ID: 1179912783

View in Genome Browser
Species Human (GRCh38)
Location 21:44459245-44459267
Sequence CGCCACATGCTGGCCCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179912783_1179912788 0 Left 1179912783 21:44459245-44459267 CCAGGCAGGGCCAGCATGTGGCG 0: 1
1: 0
2: 1
3: 23
4: 215
Right 1179912788 21:44459268-44459290 GGGTGTCCAGCTCCACTGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 121
1179912783_1179912792 10 Left 1179912783 21:44459245-44459267 CCAGGCAGGGCCAGCATGTGGCG 0: 1
1: 0
2: 1
3: 23
4: 215
Right 1179912792 21:44459278-44459300 CTCCACTGTTTGGAGGAAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 152
1179912783_1179912791 9 Left 1179912783 21:44459245-44459267 CCAGGCAGGGCCAGCATGTGGCG 0: 1
1: 0
2: 1
3: 23
4: 215
Right 1179912791 21:44459277-44459299 GCTCCACTGTTTGGAGGAAGTGG 0: 1
1: 1
2: 0
3: 18
4: 168
1179912783_1179912789 3 Left 1179912783 21:44459245-44459267 CCAGGCAGGGCCAGCATGTGGCG 0: 1
1: 0
2: 1
3: 23
4: 215
Right 1179912789 21:44459271-44459293 TGTCCAGCTCCACTGTTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179912783 Original CRISPR CGCCACATGCTGGCCCTGCC TGG (reversed) Exonic
900123658 1:1059933-1059955 CTCCACCCGCAGGCCCTGCCAGG + Intergenic
900124069 1:1061868-1061890 CGCCCCACGCTGGCCCGGCCTGG - Intergenic
900400096 1:2469532-2469554 AGCCATGGGCTGGCCCTGCCCGG + Intronic
900799884 1:4730720-4730742 AGCCACATCTGGGCCCTGCCTGG + Intronic
901739962 1:11335337-11335359 CGGCACATGCGGGTCCTGTCTGG - Intergenic
903175062 1:21575769-21575791 CGCCTCATGCAGGGCCTGCTTGG - Exonic
905785873 1:40757185-40757207 TGACACATGGTGCCCCTGCCTGG - Intronic
906060155 1:42943287-42943309 CGCCTCATGCTGGCCGTGGGAGG - Exonic
911122790 1:94312718-94312740 CACCACACCCTGGTCCTGCCTGG + Intergenic
911870028 1:103085498-103085520 CGCCACATAGTGGCCCTGACTGG + Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
914889716 1:151612129-151612151 CGGCGCGTGCTCGCCCTGCCTGG - Exonic
918523027 1:185435897-185435919 AGCCAGATGGTGGCCCAGCCAGG + Intergenic
919924354 1:202184844-202184866 CGCCACCTGGTGGCCTTTCCAGG - Intergenic
920033284 1:203049777-203049799 CGCCAGAGGCTGGGCATGCCAGG + Intronic
922672134 1:227518626-227518648 CACCACATGCTGGGCCCACCAGG - Intergenic
923372692 1:233328453-233328475 GGCCACCTCCTGGCCCTGCCAGG - Exonic
1063968889 10:11367692-11367714 CGCCTCCTGCTGGCCCTCCCTGG - Intergenic
1064463730 10:15559202-15559224 CCTCACATGCTGGCCTTGGCCGG + Intronic
1067037944 10:42933227-42933249 CGCAGCGCGCTGGCCCTGCCCGG - Intergenic
1068934255 10:62620834-62620856 CGTGACATGCTTGCCCTGTCTGG + Intronic
1069820044 10:71221796-71221818 AGCCAGATGGTGGCACTGCCAGG - Intronic
1070932450 10:80271011-80271033 CGCCACATTCTGGGTCTTCCTGG + Intergenic
1072256851 10:93629443-93629465 TGCTACTTGCTGGCCCAGCCAGG - Intronic
1072706957 10:97687551-97687573 CGGCGAAAGCTGGCCCTGCCGGG + Intergenic
1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG + Intronic
1073328640 10:102656965-102656987 CAGCACTTGGTGGCCCTGCCGGG + Exonic
