ID: 1179919631

View in Genome Browser
Species Human (GRCh38)
Location 21:44500389-44500411
Sequence GCCGCCCAGAGCAAGAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179919631_1179919637 7 Left 1179919631 21:44500389-44500411 CCCTCATTCTTGCTCTGGGCGGC 0: 1
1: 0
2: 1
3: 9
4: 88
Right 1179919637 21:44500419-44500441 CGCCAGGGTTTGCCTTCAAAAGG 0: 1
1: 0
2: 1
3: 7
4: 66
1179919631_1179919634 -9 Left 1179919631 21:44500389-44500411 CCCTCATTCTTGCTCTGGGCGGC 0: 1
1: 0
2: 1
3: 9
4: 88
Right 1179919634 21:44500403-44500425 CTGGGCGGCTGCTGGCCGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 519
1179919631_1179919640 23 Left 1179919631 21:44500389-44500411 CCCTCATTCTTGCTCTGGGCGGC 0: 1
1: 0
2: 1
3: 9
4: 88
Right 1179919640 21:44500435-44500457 CAAAAGGACTCATTTATCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 264
1179919631_1179919635 -8 Left 1179919631 21:44500389-44500411 CCCTCATTCTTGCTCTGGGCGGC 0: 1
1: 0
2: 1
3: 9
4: 88
Right 1179919635 21:44500404-44500426 TGGGCGGCTGCTGGCCGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179919631 Original CRISPR GCCGCCCAGAGCAAGAATGA GGG (reversed) Intronic
903273657 1:22207714-22207736 GCTGCCCAGAGCCAGATTGGGGG + Intergenic
903557356 1:24203327-24203349 CACGCCAAGAGGAAGAATGAAGG - Intergenic
905010064 1:34741329-34741351 GACGCTCTGAGCAAGAATAATGG + Intronic
907796911 1:57727030-57727052 GCAGCCATGAGCAAGAATGATGG + Intronic
909922662 1:81401166-81401188 GCCACCCAGAGCAAGTATGTTGG - Intronic
910712261 1:90194094-90194116 GCTGCCCAGTCCAAGAATGTTGG + Intergenic
917480070 1:175404132-175404154 GCTGCCCAGAGAGAGAATGAGGG - Intronic
919814319 1:201428175-201428197 TCAGCCCAGTGCTAGAATGAAGG + Intronic
1062933709 10:1369465-1369487 GGCGCACAGAGAAAGAGTGAGGG - Intronic
1067270864 10:44790267-44790289 GAAGCCCAGGGCAAGTATGAGGG + Intergenic
1067414065 10:46090707-46090729 GCCACCCTGAGCAGGACTGAGGG + Intergenic
1067434114 10:46265217-46265239 GCCACCCTGAGCAGGACTGAGGG + Intergenic
1073105567 10:101030592-101030614 TCAGCCCCGAGCAGGAATGAGGG - Intronic
1073120445 10:101119502-101119524 GTAGCCCAGGGCAAGAATGGTGG + Intronic
1073580984 10:104665335-104665357 GCTGCCCAGAGAAAGAATGAGGG + Intronic
1076858821 10:133130050-133130072 TCTGCCCAGAGCGAGAATGCTGG - Exonic
1077403161 11:2368942-2368964 CCCACCCAGAGCAAGAACGAAGG + Intergenic
1084654158 11:70505564-70505586 CCCGCCCAGAGCAGGAAAGCTGG - Intronic
1091382354 12:70085-70107 GGAGGCCAGAGGAAGAATGAGGG - Intronic
1104269690 12:127272040-127272062 TCAGCCCAGAGCAGGATTGAGGG - Intergenic
1107677315 13:42810825-42810847 GCCACCCAGAGAATGAATGGTGG - Intergenic
