ID: 1179924360

View in Genome Browser
Species Human (GRCh38)
Location 21:44525886-44525908
Sequence GCCTTCAGAAACCAGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179924360_1179924366 28 Left 1179924360 21:44525886-44525908 CCAGCGGCCTGGTTTCTGAAGGC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1179924366 21:44525937-44525959 CCACGGCTGCTACGTGGTGCAGG 0: 1
1: 0
2: 1
3: 2
4: 81
1179924360_1179924364 22 Left 1179924360 21:44525886-44525908 CCAGCGGCCTGGTTTCTGAAGGC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1179924364 21:44525931-44525953 CCAGATCCACGGCTGCTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1179924360_1179924362 11 Left 1179924360 21:44525886-44525908 CCAGCGGCCTGGTTTCTGAAGGC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1179924362 21:44525920-44525942 AGCATCTCTCTCCAGATCCACGG 0: 1
1: 0
2: 1
3: 26
4: 212
1179924360_1179924367 29 Left 1179924360 21:44525886-44525908 CCAGCGGCCTGGTTTCTGAAGGC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1179924367 21:44525938-44525960 CACGGCTGCTACGTGGTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179924360 Original CRISPR GCCTTCAGAAACCAGGCCGC TGG (reversed) Intronic