ID: 1179917023

View in Genome Browser
Species Human (GRCh38)
Location 21:44484412-44484434
Sequence CCTGAAAAGGAAACAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179917023_1179917030 -4 Left 1179917023 21:44484412-44484434 CCCCCCACTGTTTCCTTTTCAGG No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179917023 Original CRISPR CCTGAAAAGGAAACAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr