ID: 1179926319

View in Genome Browser
Species Human (GRCh38)
Location 21:44536217-44536239
Sequence CAGGAGCAGCAGCCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 689}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179926319_1179926329 30 Left 1179926319 21:44536217-44536239 CCATCCTCAGGCTGCTGCTCCTG 0: 1
1: 1
2: 7
3: 71
4: 689
Right 1179926329 21:44536270-44536292 ACCTCAGCAACACTGACTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 227
1179926319_1179926321 -8 Left 1179926319 21:44536217-44536239 CCATCCTCAGGCTGCTGCTCCTG 0: 1
1: 1
2: 7
3: 71
4: 689
Right 1179926321 21:44536232-44536254 TGCTCCTGCCAGTGCTCCCTCGG 0: 1
1: 0
2: 0
3: 30
4: 313
1179926319_1179926324 2 Left 1179926319 21:44536217-44536239 CCATCCTCAGGCTGCTGCTCCTG 0: 1
1: 1
2: 7
3: 71
4: 689
Right 1179926324 21:44536242-44536264 AGTGCTCCCTCGGCGTCCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179926319 Original CRISPR CAGGAGCAGCAGCCTGAGGA TGG (reversed) Intronic
900173909 1:1283763-1283785 AAGGGGCTGCAGCCTGTGGAGGG - Intronic
901067665 1:6502111-6502133 TAGCCGCAGCAGCCTGGGGAAGG + Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901407193 1:9057172-9057194 CAGGATCAGGAGGCTGAGGCAGG + Intronic
901807670 1:11748521-11748543 CTTGAGCAGCAAGCTGAGGATGG - Exonic
901828471 1:11878162-11878184 CCTGAGCAGCAGCCTGAGCTGGG + Intergenic
902219708 1:14957278-14957300 CAGGAGCACTAGCCTGAGAGTGG + Intronic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902515257 1:16986505-16986527 CAGCAGCAGCAGCTTGAAGCCGG + Exonic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
902546606 1:17194289-17194311 CAGGATCAGCAGGCTTGGGAAGG + Intergenic
902551691 1:17223319-17223341 CAGGAGCAGCTGGCAGATGAGGG - Intronic
903237299 1:21958316-21958338 CAGGCTCAGCAGCCAGAGGGTGG - Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903708451 1:25304024-25304046 GAGGAGCAGCACCCAGAAGAGGG + Intronic
903718663 1:25388389-25388411 GAGGAGCAGCACCCAGAAGAGGG - Intronic
903744227 1:25575930-25575952 CAAAAGCAGCAGCATGAGGCTGG + Intergenic
904034255 1:27550603-27550625 CTTGAGCAGCAGCCTGAGCGTGG - Exonic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
904384077 1:30130282-30130304 CAGCAGGAGCTGGCTGAGGAGGG + Intergenic
904656602 1:32053241-32053263 CTGGAGGAGCTGCCTGAGAAAGG + Intronic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904971429 1:34422083-34422105 TAGGAGCAGCAACCTTAGGCTGG - Intergenic
904982555 1:34518858-34518880 CAAGAGCCCCAGCCTTAGGACGG - Intergenic
905414256 1:37793905-37793927 CAGGAGCAGGGGCCTGAGTCAGG - Exonic
905915948 1:41684357-41684379 CAGCAGCTGCAGCCTTGGGAAGG - Intronic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906112990 1:43337082-43337104 CAGGAGCAACAGCATTAGGTGGG - Intergenic
906114801 1:43349311-43349333 CAGCAGCAGCAGGCCCAGGACGG - Exonic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906400121 1:45498437-45498459 CAGGAGCTGCAGACTGAGTAAGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906963499 1:50434111-50434133 GAAGAGCAGCAAACTGAGGAAGG + Intergenic
907865752 1:58397659-58397681 CAGAAGGAGCAGGCTGGGGAAGG - Intronic
908236529 1:62152362-62152384 AAGGAGCAGCAGTCTGAGTGCGG + Intronic
908261893 1:62345461-62345483 CAGGAGCTGAAGCATGAGAATGG + Intergenic
908273967 1:62449813-62449835 GAGGAGGAGGAGCCTGAGGTGGG + Intronic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
908990055 1:70076131-70076153 CGGGAGCAGCAGCCGTATGAAGG + Exonic
909406032 1:75290541-75290563 CAGGAGCAGGAGCCTTAGAGAGG + Intronic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
910168595 1:84354070-84354092 CAGGAACAGAAGCCACAGGAAGG + Intronic
910867737 1:91803451-91803473 CAGAAGCAGCATGCTGAGGAGGG + Intronic