1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG + Intronic
1074528196 10:114279113-114279135 AGCCAAGTGCTGGCCCTGCAGGG + Intronic
1076670571 10:132118552-132118574 TTCCACATGCTGGCCCAGCCTGG - Intronic
1076804574 10:132849060-132849082 CGCCCCATGCAGGCCAGGCCGGG - Intronic
1076820669 10:132937832-132937854 TGGCACCTGCTGGCCCTTCCTGG - Intronic
1077221630 11:1420591-1420613 CCCTCCATGCAGGCCCTGCCTGG + Intronic
1077373260 11:2193524-2193546 CGGCACACCCTGCCCCTGCCTGG - Intergenic
1078460843 11:11514276-11514298 TGCCCCAGGCTGGCCCTGCAGGG + Intronic
1081209103 11:40309937-40309959 TCCCTCCTGCTGGCCCTGCCTGG + Intronic
1083178941 11:60972044-60972066 CCCCAGATGCTGGACCTCCCTGG - Intronic
1083293530 11:61703003-61703025 CACCATCTGCTGGCCATGCCTGG - Intronic
1083602560 11:63958028-63958050 CCCCAGATGCTTGCTCTGCCAGG - Intergenic
1084378941 11:68798411-68798433 CGCCACCTGCTGGTTCTGTCAGG + Intronic
1085808309 11:79657272-79657294 AGCCCCATGCTGGAGCTGCCTGG + Intergenic
1089348521 11:117807651-117807673 CGACACCTGCTGGCCATGGCAGG - Intronic
1090406162 11:126476797-126476819 CGCCACTGCCTGGCCCAGCCTGG - Intronic
1094493629 12:30976399-30976421 CACCACATGCTGGCTCTAGCTGG - Intronic
1096241562 12:49962581-49962603 CCCCTCATGCTGGCCCACCCTGG + Intronic
1097631625 12:62071278-62071300 AGCCACATGCTGACCTTCCCGGG - Intronic
1100978111 12:100142900-100142922 CGCCTCGTGCCGGCCCCGCCTGG - Intergenic
1104825791 12:131708749-131708771 CGCCACTTGTAGGCCCTGCTTGG - Intergenic
1113595752 13:111530590-111530612 CTCCAGATCCTGGCCCTGACCGG + Intergenic
1113930651 13:113967258-113967280 CCTCCCAGGCTGGCCCTGCCAGG + Intergenic
1118737365 14:68711626-68711648 CCCCATCTGCTTGCCCTGCCTGG + Intronic
1119477914 14:74941886-74941908 CCCCACAAGCTGTCCCTGCAGGG - Exonic
1121532910 14:94671109-94671131 CTGCACGTGCTGGCCCTGCCTGG - Intergenic
1122017117 14:98805659-98805681 CCCCACATGCTGCCCTGGCCTGG + Intergenic
1122415623 14:101548284-101548306 CCCCACTTGCTATCCCTGCCTGG + Intergenic
1122971394 14:105153672-105153694 CCCCTCTTGCTGGCCCTGTCGGG - Intronic
1123105690 14:105840137-105840159 CACCACGTGCTGGCCCAGGCTGG - Intergenic
1123113396 14:105883192-105883214 GGCCAAAGGCTGGGCCTGCCAGG - Intergenic
1123880703 15:24675915-24675937 CGCCACGCCCTGGCCCTGGCAGG - Exonic
1124619051 15:31263886-31263908 AGCCACATGCTAGCCAGGCCCGG + Intergenic
1125328905 15:38564178-38564200 CGCCACCTGGTGGCCCCTCCCGG - Intronic
1127480275 15:59371881-59371903 CGCCAGGTGCTCGCCCTACCTGG + Intronic
1129262281 15:74375026-74375048 GGCCACATGTTGTCCCAGCCTGG - Intergenic
1129722707 15:77886979-77887001 AGCCCCATGGTGGCCCTGGCAGG - Intergenic
1130413999 15:83672936-83672958 TGCCACATGCTGGACCTCCCAGG - Intronic
1131050977 15:89347683-89347705 ATCCACAGGCTGGCACTGCCAGG - Intergenic
1132736489 16:1388507-1388529 GACCCCATGCTGACCCTGCCCGG + Intronic
1132746601 16:1438812-1438834 CACCTCATGCTGCCCCTGCAGGG + Exonic
1133879548 16:9768003-9768025 AGCCACAGGCTGGCTCTGTCTGG + Intronic
