ID: 1179917311

View in Genome Browser
Species Human (GRCh38)
Location 21:44485775-44485797
Sequence CTCCCTTGTGGCTCCTCCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179917306_1179917311 11 Left 1179917306 21:44485741-44485763 CCACTAAGCAGCTCAACTCCAGG No data
Right 1179917311 21:44485775-44485797 CTCCCTTGTGGCTCCTCCGTCGG 0: 1
1: 0
2: 3
3: 27
4: 115
1179917308_1179917311 -7 Left 1179917308 21:44485759-44485781 CCAGGAGATAAACCATCTCCCTT 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1179917311 21:44485775-44485797 CTCCCTTGTGGCTCCTCCGTCGG 0: 1
1: 0
2: 3
3: 27
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179917311 Original CRISPR CTCCCTTGTGGCTCCTCCGT CGG Intergenic
901636676 1:10673784-10673806 CTTCCATGTGGACCCTCCGTGGG + Intronic
904540230 1:31227855-31227877 CTCCCTGGTGGCTCCAACGCTGG + Intronic
905782045 1:40720444-40720466 CACTCTTGTGGCTCTTCCATTGG + Intronic
907309236 1:53529883-53529905 CGCCCGTGTGGCTCCTCAGGTGG + Exonic
908786722 1:67741884-67741906 TTCCCATGTGGCTGCTCAGTTGG + Intronic
910050946 1:82973450-82973472 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
913696718 1:121333429-121333451 CTCCCTTGAGGCTGCTCTCTGGG + Intronic
914140842 1:144946631-144946653 CTCCCTTGAGGCTGCTCTCTGGG - Intronic
915524190 1:156466138-156466160 CTCCCTGCTGCCTCCTCAGTGGG - Exonic
917485585 1:175452041-175452063 CTCTCTTTTGGCTGCTGCGTTGG - Intronic
918362364 1:183772076-183772098 CTCCCTTCTGGCTCCCCCATCGG + Intronic
918809285 1:189094449-189094471 CTCCCTTCTGGCTCCCCAGTTGG + Intergenic
920484049 1:206351783-206351805 CTCCCTTGAGGCTGCTCTCTGGG + Intronic
923383786 1:233447025-233447047 CTCCCTTCTGGCTCCCCCATAGG - Intergenic
924412243 1:243818898-243818920 CTCCATTGTGGCTCCCATGTGGG - Intronic
924589318 1:245388051-245388073 CTCCCTGGTGGCTCATCTCTGGG + Intronic
1063098054 10:2925724-2925746 CTCTCTTGTTGATCCTTCGTTGG - Intergenic
1068134678 10:52940132-52940154 CTCCCTTCCGGCTCCCCCATCGG + Intergenic
1068258331 10:54543147-54543169 CTCCCTTCTGGCTCCCCCATTGG + Intronic
1072431160 10:95371957-95371979 TTCCGCTGTGCCTCCTCCGTTGG - Intronic
1076793309 10:132787650-132787672 CTTCCTCGTGTCTCCTCCGAGGG - Intergenic
1076798383 10:132809666-132809688 CTCCTCTGTGGCTCCTCCCCGGG + Intronic
1077490263 11:2857868-2857890 CTCTCTGCTGGCTCCTCCGGAGG - Intergenic
1079657680 11:23002782-23002804 CACCCTTGTAACTCCTCAGTGGG - Intergenic
1082085285 11:48044977-48044999 CTCCCTTTTTTCTCCTCCCTGGG + Intronic
1084666867 11:70581031-70581053 CTCCCTGGTGGCTCCTCAGAAGG - Intronic
1085238295 11:75031970-75031992 CTGCCTTGTGCCTGCTCCATGGG + Intergenic
1085684077 11:78605834-78605856 CTCCCTTCTGGCTCCCCCATTGG + Intergenic
1089941483 11:122422538-122422560 CTCCCTTGAGGATCTTACGTGGG - Intergenic