911601267 1:99850274-99850296 CAGAAGCCGCAGCCCAAGGAGGG - Intronic
912262217 1:108121628-108121650 CTGGAGCAGGAGCCTCAGGAAGG + Intergenic
912795621 1:112691721-112691743 GGGGAGCAGCTGCCTGAGGCGGG - Exonic
914446925 1:147758307-147758329 CAGGAGCAGACTCCTGGGGAAGG - Exonic
914874191 1:151500529-151500551 GATGAGCAGGAACCTGAGGATGG - Intergenic
914923222 1:151861265-151861287 CAGGAGCCACAGCCATAGGAAGG - Intergenic
915135552 1:153728711-153728733 CGGGAGCAGGAGCCCCAGGAGGG + Exonic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915535547 1:156533388-156533410 CAGGAGCTGCAGGCTCAGGGAGG - Intronic
916738795 1:167630486-167630508 CAGGGGCAGCCGCCCGGGGAAGG - Intronic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
918203438 1:182288498-182288520 AAGGAGCACCAGCCTTAGGATGG + Intergenic
919787774 1:201270811-201270833 AAGGAACAGCAGCCTGCGGCAGG - Intergenic
920849218 1:209617441-209617463 CAGGCCCAGCAGCTTGCGGAAGG - Exonic
921392474 1:214630496-214630518 CAGGTGCATCAGCCTGATGATGG - Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923436234 1:233970333-233970355 CAAGACCCACAGCCTGAGGATGG + Intronic
923603915 1:235426188-235426210 CAGGTGCAGCACCATCAGGAAGG - Intronic
924504944 1:244673233-244673255 CAGGAGCAGAAGCATTTGGAGGG + Intronic
924567499 1:245210789-245210811 CAGGACTAGCTGGCTGAGGACGG - Intronic
1062985540 10:1765270-1765292 CAGGAGCATGAGACTGAGAATGG - Intergenic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063115011 10:3067161-3067183 CAGGGGCAGCGTCCGGAGGAGGG - Intronic
1063174350 10:3538190-3538212 CAGCAGCAGCAGCCTCTGCACGG + Intergenic
1063214182 10:3909319-3909341 CAGAAACAGCACCCTGAGAAAGG + Intergenic
1063959903 10:11298359-11298381 CAGGTGGTGCAGCCTGAGGGAGG + Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067525098 10:47033762-47033784 CACTGGCAGCAGCCTGTGGAGGG + Intergenic
1067528794 10:47055548-47055570 CAGAAGCAGCAGCCTGGCCAAGG + Intergenic
1067746451 10:48940053-48940075 CAAGAGCAGCAGGCTGTGGCAGG + Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1069041838 10:63703974-63703996 CAGGAGCTGAAGCCAGAGAAGGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069916735 10:71791186-71791208 CAGCAGCAGCAGCTCCAGGATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070787393 10:79169890-79169912 CAGGAGCATCTGCTTGAGGTGGG + Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072107881 10:92291271-92291293 GAGGAGGAGGAGCCTGAGGCGGG - Exonic
1072940640 10:99760555-99760577 AGGGAGCAGCATCCTGAGGCAGG + Intergenic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1073708304 10:106011553-106011575 ACGCAGCAGCTGCCTGAGGATGG + Intergenic
1073753752 10:106559048-106559070 CAGGGGCAGGAGTCAGAGGAAGG - Intergenic
1074112304 10:110431185-110431207 AGGGAGCCGCACCCTGAGGAAGG + Intergenic
1074146585 10:110721978-110722000 AAGGAGCAGGTGCCTAAGGAGGG - Intronic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075463921 10:122637283-122637305 AAGGTGCCGCAGCCTGAGTAGGG - Exonic
1075697653 10:124448237-124448259 CAGGAGCAGCACCCAGAGTTGGG - Intronic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075736322 10:124666674-124666696 CAGGAACAGCAGGCTAAGCAGGG + Intronic
1076143231 10:128096264-128096286 CAGGGGCAGTAGCCTGCGGTAGG - Intergenic
1076399769 10:130174328-130174350 AAGAAGCAGCAGCCTGGGGTGGG + Intronic
1076605555 10:131687088-131687110 CAGCAGCAGGGGCCTGGGGAGGG - Intergenic
1076684356 10:132190412-132190434 GAGGAGCCCCAGCCTGAGGTGGG - Intronic
1076824744 10:132961184-132961206 CAGGGCCTGCAGCCTGAGGCTGG - Intergenic
1076841637 10:133048855-133048877 CAGGAGCATCCGGCTGAGGGAGG - Intergenic