1136477141 16:30520485-30520507 CGCCTCGTCCTGGCTCTGCCAGG - Intronic
1136718346 16:32302063-32302085 TCCCAGATGCTAGCCCTGCCAGG - Intergenic
1136836720 16:33508333-33508355 TCCCAGATGCTAGCCCTGCCAGG - Intergenic
1138435959 16:57000230-57000252 GGCCACCTGCTGTCCCAGCCAGG + Intronic
1139399765 16:66671950-66671972 CACCACATCCTCGACCTGCCGGG - Intronic
1142058718 16:88016227-88016249 CGCCACATGCTTCTCCTGCATGG - Intronic
1142358104 16:89613609-89613631 GGCCACCTGCTGCCCCTCCCAGG - Intronic
1142418140 16:89954213-89954235 GGACTCATCCTGGCCCTGCCTGG + Intronic
1203008082 16_KI270728v1_random:215702-215724 TCCCAGATGCTAGCCCTGCCAGG + Intergenic
1142560248 17:805281-805303 CGGGAGATGCTGGCCCTGCCTGG + Intronic
1143318677 17:6053346-6053368 CGCTGCAGGCTGGCGCTGCCTGG + Intronic
1143562751 17:7705286-7705308 CGCCCCATGCCGCCCCCGCCCGG + Exonic
1143609016 17:8006969-8006991 TGCCACATGCTGGCCCCTCCAGG - Intronic
1143767100 17:9144988-9145010 CTCCACCTTCTGGCCCTCCCTGG - Intronic
1144785707 17:17830567-17830589 CTCTGCATGCTGCCCCTGCCAGG - Intronic
1145806966 17:27741413-27741435 AGCCACATACTGGCTCTGGCTGG + Intergenic
1147366607 17:39963313-39963335 TGCCCCATCCTGGCCCTCCCAGG + Intronic
1149521840 17:57323564-57323586 AGCCCAATCCTGGCCCTGCCAGG - Intronic
1150057314 17:62030250-62030272 CACCGTGTGCTGGCCCTGCCTGG - Intronic
1150108531 17:62478943-62478965 CCCCACCTCCTGGCCCGGCCTGG + Intronic
1151304702 17:73255846-73255868 TGCCACCTGCTGGCCAGGCCAGG - Intronic
1151945161 17:77315739-77315761 CGGCACAGGCTGGGCCTGGCAGG - Intronic
1152000892 17:77644744-77644766 AGTGACATGCTGGGCCTGCCTGG - Intergenic
1152434154 17:80264857-80264879 CACCACCTTCTGGCCCTTCCTGG + Intronic
1152596789 17:81241754-81241776 GGCCACATCCTGACTCTGCCCGG + Intergenic
1152879650 17:82807864-82807886 TGCCTCTGGCTGGCCCTGCCGGG + Intronic
1153724727 18:7943097-7943119 CTCCCCATCCTTGCCCTGCCTGG + Intronic
1153779135 18:8478844-8478866 CTCCACCTGCTGGCTATGCCTGG - Intergenic
1157559589 18:48637135-48637157 CCCCACAGGCTGCCCCTCCCAGG - Intronic
1157565566 18:48676945-48676967 CGCCACCTGCTGGGGCTGCCAGG - Intronic
1158676968 18:59529178-59529200 CCCCACAGGGAGGCCCTGCCCGG + Intronic
1160187095 18:76684389-76684411 CGCAGCATGGGGGCCCTGCCAGG - Intergenic
1161519736 19:4717133-4717155 CAGGACACGCTGGCCCTGCCTGG - Intronic
1161595139 19:5147388-5147410 CCCCTGACGCTGGCCCTGCCTGG - Intronic
1163020882 19:14480221-14480243 CGCCACCTGCTGGCCGCTCCCGG + Intronic
1163687384 19:18719442-18719464 GGCCAGATCCTGGGCCTGCCGGG - Intronic
1165236932 19:34428817-34428839 CGCCACACATTGGCGCTGCCGGG - Intronic
1165966968 19:39590014-39590036 TCCTACATGCTGTCCCTGCCAGG + Intergenic
1166326436 19:42053822-42053844 CACCTCACGGTGGCCCTGCCGGG + Exonic
1166344163 19:42155049-42155071 CCCCCCAGGCTGGCCATGCCTGG - Intronic
1166944440 19:46388324-46388346 GGCCACCTCCTGGCCCGGCCAGG - Intronic
1167095480 19:47373041-47373063 CCCCACAGACTGGGCCTGCCTGG + Intronic
1167097357 19:47381433-47381455 CTCCACCCGCTGGCCCTGGCTGG + Intronic
