ID: 1179917030

View in Genome Browser
Species Human (GRCh38)
Location 21:44484431-44484453
Sequence CAGGCATTCAGCTCAGTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179917027_1179917030 -7 Left 1179917027 21:44484415-44484437 CCCACTGTTTCCTTTTCAGGCAT No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data
1179917026_1179917030 -6 Left 1179917026 21:44484414-44484436 CCCCACTGTTTCCTTTTCAGGCA No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data
1179917021_1179917030 11 Left 1179917021 21:44484397-44484419 CCTCTACCAGTACTGCCCCCCAC No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data
1179917025_1179917030 -5 Left 1179917025 21:44484413-44484435 CCCCCACTGTTTCCTTTTCAGGC No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data
1179917023_1179917030 -4 Left 1179917023 21:44484412-44484434 CCCCCCACTGTTTCCTTTTCAGG No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data
1179917022_1179917030 5 Left 1179917022 21:44484403-44484425 CCAGTACTGCCCCCCACTGTTTC No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data
1179917028_1179917030 -8 Left 1179917028 21:44484416-44484438 CCACTGTTTCCTTTTCAGGCATT No data
Right 1179917030 21:44484431-44484453 CAGGCATTCAGCTCAGTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179917030 Original CRISPR CAGGCATTCAGCTCAGTCTA CGG Intergenic
No off target data available for this crispr