1076869459 10:133186239-133186261 CAGGAGAAGCCGCCTGCGGAAGG + Exonic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1076911066 10:133389816-133389838 CAGGAGCACCAGCCAGTGGCGGG + Intronic
1076995750 11:296787-296809 CAGGAGCCTGAGCCTGAGGCAGG + Intergenic
1077034781 11:489367-489389 CAGAGCCGGCAGCCTGAGGAAGG - Intronic
1077474239 11:2778890-2778912 CAGGAGCAGGAGCCTGGGCCGGG - Intronic
1077554056 11:3217606-3217628 CAGGTGCAGCAGGGTGGGGAGGG + Intergenic
1078827839 11:14948175-14948197 CAGAAAAAGCTGCCTGAGGAGGG - Intronic
1079092487 11:17490904-17490926 CAGGAGCAGCCCCCTGGGGAAGG - Intergenic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1079550034 11:21683962-21683984 CAGGAGCCCCAGGCTGAGAAAGG - Intergenic
1079837362 11:25350969-25350991 CAGGCTCAGCAGACTCAGGAGGG - Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1081618395 11:44603941-44603963 CAGGTGCAAAGGCCTGAGGAAGG - Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081819916 11:45982729-45982751 CAGCATCAGCAGCCAGAGAAAGG + Intronic
1081858034 11:46316276-46316298 CTGGAGCAGGGTCCTGAGGAGGG - Exonic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083268152 11:61556569-61556591 CAGGAGCAGTGGCCTGTGGAGGG - Intronic
1083605211 11:63974685-63974707 CAGCAGCAGCGGCGTCAGGACGG - Exonic
1083663262 11:64261870-64261892 CAGGAGCACCTGGCTGAGGCCGG + Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084317581 11:68354380-68354402 CAGGAGCAGGAGCCTCCGCATGG - Intronic
1084445562 11:69201734-69201756 CAGAGCCAGCAGGCTGAGGAAGG - Intergenic
1084489955 11:69472819-69472841 AAGGAGCAGCAGGCTGTGAAAGG + Intergenic
1084774950 11:71369011-71369033 CTGGAGCAGCAGCCTGCCGGCGG - Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1088036420 11:105322131-105322153 CAGGAACAGATGCCAGAGGAAGG - Intergenic
1088836304 11:113580506-113580528 GAGGGACAGCAGTCTGAGGAAGG - Intergenic
1089048108 11:115521322-115521344 CTGGAGGAGGAGCCTGAAGATGG - Intergenic
1089278320 11:117354929-117354951 TAGGAAACGCAGCCTGAGGAGGG + Intronic
1089341776 11:117763096-117763118 TAGGGCCAGCAGCCCGAGGAGGG + Intronic
1089619474 11:119714137-119714159 CAGGAGCGGCAGCCTCTGGGTGG + Intronic
1089623907 11:119739430-119739452 CAGGACCAGCTGTCTGAGGCTGG - Intergenic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1090249955 11:125244310-125244332 CTGGAGCTGCGTCCTGAGGATGG + Intronic
1090315049 11:125778788-125778810 CAGGTGCAGCTTCCTGTGGAAGG + Exonic
1090409137 11:126495589-126495611 CAGCAGCAGATGCCTCAGGAAGG + Intronic
1091234993 11:134015661-134015683 CTGGAGCAGGAGCCTGAGGTGGG + Intergenic
1091344957 11:134846209-134846231 GAGGTGCAGCAGGCTGGGGAGGG + Intergenic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1091601121 12:1918297-1918319 TAGAAGCAGCAGCCACAGGAGGG + Exonic
1091886096 12:4018185-4018207 CAGGGGCAGAAGTCTGAAGAGGG - Intergenic
1093573360 12:20695313-20695335 AAGGAACAGAAGCCAGAGGAGGG - Intergenic
1094272244 12:28629867-28629889 CTCCAGCAGAAGCCTGAGGAGGG + Intergenic
1095826609 12:46536493-46536515 CAGGAGCAGGACCATGAGCATGG + Intergenic
1096193245 12:49633413-49633435 CAGGAGCAGCTGCAAGTGGATGG - Exonic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096589743 12:52649797-52649819 CAAAAGCAGCAGCCAGAGAAAGG - Intronic
1096651079 12:53062248-53062270 GAGAAGCAGGAGCCTGGGGAAGG + Intronic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097233607 12:57526129-57526151 CAGGAGCAGGGGCCCGAGGACGG - Exonic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100559033 12:95728922-95728944 CAGGAGCAGCAGCAAGGGTAGGG - Intronic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1101997586 12:109535955-109535977 CAGGTGCAGGAGCATGAGGTGGG - Exonic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1103059496 12:117847410-117847432 CAAGAGAAGAAGCCAGAGGAGGG + Intronic