926054377 2:9765782-9765804 GGTCACATGCTGGGCTTGCCTGG + Intergenic
926105028 2:10144730-10144752 CTCCACATGCTGACCCTCCCTGG - Intronic
926126958 2:10277827-10277849 CGCCCGATGCTGCCGCTGCCCGG - Intergenic
926809794 2:16746096-16746118 TGCCACAAGCTGGCCCTGTGTGG - Intergenic
934529629 2:95076894-95076916 CGCCACCTGCTGGCCCGAACTGG - Intergenic
934567419 2:95348262-95348284 GGCCGGATGCTGGCCCTGGCAGG + Intronic
935946276 2:108289436-108289458 AGACACATGCTGGGCCTGCAAGG + Intronic
940846892 2:158651523-158651545 CGGCACATGCTGGAGCTGGCTGG - Intronic
941095723 2:161238074-161238096 CGCCACAGGCTGGGCGCGCCCGG - Intergenic
944270998 2:197785497-197785519 GGCCACAGGCGGGCCCTGCCAGG + Intronic
947712948 2:232326198-232326220 CGCCACCTGCTGGCCCACCAGGG + Intronic
947732631 2:232439654-232439676 CGCCACCTGCTGGCCCACCAGGG + Intergenic
947740339 2:232481930-232481952 TGCCACCTCCTGGCCCGGCCAGG - Intronic
947746943 2:232512690-232512712 CGCCCCCAGCTTGCCCTGCCTGG + Intergenic
947866352 2:233400453-233400475 CGCCTCATGCTGTCCTGGCCTGG + Intronic
948456836 2:238108476-238108498 CATCAGCTGCTGGCCCTGCCCGG + Intronic
948588432 2:239035446-239035468 CGCCACCTGGTGGTGCTGCCTGG - Intergenic
948892208 2:240913027-240913049 GGCCACATCCAGGCCCTGTCAGG + Intergenic
1169147701 20:3264270-3264292 CGGCAGCTGCTGGCCTTGCCAGG - Intronic
1172011968 20:31850833-31850855 CCCCACAGGCTGGCCCAGCAGGG - Intronic
1173521453 20:43703275-43703297 CAGCACTGGCTGGCCCTGCCTGG + Intronic
1173656063 20:44701084-44701106 GGCCACATGCAGGCCCTGCTTGG + Intergenic
1173793140 20:45841032-45841054 CGCCCCCTGCTGACCCTGGCTGG + Exonic
1174380373 20:50152328-50152350 CACCACATGCAGCCCTTGCCTGG - Intronic
1175168218 20:57061443-57061465 CTCCACATGTGGGACCTGCCAGG + Intergenic
1175206014 20:57311851-57311873 CGGCACATCCTGGGCCAGCCAGG - Intergenic
1175216811 20:57395630-57395652 CGCCGCCTCCTGCCCCTGCCTGG + Intronic
1175333415 20:58179722-58179744 CGCCCCCTGCTGGCCACGCCTGG + Intergenic
1175529467 20:59664488-59664510 AGCCACTTGCTGACCCTGTCTGG + Intronic
1175901831 20:62363017-62363039 CCCTCCCTGCTGGCCCTGCCAGG + Intronic
1177883360 21:26719853-26719875 CGCCATTTGTTGGGCCTGCCCGG - Intergenic
1179165475 21:38932192-38932214 CACCACAGCCTGGACCTGCCAGG + Intergenic
1179270616 21:39847905-39847927 GGGAACATGCTGGCCCCGCCCGG + Intergenic
1179381785 21:40906086-40906108 CTCCACATCCTGGCACTGCTTGG - Intergenic
1179510713 21:41871435-41871457 AGCCACAGGCTGTCCCTGTCTGG + Intronic
1179912783 21:44459245-44459267 CGCCACATGCTGGCCCTGCCTGG - Exonic
1179923723 21:44521425-44521447 CGCCACGTGCTGCCCCGACCCGG + Intronic
1180060216 21:45381220-45381242 CGCCACACACAGGCCTTGCCTGG - Intergenic
1181235191 22:21444297-21444319 CGCCAAGTGCTGCCCCAGCCTGG - Intronic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181988711 22:26820457-26820479 GGGCACATGCTGGGCCTCCCTGG + Intergenic
1182349567 22:29691731-29691753 TGCCACCTGCACGCCCTGCCTGG - Intronic