1110920619 13:81079701-81079723 GGCTCCCAGAGCCAGAGTGATGG - Intergenic
1111342730 13:86909452-86909474 ACTGCCCAGAGGAAGAACGAAGG - Intergenic
1111993456 13:95139301-95139323 GCCGCCCAAAGGAGGGATGAAGG + Intronic
1120761969 14:88293090-88293112 GCCTCACAGGGCAAGAGTGAAGG + Intronic
1122050406 14:99055529-99055551 GGCGGCCACAGCAAGAATGTTGG - Intergenic
1124016452 15:25880416-25880438 TCCACCCAGAGCATGACTGATGG + Intergenic
1135722596 16:24829923-24829945 GACCCCCAGAGAAGGAATGAGGG + Intergenic
1137480594 16:48849024-48849046 ACCTCCCAGAGACAGAATGAGGG + Intergenic
1141338013 16:83175682-83175704 GGCTGCCAGAGTAAGAATGACGG - Intronic
1145915832 17:28573587-28573609 GCAGCCCAGGGCAAGTATGAAGG - Exonic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
1148960649 17:51389955-51389977 GCTGCCATGATCAAGAATGATGG - Intergenic
1149089314 17:52759499-52759521 ACCTCCCAGACCAAGAATTATGG + Intergenic
1151752776 17:76050387-76050409 CCCGCCCAGAGCAAGAACCAGGG + Intronic
1153096532 18:1412500-1412522 GCAGCCCAGTTCAAGAAGGAGGG - Intergenic
1158194255 18:54866757-54866779 GGCTCCCAGTGCCAGAATGATGG - Intronic
1159203648 18:65222221-65222243 GTTACCAAGAGCAAGAATGAGGG - Intergenic
1162359005 19:10206359-10206381 GCAGCCCAGAGCACGAAGGCTGG + Intronic
1162630681 19:11924962-11924984 GCCCCGCAGAGCCAGACTGACGG - Intergenic
1163223372 19:15937441-15937463 GCAGCCTAGAGCAGGAATGGTGG + Intergenic
1167179030 19:47887876-47887898 CGTGCCCAGACCAAGAATGAAGG - Intergenic
1168155468 19:54471656-54471678 CCCGCCCGGAGGAAGAAGGAAGG - Exonic
925306395 2:2850345-2850367 GCCTTCCAGAGCAAGAGTGCAGG - Intergenic
925654512 2:6131453-6131475 GCCCCGCAGAGCAGCAATGAAGG - Intergenic
925844607 2:8024206-8024228 GTCTCCCAGAGACAGAATGAAGG + Intergenic
926913218 2:17870574-17870596 TGCACCCAGAGCAAGAGTGATGG + Intergenic
927109645 2:19855270-19855292 GCAGCCCACAACATGAATGATGG + Intergenic
932354792 2:71059893-71059915 GGGGCCCAGAGCAAGGCTGAGGG - Intergenic
937463300 2:122108188-122108210 CAAGCCCAGAGCAAGAAGGAAGG - Intergenic
946689127 2:222297801-222297823 AACACCCAGAGCAAGAATGGGGG - Intronic
947065454 2:226219269-226219291 CCCACCCAGAGCAAGAATGGTGG + Intergenic
947367703 2:229414070-229414092 TCCACCCAGAGGAAGAGTGAGGG - Intronic
1169068520 20:2707798-2707820 GCAGCCCAGAGCAAGGCAGAGGG + Intronic
1174105936 20:48162065-48162087 GCCGCCCCCAGCATGAGTGATGG - Intergenic
1174539252 20:51276164-51276186 GCCCCTCAGAGCACGAATGATGG + Intergenic
1179919631 21:44500389-44500411 GCCGCCCAGAGCAAGAATGAGGG - Intronic
1180611168 22:17099061-17099083 GCCGCCGTGAGCAATAGTGAGGG + Intronic
1183056010 22:35306260-35306282 GCTGGCCAGAGGCAGAATGATGG + Intronic