1090243816 11:125201920-125201942 CTGCCTTGTGGCTGCTCCTTGGG + Intronic
1094586569 12:31782429-31782451 CTCCCTTCTGGCTCCTCCATCGG + Intergenic
1102582468 12:113899314-113899336 CTCTATTGTGGCTCCTGCCTCGG - Intronic
1103607331 12:122097064-122097086 CTCGCTTGTGGTGCTTCCGTGGG + Intronic
1104935132 12:132360397-132360419 CGGCCTTCTGGCTCCTCCGAGGG - Intergenic
1106303200 13:28488012-28488034 CTCTCTTCTGGCTCCCACGTTGG - Intronic
1108267960 13:48731091-48731113 CACCCAGGTGGCTCCTCCCTGGG - Intergenic
1110835177 13:80074678-80074700 CTCCCTTCTGGCTCCTCCATTGG + Intergenic
1111292756 13:86188804-86188826 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
1111406237 13:87810886-87810908 CTCCCTTCTGGCTGCCCCATGGG - Intergenic
1113900814 13:113796970-113796992 CTCCCATGACGCACCTCCGTGGG - Intronic
1114050338 14:18916002-18916024 CGCCCTTGTGGACCCTACGTTGG + Intergenic
1114112220 14:19485930-19485952 CGCCCTTGTGGACCCTACGTTGG - Intergenic
1121798662 14:96755641-96755663 CTCCTTTGTCCCTCCTCCATAGG + Intergenic
1122371151 14:101229772-101229794 CTCCCTTCTGGCTCCCCCATGGG - Intergenic
1122899961 14:104778309-104778331 CTCCCCAGTGTCTCCTCGGTTGG - Intronic
1124313318 15:28647555-28647577 CTTCCTTGGGGCTCCTTCCTGGG + Intergenic
1126228299 15:46296479-46296501 CTCCCTTCTGGCTCCCCCATTGG + Intergenic
1126416610 15:48424397-48424419 CTCCAATCTGGATCCTCCGTGGG + Intronic
1130832554 15:87616386-87616408 CTCCCTTGTTCCTCCTCCTTGGG - Intergenic
1131075583 15:89493240-89493262 AGCCCTGGTGGCTCCTCCTTGGG + Intronic
1135121117 16:19767398-19767420 TGCCCTTCTGGCTCCTCCATCGG - Intronic
1135992390 16:27225904-27225926 TTCCCTTGTGGCTTCCCCGGAGG - Intronic
1142535562 17:615532-615554 CTCCCTTGCTGCCCCTCCCTAGG - Intronic
1143350604 17:6285488-6285510 CTCCTTTGTGGCCTCTCCATGGG + Intergenic
1144016178 17:11198681-11198703 CTCCCTACTGGCTCCTCCACTGG + Intergenic
1147911491 17:43858682-43858704 TTCCCTTGTGGCTTCTCCATAGG + Intronic
1148052024 17:44774236-44774258 CTCCCCTGTGGCTCCCCGGGTGG - Intronic
1148324809 17:46777005-46777027 CTCCCTTAGGGCTCCTCCTGTGG - Intronic
1148392234 17:47280819-47280841 CTCTGTTGTGGCTCCTCCCTAGG + Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1150248821 17:63694892-63694914 TTCCCTTGTAGCTCCTCCCCTGG + Exonic
1152593160 17:81223347-81223369 CTCCCTGGTGTCTCCTCCCCAGG - Intergenic
1157858913 18:51123999-51124021 CTCCCTTCTGGCTCCCCCATTGG - Intergenic
1158015219 18:52775523-52775545 CTCCCTTCTGGCTCCCCCATTGG - Intronic
1159345761 18:67201169-67201191 TTCCCTTCTGGCTCCCCCATTGG - Intergenic
1161036088 19:2085294-2085316 GTCACTTGTGTCTCGTCCGTGGG - Exonic
1163157897 19:15449307-15449329 TTCCCAGGGGGCTCCTCCGTGGG + Intronic
1166994634 19:46714330-46714352 CTCCCCTGTGCCTCCTCCCCAGG + Intronic