1184273188 22:43396438-43396460 ATCCTCATGCTGGCCCTGCGAGG + Intergenic
1184282002 22:43442628-43442650 GGCCTCATGCTGGCTCTGTCAGG + Intronic
1184392034 22:44208131-44208153 CGCTGCAGGCTGGCTCTGCCTGG + Exonic
1184583877 22:45434768-45434790 ATCCGCATGGTGGCCCTGCCTGG - Intergenic
1184806618 22:46798763-46798785 CGCCACCTCCTGGCCAAGCCAGG - Intronic
1184931249 22:47682733-47682755 CACCAGATGCTGAACCTGCCTGG - Intergenic
1185110488 22:48897696-48897718 CGGGACATGAGGGCCCTGCCTGG + Intergenic
1185322617 22:50208953-50208975 CGCCCCAAGCTGGCCCTGCAGGG - Intronic
1185335119 22:50267913-50267935 CGCCACCTTCTGGCGCAGCCGGG + Exonic
953044191 3:39280802-39280824 CGCCCCAAGCTGGCCAGGCCAGG - Intronic
953904073 3:46859474-46859496 CGCCACGTGCTGGCCACGCTGGG - Exonic
954759002 3:52860678-52860700 GACCACATGCTGGCACTGACCGG + Intronic
954801480 3:53189483-53189505 GGCCAAATGCTGGCTCTGCCTGG + Intronic
962342561 3:134597603-134597625 AGCCACTTGCTGGGGCTGCCTGG - Intergenic
968656302 4:1779815-1779837 GGCCACATGGTGGCCCAGGCTGG - Intergenic
968913414 4:3486859-3486881 AGCCTCCTGCTGCCCCTGCCCGG - Intronic
968969529 4:3786361-3786383 GGCCACCTGCTGGTGCTGCCTGG + Intergenic
969365301 4:6690600-6690622 GGCCACATCCTGGCCTTCCCGGG + Intergenic
971160619 4:24130011-24130033 CTCCAAATGCTGTCCCTCCCCGG - Intergenic
981559579 4:146032684-146032706 CGCCTCCTGCTGCCCCGGCCAGG + Intergenic
984245035 4:177264665-177264687 ACCCACATGCTGGCCTTGACAGG - Intergenic
985280809 4:188283913-188283935 TGCCACATGCTGGTGGTGCCTGG + Intergenic
985491952 5:185528-185550 AGCCACACTCTGGCACTGCCTGG + Exonic
996874847 5:128229047-128229069 TCCCATAAGCTGGCCCTGCCTGG - Intergenic
996968157 5:129330755-129330777 TGCACCATGCTGCCCCTGCCAGG - Intergenic
997351506 5:133234494-133234516 TGCCCAATGCTGGCCCTTCCAGG + Intronic
997791859 5:136769102-136769124 CAGCTCATCCTGGCCCTGCCTGG - Intergenic
998213866 5:140222754-140222776 CTCCACATGCTGCCCCTACAGGG - Intronic
998456848 5:142280333-142280355 GGCCTCAGGCTGGCCCTGCTTGG - Intergenic
999175105 5:149626647-149626669 CGCCATGTGCTGGCCCTGGCTGG + Intronic
999247255 5:150161781-150161803 CGCCACCTGCTGGCACTCCTGGG - Intergenic
999331725 5:150678026-150678048 CACCCCATGCTGGCCCTCACTGG - Exonic
1000072766 5:157756178-157756200 CTACACATGCTGGCCCTGCCTGG - Exonic
1003147140 6:3518120-3518142 AGCCCCAGGCTGGCACTGCCCGG - Intergenic
1006397841 6:33798622-33798644 CGCTGCATGCAGGCCCTGCCTGG + Intronic
1006423662 6:33950672-33950694 CCCCTCCTCCTGGCCCTGCCAGG - Intergenic
1006844449 6:37052486-37052508 CTGCACCTGCCGGCCCTGCCCGG + Intergenic
1006981626 6:38152393-38152415 CGTCACGTGGTGGCCATGCCTGG - Exonic
1007693555 6:43717963-43717985 CAACACATCCTGCCCCTGCCTGG + Intergenic
1007787050 6:44286592-44286614 TGCCTCAGGCTGGGCCTGCCTGG + Intronic
1015114741 6:129635485-129635507 CGGCAGAGGCTGGCCCTGCATGG + Intronic
1016614217 6:146028352-146028374 CGTCCCTTGCAGGCCCTGCCAGG + Intronic
1016990529 6:149925134-149925156 CTCCAGATTCTGGCCCTGCCTGG - Intergenic