1183162325 22:36123279-36123301 ACTGCCCAGAGCCAGAAGGATGG + Intergenic
1184882905 22:47322758-47322780 ACCTCCCATAGCAAGAGTGATGG - Intergenic
949880995 3:8660542-8660564 CCCTGCCAGAGCAAGATTGAAGG + Intronic
950215160 3:11153985-11154007 GGCGCCCCTAGCAGGAATGAGGG + Intronic
955492626 3:59498456-59498478 GACTCCCAGAGCAGGAGTGAGGG - Intergenic
960383595 3:116993396-116993418 GCCTCCAAGAGCAAGATAGATGG + Intronic
960875287 3:122289598-122289620 GCCGGGCAGAGCCAGCATGAAGG + Intergenic
962369342 3:134807901-134807923 GCTGCCCAGATCAAGCATGGAGG + Intronic
962751850 3:138439455-138439477 GGAGCCCAGAGCACGAAGGATGG - Intronic
965606072 3:170498805-170498827 CACCCCCAGAGCAACAATGATGG + Exonic
971043538 4:22780324-22780346 GCTGACCAGAGCCAAAATGAAGG - Intergenic
971896004 4:32594985-32595007 ACCACTCAGAGCATGAATGAGGG + Intergenic
981620925 4:146697780-146697802 GTCTCCCAGGGCAAAAATGAAGG - Intergenic
993134615 5:83943416-83943438 GCTGCACAGAGGAGGAATGAGGG - Exonic
1001017125 5:168151801-168151823 GCCCCCAAGGGCAAGAAAGAGGG - Intronic
1001580161 5:172792785-172792807 ACAGCCCAGGGCAGGAATGAAGG - Intergenic
1006901372 6:37504096-37504118 GCTTTTCAGAGCAAGAATGAGGG + Intergenic
1007306171 6:40907062-40907084 GGCACCCAGAGCCAGAAAGATGG - Intergenic
1016522912 6:144966676-144966698 GCAGCTGAGAGCAAGAATCAGGG - Intergenic
1016915116 6:149237621-149237643 GCCGCCTAGAGGACGGATGAGGG - Intronic
1020360704 7:7323847-7323869 GCCCCACAGAGCAAGGCTGAGGG - Intergenic
1021846625 7:24769379-24769401 GCCTCCCGCTGCAAGAATGAGGG - Intergenic
1022827393 7:34029702-34029724 GCCTCCCAGAGCAGGACTAAGGG + Intronic
1024240020 7:47427594-47427616 GCTGCCCAGGGCCAGAAGGATGG + Intronic
1028311111 7:89336954-89336976 TCTGGCTAGAGCAAGAATGATGG - Exonic
1030838562 7:114319257-114319279 GGCTCCCAGAGCCAGAGTGATGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1048015282 8:130491429-130491451 GGCTCCTAGAGCAGGAATGATGG + Intergenic
1057204345 9:93162389-93162411 CCAGCCCAGAGAAAGAATCATGG - Intergenic
1060103980 9:120862258-120862280 GCCCCCCAGTGCCAGGATGAGGG + Intronic
1061900822 9:133671119-133671141 CCTGTCCAGAGCAAGGATGAAGG - Intronic
1061991245 9:134159807-134159829 TCCCCCCAGAACAAGACTGAAGG - Exonic
1185674300 X:1836425-1836447 GCCTTCCAGAGCAAGGTTGAAGG - Intergenic
1185678372 X:1867217-1867239 CCCTCCCAGAGCAAGGTTGAAGG + Intergenic
1190214275 X:48469468-48469490 CCCGCCCAGGGCCAGAAGGAGGG - Exonic
1192208151 X:69109676-69109698 GCCTCCCAGAGCAGGACTGAGGG - Intergenic
1193415320 X:81215507-81215529 TCCTCCCTGAGCCAGAATGAAGG + Intronic
1196381774 X:115098712-115098734 GCAGCCTAGAGCTACAATGATGG - Intergenic
1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG + Exonic