925415072 2:3664280-3664302 CTCTATGGTGGCTCCTCTGTAGG + Intronic
927574317 2:24189100-24189122 CTCCCCTCTGGCTCCTCCGCTGG + Intronic
935244026 2:101202953-101202975 CTCCTTTGGGGTGCCTCCGTGGG - Intronic
936633057 2:114225573-114225595 CTCTCTTTTGTCTTCTCCGTTGG - Intergenic
937336601 2:121066119-121066141 GTCCCTTCTGTCTCCTCTGTGGG + Intergenic
939996779 2:148927317-148927339 CTCCCTGGGGCCTCCTGCGTGGG + Intronic
940146383 2:150548989-150549011 CTCCTTTGTAGCTCCTGGGTTGG - Intergenic
944688920 2:202141677-202141699 CTGCCTCGTGGCTCCTCCTAAGG + Intronic
946032146 2:216713829-216713851 CTCCCTTGGGGCTTTTCCCTTGG - Intergenic
948691804 2:239711018-239711040 CTCCATTGTGACTGCTCTGTAGG + Intergenic
1172617759 20:36300395-36300417 TTTTCTTGTGTCTCCTCCGTGGG + Intergenic
1175968730 20:62673228-62673250 CTCCCTTCTGTCACCTCCCTCGG - Intronic
1179917311 21:44485775-44485797 CTCCCTTGTGGCTCCTCCGTCGG + Intergenic
1180468815 22:15638376-15638398 CGCCCTTGTGGACCCTACGTTGG + Intergenic
1180741169 22:18054116-18054138 CCCTCTTGTGGCTCCTCAGGAGG + Intergenic
1180864378 22:19107526-19107548 CTGCCCTGTGGCTTCTCCTTAGG + Intronic
1180955174 22:19738247-19738269 CTCCCTTGGGGCTCCCCAGTTGG + Intergenic
1181107428 22:20583411-20583433 TGCCCTTGTGGACCCTCCGTGGG - Intronic
1183134362 22:35872539-35872561 CTCCCTTCTGGCTCCCACATTGG - Intronic
1185112039 22:48905531-48905553 CTGACTTGTGTCTCCTCCCTCGG + Intergenic
951462258 3:22963853-22963875 CTCCCATATGGCTCCACAGTGGG + Intergenic
952580260 3:34824568-34824590 CTCCCTTCTGGCTCCCCCACTGG + Intergenic
952848784 3:37711099-37711121 TTCCCTTGTGGCCCCTCGCTTGG + Intronic
953088388 3:39697473-39697495 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
954124509 3:48520689-48520711 CTCCCTTCTGGCCCATCCATTGG - Intronic
959269732 3:104192333-104192355 CTCCCTTCTGGCTCCCCCTTTGG - Intergenic
961141996 3:124563535-124563557 CTCAGCTGTGGCTCCTCCCTGGG - Intronic
965321021 3:167251172-167251194 CTCCCTTCTGGCTCCCCCAGTGG + Intronic
966860752 3:184229969-184229991 CTCCCTGGTGCCTCATCCGACGG - Intronic
968455980 4:700009-700031 CGCCCCTCTGGCTGCTCCGTGGG - Intergenic
969283948 4:6190819-6190841 CTCCCTTGTGGCTCCTGGCTGGG + Intronic
969321205 4:6413957-6413979 CTCCCTGGTGGCTCTGCAGTTGG + Intronic
969436400 4:7191921-7191943 CTCCCTCGTGGCCCCTGGGTTGG + Intergenic
976088437 4:81429977-81429999 CTCCCTTTGGGCTCCCCCATAGG + Intronic
983774992 4:171595217-171595239 CCCCCATGTGGCTCCTAGGTGGG + Intergenic
985813688 5:2110891-2110913 CTCCCGTGTAGCTCCTCCTGTGG - Intergenic
986060816 5:4188477-4188499 CTCCCTTGTGGCTTCACGGACGG - Intergenic
986314095 5:6574553-6574575 CTCCCTTGCAGCCCCTCCTTTGG - Intergenic
990335014 5:54764048-54764070 CTCCCTTGTGGATTCTACCTGGG - Intergenic