1016997529 6:149970809-149970831 AGCCAGCTGATGGCCCTGCCTGG + Intronic
1017001271 6:149999367-149999389 AGCCAGCTGATGGCCCTGCCTGG - Intergenic
1017010993 6:150063886-150063908 AGCCAGCTGATGGCCCTGCCTGG - Intronic
1018276897 6:162142338-162142360 CTCCACATCCTGTCTCTGCCAGG + Intronic
1019596978 7:1862623-1862645 AGCCACTTGCTGGACCGGCCAGG - Intronic
1019712755 7:2524961-2524983 CGCCACCTGTTGCCGCTGCCTGG - Intronic
1019747755 7:2710009-2710031 CACCACACGCGGGCCCTGGCAGG - Intronic
1020076136 7:5260278-5260300 CGCCACACCCAGGCCTTGCCTGG + Intergenic
1021963547 7:25895527-25895549 CGCCCCCTGCTGGCCCGCCCCGG + Intergenic
1022453129 7:30534293-30534315 CTCCACTTCCTGACCCTGCCTGG + Intronic
1024973578 7:55092780-55092802 CACCGCCCGCTGGCCCTGCCAGG - Intronic
1025262454 7:57427752-57427774 AGGCACATGCGGACCCTGCCTGG + Intergenic
1026931800 7:74226981-74227003 CCCCAAGTGCTGGCCCTGCCTGG - Intronic
1028258208 7:88627196-88627218 CTCCTCATGGTGGCCCTGCCAGG + Intergenic
1029210996 7:98908266-98908288 TGCCAGATCCTGGGCCTGCCAGG - Intronic
1031553510 7:123143574-123143596 TGCAACATGCTGCCACTGCCAGG + Intronic
1032037567 7:128531484-128531506 CCCCACCTCCTGGCCCGGCCTGG + Intergenic
1032519978 7:132536523-132536545 TGCCACATGGGGGCCCTGCAGGG - Intronic
1034099053 7:148436103-148436125 CTCCCCATGCTGGCTCTTCCTGG - Intergenic
1034431925 7:151045435-151045457 CTCCACATGCTGGCCCTCCTGGG - Exonic
1034860585 7:154591749-154591771 CGCCAGCTGCAGGCCCTGGCTGG + Intronic
1035165628 7:156988077-156988099 CACCACATTCTGGCCCGGCGCGG - Intergenic
1037348391 8:17923451-17923473 CCCCTCCTGCTGGCCCTGTCGGG + Intronic
1037795813 8:21993793-21993815 AGTCAGATGCAGGCCCTGCCAGG - Intronic
1041099188 8:54379390-54379412 CTCCACATGCCAGACCTGCCCGG + Intergenic
1049405340 8:142449796-142449818 CGCCGCGTCCTGGCCCGGCCCGG + Exonic
1049656470 8:143800798-143800820 CGCCGCAGGCTCGCCCTGCCGGG - Intronic
1049724201 8:144137962-144137984 CGGCACGTGCTGGCGCTGACTGG + Exonic
1049799689 8:144512036-144512058 CCCCAGCTGCGGGCCCTGCCTGG - Exonic
1052866356 9:33466803-33466825 CGCCGCCTGCTGGACATGCCAGG + Intronic
1056538587 9:87552176-87552198 CCCTACTTGCTGGCCTTGCCAGG - Intronic
1058744249 9:107974439-107974461 CTCCAAATGCTGGCCTTTCCAGG + Intergenic
1060548704 9:124475374-124475396 CCCCACAGCCTGGCCTTGCCTGG - Intronic
1061854158 9:133432662-133432684 CGCCACATTCTGTCCCATCCAGG - Exonic
1061888386 9:133604926-133604948 TGCAACAGGCTGGCCCTGTCTGG - Intergenic
1062273446 9:135720101-135720123 CTGCTCCTGCTGGCCCTGCCTGG - Intronic
1062545644 9:137062681-137062703 AGGCACATGCAGACCCTGCCTGG - Exonic
1185759810 X:2681760-2681782 TGCATCATGCTGGGCCTGCCTGG - Intergenic
1186770244 X:12811158-12811180 CTGCACATGCTGGGCCTGCGTGG - Intronic
1188473128 X:30562409-30562431 AGCCTCATGCTGGCCCGCCCAGG - Intronic
1191149983 X:57210020-57210042 TGCACCATGCTGCCCCTGCCAGG + Intergenic
1192172568 X:68865976-68865998 CCCCACAGACTGGCCCTGGCAGG + Intergenic
1199643421 X:149883647-149883669 GGCCAGATCCAGGCCCTGCCAGG + Intronic