1103507605 12:121452516-121452538 GGGGAGCAGCGCCCTGAGGAAGG + Intronic
1103557848 12:121776564-121776586 CAGGGGCCGCACCCTGAGGCGGG + Exonic
1104421893 12:128642840-128642862 CAGAAGCAGCAGGCTGTGGTTGG + Intronic
1104591400 12:130086997-130087019 CAGAAGCAGCTTCCTGAGGATGG - Intergenic
1104786076 12:131448624-131448646 CAGGTGCAGGAGCCTCAGGCGGG + Intergenic
1104998892 12:132675896-132675918 CAGAAGCAGCAGCCTCATGTTGG + Intronic
1105282145 13:18971994-18972016 CAGCAGCTGCAGCTTGAGGGAGG + Intergenic
1105633918 13:22199148-22199170 CAGGCACTGCAGCCTGAGAAAGG - Intergenic
1106176673 13:27337862-27337884 CAGGAGAAACAGCCTGTGGCTGG + Intergenic
1107022799 13:35768330-35768352 CTGCAGCAGCAGCCTGTGGATGG + Intergenic
1107722839 13:43267135-43267157 CTGGAGCTGCAGCTCGAGGAAGG - Intronic
1107739857 13:43438264-43438286 CAGGAAGACAAGCCTGAGGAGGG + Intronic
1108071866 13:46636596-46636618 TAGGAGCAAAAGCCTGATGAAGG - Intronic
1108095232 13:46894173-46894195 CTGGAGGAGCAGCCTAGGGAGGG + Intronic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110706215 13:78603449-78603471 CAGCAGCAGCAGCCCGCGGCGGG - Exonic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1113001173 13:105639104-105639126 CAGGAGCAGGAGCAAGAGTAGGG - Intergenic
1113381611 13:109810807-109810829 CAGGACCCGCAGCCGGAGCAAGG - Intergenic
1113400911 13:109992568-109992590 CATCTGGAGCAGCCTGAGGAGGG - Intergenic
1113661366 13:112108272-112108294 CAGGAGCTGGGGCCAGAGGATGG - Intergenic
1113885741 13:113657540-113657562 CAGGTGCTGCAGGCTGAGGCAGG + Intronic
1113914538 13:113862919-113862941 CAGGAGCCGCCGTGTGAGGACGG - Intronic
1114184649 14:20391249-20391271 CAGGAGGAGCTGACTGTGGAGGG + Intronic
1114527789 14:23377273-23377295 CGGGACCGGCACCCTGAGGAGGG + Exonic
1114824813 14:26064160-26064182 CAGGAGCAGAAGTCTGAAGATGG + Intergenic
1115576233 14:34714649-34714671 CGGGAGCTGCAGCCCGAGGGAGG + Exonic
1116658172 14:47675799-47675821 CGGGAGCGGCCGCCTGCGGAGGG + Intergenic
1117406810 14:55411884-55411906 CAGGAGGAGGGGCCTGGGGAAGG + Intergenic
1117562709 14:56958610-56958632 CAGGAGGACCAGCCTTAGGAAGG + Intergenic
1118163163 14:63311058-63311080 CAGGAGCTGCAGCCTTTGGTAGG - Intergenic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119180335 14:72600904-72600926 CAGCTGCAGCAGCCAGGGGAGGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1120949082 14:90024313-90024335 CAGGTGCAGCAGGCAGAGGTGGG - Intronic
1121269206 14:92626712-92626734 TAGCAGCAGCTGCCTGTGGAGGG + Intronic
1121368705 14:93337612-93337634 CAGGAGCTGCAGCCTGGAGTGGG + Intronic
1121739349 14:96240513-96240535 CACGAACAGCACCCAGAGGAAGG - Exonic
1122234879 14:100325856-100325878 CAGGTGCAGGGGCCTTAGGATGG - Intronic
1122277758 14:100603955-100603977 CAGGGGCAGCAGCCTGTGGGAGG - Intergenic
1122509830 14:102257359-102257381 CAGGGCCAGCAGCCTGATCATGG + Intronic
1122616255 14:103020043-103020065 CAAGAGCTGAAGCCTGAGGCAGG + Intronic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1122843719 14:104479257-104479279 CAAGAGCACCAGCCTGAGCATGG + Intronic
1122910534 14:104825840-104825862 CAGGAGCAGAAGCCTGATGTGGG + Intergenic
1123135979 14:106027561-106027583 CCAGGGCAGCAGCCTGGGGATGG + Intergenic
1123194675 14:106605084-106605106 GAGGAGCAGCCCCCTGAGGCTGG - Intergenic
1124700826 15:31910269-31910291 CAGGAGCAGCATCCAGAGGAGGG + Intergenic
1125396376 15:39252573-39252595 CAGCAGCATGAGCCTGAGCACGG - Exonic
1125722475 15:41851881-41851903 CAGGACCAGCACCCTCAGGAAGG + Intronic
1126049452 15:44673182-44673204 CAGGAGGTGCTGGCTGAGGAGGG - Intronic
1126362560 15:47861323-47861345 CAGGGGCTGCAGCCTGTGAATGG - Intergenic
