ID: 1179913351

View in Genome Browser
Species Human (GRCh38)
Location 21:44461434-44461456
Sequence ACCTCCCGCCACAGAGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179913336_1179913351 23 Left 1179913336 21:44461388-44461410 CCGGCCTCCTCTGCAGGGGCTGC 0: 1
1: 0
2: 3
3: 71
4: 592
Right 1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 221
1179913334_1179913351 25 Left 1179913334 21:44461386-44461408 CCCCGGCCTCCTCTGCAGGGGCT 0: 1
1: 0
2: 3
3: 44
4: 378
Right 1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 221
1179913339_1179913351 16 Left 1179913339 21:44461395-44461417 CCTCTGCAGGGGCTGCTGGCAGG 0: 1
1: 0
2: 10
3: 77
4: 560
Right 1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 221
1179913335_1179913351 24 Left 1179913335 21:44461387-44461409 CCCGGCCTCCTCTGCAGGGGCTG 0: 1
1: 1
2: 11
3: 67
4: 528
Right 1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 221
1179913338_1179913351 19 Left 1179913338 21:44461392-44461414 CCTCCTCTGCAGGGGCTGCTGGC 0: 2
1: 1
2: 6
3: 59
4: 471
Right 1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 221
1179913333_1179913351 26 Left 1179913333 21:44461385-44461407 CCCCCGGCCTCCTCTGCAGGGGC 0: 1
1: 0
2: 3
3: 29
4: 388
Right 1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179913351 Original CRISPR ACCTCCCGCCACAGAGCCTG GGG Exonic