ID: 1179923160

View in Genome Browser
Species Human (GRCh38)
Location 21:44518420-44518442
Sequence GGGCTTTAGGATCACGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179923160 Original CRISPR GGGCTTTAGGATCACGGTGT TGG Intronic
904130770 1:28273722-28273744 GGGCTTCAGGATTGCTGTGTAGG + Intronic
907089302 1:51709586-51709608 GGGCTTCAGCATCTCGGTGCAGG + Intronic
910212147 1:84804402-84804424 GGGCTTTAGGATATAGGTGGAGG - Intergenic
914347358 1:146811328-146811350 GGGTTTCAGGACCATGGTGTTGG - Intergenic
917426215 1:174917195-174917217 GGGCTTCAGTATCTCAGTGTGGG + Intronic
920849012 1:209615988-209616010 GGACATTAGGATAAGGGTGTTGG - Intronic
924157943 1:241200662-241200684 GAGCTTTAGGAAGACGGTTTTGG - Intronic
1064367903 10:14724815-14724837 GTGCTTTAGGACCTAGGTGTTGG - Intronic
1071231999 10:83598924-83598946 GGGGTTTAGAATCAGAGTGTGGG - Intergenic
1074211730 10:111341361-111341383 GGGCTTTATGAACAGGGAGTAGG + Intergenic
1076905326 10:133358176-133358198 GGGCTTTAGGGTCCCGGGCTTGG + Intergenic
1083936699 11:65873131-65873153 GGGCTCCAGGATTACGGTGTGGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1098287842 12:68926465-68926487 GGGTTTTAGGACCATGGTTTGGG - Intronic
1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG + Exonic
1123574328 15:21651748-21651770 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1123610943 15:22094335-22094357 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1125469348 15:39987227-39987249 ATGCATCAGGATCACGGTGTGGG + Intronic
1132370734 15:101295860-101295882 GGTGTTTTGGATCCCGGTGTCGG - Intergenic
1202983192 15_KI270727v1_random:386091-386113 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1132939663 16:2500508-2500530 GGGCTCTGGGATGAGGGTGTGGG + Intronic
1134602244 16:15542538-15542560 GGGCTTTAGGAGCTCTGTGCTGG + Intronic
1136171110 16:28490129-28490151 GGGCTTTGGGATCACAGACTTGG - Intronic
1139986629 16:70903917-70903939 GGGTTTCAGGACCATGGTGTTGG + Exonic
1140956764 16:79873684-79873706 ACGCTTTAGGCTCACGGGGTCGG - Intergenic
1141540778 16:84719378-84719400 GGAGTTTAGAATCACTGTGTAGG - Intronic
1142283614 16:89161750-89161772 GGGCCTTAGGAGCACAGGGTGGG + Intergenic
1151556840 17:74850951-74850973 GGGCTTTAGGAAGATGCTGTGGG - Intronic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1153028332 18:690838-690860 TGGCTTTAGGATTACACTGTAGG - Intronic
1160525482 18:79533110-79533132 GGGCATTAGGTGCACGGTCTGGG + Intergenic
1162751979 19:12834587-12834609 GGACTTGAGGATCGCGGTGGGGG - Intronic
1166226550 19:41399270-41399292 GGGCTGCAGGAGCAAGGTGTGGG + Intronic
1166373266 19:42313891-42313913 GGTCTTTGGGAGCACGGGGTGGG + Intronic
928205063 2:29278141-29278163 GGGCTTGAGGATGTGGGTGTGGG + Intronic
928693936 2:33829681-33829703 GTGCTTTAGGATCAGGGAGGAGG + Intergenic
933361825 2:81296568-81296590 GTGATTTAGGATCAGGGTTTTGG - Intergenic
935377627 2:102416149-102416171 GAGCTTGAGGATCACATTGTGGG - Intergenic
941609040 2:167637316-167637338 GGGCATTAGTATAACGGTGCTGG - Intergenic
948656445 2:239479527-239479549 GGGCTGTAGGAACACTGAGTAGG + Intergenic
1178724413 21:35038228-35038250 GGGCTTTAGAATCGAGGTATTGG - Intronic
1178960982 21:37064698-37064720 GCACTTTAGGATCAAGCTGTTGG - Exonic
1179912347 21:44456835-44456857 GAGCTTCAGGAGCACGGTGTTGG - Exonic
1179923160 21:44518420-44518442 GGGCTTTAGGATCACGGTGTTGG + Intronic
952987025 3:38794653-38794675 GGGATTTAGGATAAGGGTGAGGG - Intergenic
957124266 3:76137639-76137661 GGGTTTTAAGATCAAAGTGTTGG + Intronic
959089663 3:101888582-101888604 GGGCTTTAGGATGAAAGGGTGGG - Intergenic
962896145 3:139716709-139716731 GGGCTTTAGGCTCAGGGTTGAGG - Intergenic
969098787 4:4753489-4753511 GGTCTCTAGGATCAGGGAGTAGG + Intergenic
980128079 4:128792173-128792195 AGGCTTGAGGATCACAGGGTTGG + Intergenic
991490567 5:67179017-67179039 TGGCTTTAGGAGCAGGGTCTTGG + Intergenic
1000400997 5:160827072-160827094 GGGGTGTAGGAACAGGGTGTAGG - Intronic
1004599169 6:17130994-17131016 GGGCTTAAGGATGATTGTGTGGG + Exonic
1013118579 6:107121815-107121837 GGGCTTTAGAATTATGGTTTTGG + Intergenic
1020815125 7:12895896-12895918 GGGTGTTTGGATCACGGAGTGGG + Intergenic
1024564123 7:50667514-50667536 TGGATCTAGGATCACGGTGGGGG - Intronic
1030683139 7:112453367-112453389 GGTACTTAGGATCACAGTGTGGG + Intronic
1035938991 8:3875104-3875126 GGGCTTCAGGAACACATTGTGGG + Intronic
1036239346 8:7069143-7069165 GGGCATTTGGATCCCGGTTTTGG - Intergenic
1039363239 8:36902830-36902852 GGGCTTTTGGAACTTGGTGTTGG + Intronic
1040625743 8:49147973-49147995 GGGCTTCAGGATCACTGGGTTGG + Intergenic
1041959008 8:63590359-63590381 TGGCTTTAGTATCAAGGTATTGG + Intergenic
1061029831 9:128074386-128074408 TGGTTTTAGGATCAGGGTATGGG - Intronic
1190051979 X:47157253-47157275 GGGCCTCTGGACCACGGTGTAGG + Intronic