1126479205 15:49099326-49099348 CAAGTGCAACAGCCTGAGGAGGG + Intergenic
1127612193 15:60647836-60647858 CAGCTGCAGCAGGCTGAGGGTGG - Intronic
1128131451 15:65229778-65229800 CTGGAGCATCATTCTGAGGATGG + Intergenic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128745788 15:70113403-70113425 CAGGAGCTGGGGCCTCAGGAGGG - Intergenic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1128944819 15:71812995-71813017 CAGGAGGAGAGGCATGAGGAGGG + Intronic
1129182674 15:73886973-73886995 CAGGAGCAGCACTCTGGGGAAGG - Intronic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1131163679 15:90126961-90126983 AGAGAGCAGCAGCCTTAGGAAGG + Intergenic
1131231163 15:90660651-90660673 GAGAAGCAGCACCCTGGGGAGGG + Intergenic
1131261525 15:90890398-90890420 CAGGAGCAGGAGCGAGAGGGGGG + Exonic
1132026091 15:98405531-98405553 CAGCAACAGCAGCCTGGGGCAGG - Intergenic
1132311235 15:100859452-100859474 CAGGAGGAGAAGCCCCAGGAGGG - Intergenic
1132574921 16:659834-659856 CCGGTGCAGGGGCCTGAGGACGG + Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133345306 16:5065882-5065904 CAGGAGCAGCAGCCCCAGGCTGG + Exonic
1135065723 16:19308024-19308046 CAGGAGCATGAGTCTGTGGAAGG - Intronic
1135326248 16:21527514-21527536 TGGAAGCAGCAGCCAGAGGAAGG - Intergenic
1135994213 16:27236096-27236118 CAGGTCCATCAGTCTGAGGAGGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136383470 16:29908160-29908182 CAGAAAGAGCAGCCTGGGGAGGG + Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137251883 16:46747185-46747207 CAGGAGCCGGAGCCTGGGGGTGG - Intronic
1137395556 16:48114314-48114336 CAGGAGGACCAGCCTAAAGAGGG - Intronic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1138343226 16:56304334-56304356 CAAGAGCACCAGCTTGAAGAGGG - Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139350767 16:66333912-66333934 CAGAAGCAGCTTCCTGATGAGGG - Intergenic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140473872 16:75229015-75229037 GAAGAGCAGCTGCCTGAGGGTGG - Intronic
1140552937 16:75887167-75887189 AAGGAGCAACAGCCTAAGGAAGG + Intergenic
1140722888 16:77787335-77787357 CAGGTGCAGAACCCTGTGGAAGG + Intergenic
1141523672 16:84598061-84598083 CAGGAGCCCCATCCTGAGGACGG + Intronic
1141722141 16:85762376-85762398 CAGAAGCAGCCGTCTGAAGATGG + Intergenic
1142039295 16:87882241-87882263 TGGAAGCAGCAGCCAGAGGAAGG - Exonic
1142256463 16:89015920-89015942 CAGGAGCAGGGGGCTGAGGAGGG + Intergenic
1142673304 17:1497517-1497539 GAGGGGCAGCAGCCTGAAGGAGG + Intronic
1143186676 17:5014247-5014269 CAGGATCATCAACCTAAGGATGG + Intronic
1143410415 17:6705080-6705102 CAGGGGTAGGAGCCTGAAGAAGG + Intronic
1143587257 17:7856448-7856470 CTGGAGCAGCAGCCGTGGGAGGG + Intergenic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1143720375 17:8805026-8805048 CACGAGCAGCAGCCTGAACTAGG + Intronic
1143900877 17:10173877-10173899 CAGCAGCAGCAGCCTGGAAAGGG + Intronic
1143953996 17:10654825-10654847 GAGGGCCAGCAGCCTGTGGAGGG + Intronic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1144764439 17:17725022-17725044 CAGGGTCAGCAGCCCCAGGAGGG - Intronic
1144892128 17:18500214-18500236 CAGGAGCTGCAGGCTCAGGGAGG + Intergenic
1145140088 17:20444074-20444096 CAGGAGCTGCAGGCTCAGGGAGG - Intergenic
1145751733 17:27360049-27360071 CAGGAGCTGCCACCTGAGGCTGG - Intergenic
1146005207 17:29156395-29156417 CAGGAGCAGGAGCCTGGGAAGGG - Intronic
1146180977 17:30697972-30697994 CAGGAGGGGCAGCCCGGGGAAGG - Intergenic
1146445331 17:32928220-32928242 CGGGAGCCACAGCCTGAGGTGGG + Exonic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1146753982 17:35409773-35409795 CAGAAACAGCAGCCTCAAGATGG - Intergenic