996486599 5:124042272-124042294 CTCCCTTCTGGCTCCCCAGTTGG + Intergenic
998039524 5:138943667-138943689 CTCCCTTGCAACTCCTCCCTCGG + Intergenic
999141250 5:149363797-149363819 CTCACTTGTGGATCCTCCTGGGG + Intronic
1000167922 5:158673256-158673278 CTCCCTTCTGGCTCTCCCATTGG - Intergenic
1001565276 5:172695970-172695992 CCCCCTCGTGGCCCCTACGTGGG + Intergenic
1002586245 5:180250547-180250569 CCCCCTTGTGGCCCATCAGTTGG - Intronic
1002908575 6:1470812-1470834 CACCCTGATGGCTCCTCCCTGGG - Intergenic
1006592056 6:35165607-35165629 CTCCCTTCTGGCTCTTCAGGTGG - Intergenic
1011325724 6:86148681-86148703 CTCCCTTCTGGCTCCCTCATTGG - Intergenic
1014717969 6:124887797-124887819 CTCCCTTGTGGATCCCCCATTGG + Intergenic
1015156392 6:130101427-130101449 GTCCCTTGTGGCTCCCTAGTAGG - Intronic
1015440295 6:133240814-133240836 GTCCCTTCTGTCTCCTCCCTTGG + Intronic
1015685106 6:135850674-135850696 CCCCCTTGTGGCTCTGTCGTGGG + Intergenic
1019597566 7:1865246-1865268 CTCCACAGTGGCTCCTCCTTGGG + Intronic
1024203061 7:47126030-47126052 CTCCCTTCTGGCTCCCCCATGGG - Intergenic
1025820195 7:64955572-64955594 CTCCCTTCTGCCTCCCCCATTGG + Intergenic
1027462533 7:78472943-78472965 TTCCCTTGTGGTTCCTCAGTTGG - Intronic
1032544994 7:132734374-132734396 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
1034884738 7:154790693-154790715 CTGCCTCGTGGCTCATCCCTGGG - Intronic
1035390256 7:158499301-158499323 CTCCCTGGTGACTCGTCCGCTGG + Intronic
1035563573 8:627028-627050 CTCCCTTCTGTCTCCTCGGAGGG + Intronic
1036159067 8:6369715-6369737 ATCCCTTCTGGCTGCTCTGTGGG + Intergenic
1038442302 8:27579836-27579858 CTCCCCTGTGTCTCCTCTGGTGG + Intergenic
1039533552 8:38286735-38286757 CTCTCCTGTGGCTCCTCCCCAGG + Intronic
1043238456 8:77899695-77899717 CTCCCTTCTGGCTCCCCCATCGG - Intergenic
1046526152 8:115384491-115384513 CTCCCTTGTGGCGCATCCTATGG - Intergenic
1048326884 8:133446783-133446805 CTCCCTTGCTCCTGCTCCGTGGG - Intergenic
1049726982 8:144151507-144151529 CTCCTTTCTGGCTCCCCCATTGG + Intronic
1052134956 9:24898097-24898119 CTCCCTTCTGGCTCCCCCGTTGG + Intergenic
1053591419 9:39518195-39518217 CTCACTTGTGACTCCTCAGATGG + Intergenic
1053849263 9:42273554-42273576 CTCACTTGTGGCACCTCAGATGG + Intergenic
1054574888 9:66847094-66847116 CTCACTTGTGACTCCTCAGATGG - Intergenic
1060024682 9:120161228-120161250 TTGGCTTGTGGCTCCTGCGTAGG + Intergenic
1185942864 X:4340799-4340821 CTCCCTGCTGGCTCCCCCATTGG - Intergenic
1193257534 X:79367396-79367418 CTCCCTTTAGGCACCTCCCTGGG - Intronic
1193898241 X:87141122-87141144 CTCCCTTCTGGCTCCCTCATTGG + Intergenic
1195333801 X:103830435-103830457 ATCCCTTATGGGTCCTCTGTCGG + Intronic
1197696373 X:129554524-129554546 CTCCTTTGAGGCTCATCCATTGG - Intronic
1200852276 Y:7896188-7896210 CTCTCTTGTGGATACTCCATGGG - Intergenic