCGCTGG + Intergenic
1028730821 7:94146708-94146730 AAGGCAGGCCCAGCAGAGGCAGG - Intergenic
1030151796 7:106413763-106413785 ATGACAGAGCCAGCAGCAGCTGG + Intergenic
1032418038 7:131753829-131753851 AAGAGAGGTTAAGCAGCTGCAGG - Intergenic
1033371563 7:140713825-140713847 CAGACAGGACCATCAGCTGCAGG + Intronic
1034312651 7:150102664-150102686 AAGAAAGGTCCAGCACCATCAGG - Intergenic
1034427091 7:151019661-151019683 AAGCCAGGTCCAGCACCTGGAGG - Intronic
1034794206 7:153997993-153998015 AAGAAAGGTCCAGCACCATCAGG + Intronic
1037483299 8:19325084-19325106 AAGGCAGGACCAGCAGACGCCGG - Intronic
1038322168 8:26537331-26537353 AAGACAAGTTCAGGAGCTGCAGG + Intronic
1038541417 8:28393248-28393270 AAAACAGGCCCAGCACCCACTGG + Intronic
1038911327 8:31967928-31967950 AATACTGGTACAGCAGCCCCAGG + Intronic
1041613870 8:59882767-59882789 AAGACAGGACCCTCAGCTGCAGG - Intergenic
1044727002 8:95202172-95202194 AAGACAGGTGCAGCAGCTTCAGG - Intergenic
1046880979 8:119307659-119307681 AAGTCAGGTCCTTCAGCTGCAGG - Intergenic
1048207518 8:132427112-132427134 GAGAAGGGTCCAGCAGCAGCAGG + Intronic
1049500751 8:142963647-142963669 CTGACAGGTCCAGGAGCCCCAGG + Intergenic
1055745533 9:79439750-79439772 AAGACAGGACCCTCAGCTGCAGG - Intergenic
1061048245 9:128179021-128179043 AAGGCAGGTGCAGCTGCAGCAGG - Exonic
1061536385 9:131252691-131252713 AAGGCAGGTCCCACAGCCTCTGG - Intergenic
1061664778 9:132154129-132154151 GAGACAGCTCCAGCTGCCACTGG - Intergenic
1062087990 9:134658468-134658490 AGGACAGGCCCAGCAGGGGCGGG - Intronic
1062250619 9:135591989-135592011 AAGACAGGCCCAGCCTCGGCTGG + Intergenic
1062347048 9:136119599-136119621 AAGGCAGGGTCAGCAGCCCCTGG + Intergenic
1062352160 9:136144506-136144528 AAGTCTGGGCCAGCAGCCGGAGG + Intergenic
1062354044 9:136153528-136153550 AAGACAGGCAGGGCAGCCGCTGG - Intergenic
1203378846 Un_KI270435v1:8404-8426 CAGACAGGTCCCTCAGCTGCAGG + Intergenic
1185891921 X:3829270-3829292 AAGACAGAGCCAGCCGCCCCGGG - Intronic
1185897026 X:3867684-3867706 AAGACAGAGCCAGCCGCCCCGGG - Intergenic
1185902144 X:3906110-3906132 AAGACAGAGCCAGCCGCCCCGGG - Intergenic
1186623344 X:11264675-11264697 ATGACAGGGCCAGCAGCTGATGG + Intronic
1189037278 X:37505870-37505892 CAGACAGGTCCCGCAGCCACGGG + Intronic
1191192864 X:57685178-57685200 AAGACAGGACCCTCAGCTGCAGG - Intergenic
1191273549 X:58511279-58511301 AAGACAGGTCCCTCAGCTGCAGG - Intergenic
1191740421 X:64432060-64432082 CTGACAGGTCCAGGAGCCCCAGG + Intergenic
1192243832 X:69357445-69357467 ACGGCAGGCCCAGCAGCTGCAGG + Intergenic
1192973706 X:76260771-76260793 AAGTCAGGTCCCTCAGCTGCAGG + Intergenic
1195007542 X:100701204-100701226 TAGACAGGTCCAGTACCTGCAGG + Exonic
1199721149 X:150543512-150543534 AAGCCCGGGCCAGCAGCCACAGG - Intergenic