1146978180 17:37134163-37134185 CAGCAGCAGAGGCCTGAGCATGG - Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147475117 17:40703531-40703553 CAGCAGCTGCAGCCTGAGTGGGG - Exonic
1147758886 17:42784992-42785014 CACGCGCAGCTGCCTAAGGAGGG + Intronic
1148465969 17:47865515-47865537 CAGGAACAGGTGCCTGAGGGGGG - Intergenic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1148751737 17:49949227-49949249 GAGGAGCAGCAGTCTGTTGATGG - Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149347178 17:55750935-55750957 CTGGAGGAGCGGCCTGAGGGTGG - Intergenic
1149549875 17:57532276-57532298 GAGGGGCTGCAGCCTGTGGAGGG + Intronic
1149845370 17:60006436-60006458 CAGGAGCACCAGGCTGGGGGAGG - Intergenic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1151539917 17:74759574-74759596 CTGGAGCTGCAGCCTGAGCTGGG - Intronic
1151826081 17:76525178-76525200 CAGCAGCAGCTCCCTGAGAAGGG - Intergenic
1152320609 17:79607143-79607165 CAGGAGCAGGGGCCTGTGGCAGG + Intergenic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152408287 17:80109739-80109761 CAGGACCAGCTGGCTGATGAGGG - Intergenic
1152518892 17:80843850-80843872 CAGGGGCAGCAGACTGAAAATGG - Intronic
1152560735 17:81077668-81077690 CAGCACCACCAGCCTCAGGACGG - Intronic
1152722522 17:81929909-81929931 CAGAAGCTGCAGCCTGGGGCGGG - Intergenic
1152722558 17:81930027-81930049 CAGAAGCTGCAGCCTGGGGCGGG - Intergenic
1152920300 17:83063219-83063241 CCCAAGCAGCAGCTTGAGGAGGG + Intergenic
1152946277 17:83199169-83199191 CAGGAGCAGCTGGGAGAGGAGGG - Intergenic
1153101310 18:1473144-1473166 AAGTAGCAGCAGCCTGAGCCAGG - Intergenic
1153757890 18:8302063-8302085 CAGGACCATCAGCTTCAGGAGGG - Intronic
1155220174 18:23678056-23678078 CAGGACCAAAAGCCTGAGAATGG + Intergenic
1155778194 18:29794566-29794588 CATGGGCAGAAGCCTGGGGATGG + Intergenic
1156204677 18:34872797-34872819 AAGGTTCAGCAGCCTGAAGAGGG - Intronic
1156403093 18:36758597-36758619 CAGAACCAGCAGCCTGGGCAGGG + Intronic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157500334 18:48186065-48186087 AAGGTGCAGAAGCCTGAGGTCGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159882163 18:73868475-73868497 CTGAAGCAGCAGCCTGAAGTGGG - Intergenic
1160030827 18:75258064-75258086 GAGGAGCAGCAGCCGGCAGATGG - Intronic
1160234513 18:77075480-77075502 CAGGAGCAGCGGGCTGAAGGTGG + Intronic
1160586328 18:79915420-79915442 CAGGAGCAGCAGCGTCGGGTCGG - Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161341573 19:3745974-3745996 GAGGACCAGCAGCTTCAGGAGGG - Intronic
1161735660 19:5990779-5990801 GAGGGGCAGCAGCCAGAGGCAGG + Intergenic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1162349233 19:10138677-10138699 CAGGGTCAGCAGCCTGAGTCGGG + Intronic
1163420115 19:17209675-17209697 CAGGAGCGAAAGCCTGCGGAAGG - Exonic
1163607151 19:18281601-18281623 CAGGAGCCGCCGCCAGTGGAGGG - Exonic
1163641234 19:18463269-18463291 GAGGAGGAGCAACCTGAGGGGGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1165062220 19:33210503-33210525 CAGCAGCAGCAGGCCCAGGATGG + Exonic
1165363881 19:35352237-35352259 GCAGAGCAGCAGCGTGAGGAGGG - Exonic
1165453577 19:35898729-35898751 CAGCAGCAGCAGCCCGACGCTGG - Exonic
1165455497 19:35908190-35908212 CAGGAGCAGGAGCCTGCTGCAGG + Exonic
1165779470 19:38423895-38423917 CAGGAACAGCAGCCTCTGGGAGG - Intronic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166740335 19:45110886-45110908 CATGACCAGAAGCCTGAGGCAGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1168249939 19:55136231-55136253 CAGCAGCAGCTTCCTGTGGAGGG - Intronic
1168255056 19:55160663-55160685 GAGGAGCAGCAGCACGCGGAGGG - Exonic
1168264130 19:55212291-55212313 CTGGAGCAGCTGCCTGTGTATGG + Intergenic
925118458 2:1399291-1399313 CAGCATCAGCAGCCTGACGATGG + Intronic
925220264 2:2133792-2133814 CAGGAAAAGTAGCCTGGGGAAGG - Intronic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925732985 2:6935480-6935502 CAGGAAAAGAGGCCTGAGGATGG - Intronic
925900556 2:8506280-8506302 CAGGAGCAAGAGCGTGACGAGGG - Intergenic
926221061 2:10935656-10935678 CAGGGGCCGCCGCCTGAAGAGGG - Intergenic
927194934 2:20540516-20540538 CAGGAGCAGAAGCCCGTGGCAGG - Intergenic
927428837 2:23009373-23009395 CAGGTGCAGGACCCTGAAGAAGG - Intergenic
927553093 2:24015997-24016019 CGGGATCAGCATCCTGGGGAAGG + Intronic
927948596 2:27152469-27152491 CAGGAGGAGCCATCTGAGGAGGG - Intronic
928251631 2:29686198-29686220 GAGGTTCAGGAGCCTGAGGAGGG - Intronic
929313756 2:40453311-40453333 CAGGAGCAGCTACTTGGGGAAGG + Intronic
929538971 2:42805061-42805083 GAGGTGCTGCAGGCTGAGGATGG + Intergenic
929589616 2:43136370-43136392 GAGGGGCAGCAGCCTCAGTAGGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
930017264 2:46979537-46979559 CAGGAGCAAAAGCCTACGGAAGG - Intronic
930019055 2:46990099-46990121 CAACAGCAGCAGGCTGAAGAGGG - Intronic
930022088 2:47007703-47007725 CAGGTGCTGCAGCCTGAGTGCGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096483 2:47570395-47570417 CGGGAGCAGGAGCGTGAGGATGG + Exonic
930149651 2:48045465-48045487 CAGGAGCAAGAGGCTGAGAAGGG + Intergenic
930417190 2:51103649-51103671 CTGGAGCAGGAACCAGAGGAGGG - Intergenic
930886132 2:56328983-56329005 CAGGAGGAGCCCACTGAGGAAGG - Intronic
931638344 2:64360419-64360441 CAGCACCAACAGCCTGATGAGGG - Intergenic
932124154 2:69128129-69128151 CAGGAGAATCAGCCTGAACATGG + Intronic
932238238 2:70138290-70138312 CAGGAGCAGCAGCCTGACCAAGG + Intergenic
932424382 2:71619862-71619884 CTTGGGCTGCAGCCTGAGGAGGG - Intronic
932744460 2:74321322-74321344 CAGGAGAAAGAACCTGAGGAAGG + Intronic
932837283 2:75049541-75049563 CACGAGGAGGAGCCAGAGGACGG - Exonic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933699350 2:85243612-85243634 CAGGAGGAGAAGGCTGGGGATGG + Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934573944 2:95388997-95389019 GAGGACCAGCAGGCTGAGGAGGG + Intergenic
934751579 2:96797387-96797409 CAGGAGCAGCAGGCTCTGGCTGG - Intronic
935054767 2:99555994-99556016 CAGTAGCACCAGCTTGAGAAAGG - Intronic
935592407 2:104855188-104855210 CAGGAGCAGCGCTCTGGGGAGGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936517803 2:113193178-113193200 CAGTGGCACCAGCCTGAGGCTGG + Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936959815 2:118061321-118061343 TAGGGGCAGGAGCCTGAGGGTGG - Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938293816 2:130164313-130164335 AAGAAGCAGCAGGCTGAGCAGGG + Intronic
938306435 2:130259574-130259596 CAGAAGTAGCTCCCTGAGGATGG - Intergenic
938462728 2:131508649-131508671 AAGAAGCAGCAGGCTGAGCAGGG - Intergenic
938859273 2:135349993-135350015 CAGGAACACCAGCTTTAGGAAGG - Exonic
940640929 2:156343076-156343098 CCGTAGTAGCAGCGTGAGGAAGG + Intergenic
940831463 2:158470887-158470909 GGGGAGCAGCAACCCGAGGATGG + Intronic
941139993 2:161768286-161768308 CAGGCTCAGCAGCCAGAGTAGGG - Intronic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943547936 2:189304539-189304561 CAGGAGCGGAAGCCAGAGGTGGG + Intergenic
945555439 2:211269892-211269914 CAGGACCAGCAAACTGAGGTGGG - Intergenic
946306626 2:218860057-218860079 CAGCAGCAGCAGCCCGAGGCGGG - Exonic
946869319 2:224071677-224071699 CAGCAGCCACAGCCTGAGAAGGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
948080056 2:235198491-235198513 CAGCAGCCCCAGCCTGAGGAGGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948332531 2:237181278-237181300 CATGAGCAGTAGCTTGAGAAAGG - Intergenic
948583646 2:239004791-239004813 CTGGTGCAGCAGCCTGGGAAGGG - Intergenic
948587462 2:239028238-239028260 CAGGAGAAGAATCCCGAGGATGG - Intergenic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948805635 2:240452606-240452628 CAGGAGCAGCACCCGCAGGCGGG + Intronic
949062309 2:241968565-241968587 CAGCAGCCTCAGCCTGTGGATGG + Intergenic
1168860874 20:1045236-1045258 CAAGGGCAGCAAGCTGAGGATGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169286803 20:4315122-4315144 CAGCAGCATCAGCCTCAGGTGGG - Intergenic
1169317093 20:4601813-4601835 CAGGACCAGCTGCCTGATCATGG - Intergenic
1169534733 20:6525739-6525761 CAGTAGCAGCAGCCATAGGCAGG + Intergenic
1170041948 20:12048450-12048472 CAGTTACAGCAGCCTGGGGAGGG + Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1170867684 20:20174634-20174656 CACGATCAGCTGCCTGAAGAGGG - Intronic
1171345263 20:24461238-24461260 CAGCAGCATCACCCTGAGCACGG - Intergenic
1171424695 20:25042256-25042278 CAGCAGCCGCAGCCTGGGGCTGG + Intronic
1172147611 20:32767790-32767812 CCAGAGCAGCAGGCTGAGGGAGG + Intronic
1172740341 20:37161559-37161581 CAGGAGGAGCAGCCTGACCCAGG - Intronic
1172837380 20:37881803-37881825 CAGGCCCTGCTGCCTGAGGACGG + Intergenic
1173037292 20:39424612-39424634 CAGCAGTAGCAGCCTGTGGGTGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173663570 20:44750555-44750577 CAGGACCACCAGGTTGAGGAAGG - Exonic
1174115085 20:48221279-48221301 CAGGAGAAGCAGCCTGTGCCAGG + Intergenic
1174137096 20:48387164-48387186 CAGGAGCAGCAGCCTAAAGCGGG - Intergenic
1174555775 20:51394416-51394438 CCAGAGGAGCAGCGTGAGGAAGG - Intronic
1174583327 20:51588722-51588744 TAAGGGCAGCAGCCTTAGGATGG + Intergenic
1175649124 20:60701953-60701975 CAAGAGCAGCAACAAGAGGATGG - Intergenic
1175741082 20:61420213-61420235 CAGGAGGAGCTGCCTGCAGAGGG - Intronic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176081018 20:63273036-63273058 CTGGGGCAGCAGCCTCAGGGTGG - Intronic
1176096687 20:63347543-63347565 CAGGAGCAGAGGCCTAGGGAGGG + Intronic
1176231051 20:64033128-64033150 CAGAAGCAGGAGCCAGAGAAGGG - Intronic
1177646797 21:23909287-23909309 CAGCAACTGAAGCCTGAGGATGG + Intergenic
1178362228 21:31958191-31958213 CAGGAGCCACCTCCTGAGGAGGG - Intronic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1179602292 21:42487952-42487974 CGCGAGCACCAGCCTGAGGATGG + Intronic
1179886304 21:44315666-44315688 CTGAGGCAGCAGCCTGAGGCTGG + Intronic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1180662890 22:17484299-17484321 CAGGATCAGGAGGCTGAGGCAGG - Intronic
1181030968 22:20148788-20148810 CAGGGTCAGCAGCCTGCGGGCGG + Exonic
1181113162 22:20613600-20613622 AAGAAGCAGCAGGCTGAGCATGG + Intergenic
1181324057 22:22031279-22031301 CATCAGCAGCAGCCAGAGAAGGG + Intergenic
1181512354 22:23394605-23394627 CAGGATCAGCAGCCTACGGGCGG - Intergenic
1182072788 22:27475431-27475453 CAGGAGGGGCAGGCAGAGGAAGG - Intergenic
1182748600 22:32624359-32624381 GATGAGCAGCATTCTGAGGAGGG + Intronic
1183036701 22:35146119-35146141 CAGGGGCAGCAGCCTGGTGTAGG - Intergenic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183367017 22:37412356-37412378 CAGGAGCCCCAGTCTGAGGGTGG - Intronic
1183456278 22:37924907-37924929 CAGGAGCAGGGACCTGGGGAGGG - Intronic
1183489980 22:38110981-38111003 CAGCAGCAGCAGCCCCTGGAGGG + Intergenic
1183526128 22:38323967-38323989 CAGGGGCAGGAGCCTGATGGGGG - Intronic
1183746847 22:39697135-39697157 CAGGTGCAGTGGCCGGAGGAAGG + Intergenic
1183775205 22:39959620-39959642 CAGGTGCAGCCGGCTGAGCAGGG - Intronic
1184027464 22:41868531-41868553 CTGCAGCAGAAACCTGAGGATGG - Intronic
1184262870 22:43329347-43329369 AACGAGGAGCACCCTGAGGAAGG + Intronic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1184658280 22:45952948-45952970 AAGGGGCAGCAGCCAGGGGAGGG - Intronic
1184856360 22:47148745-47148767 CAGGAGAAGAACCCAGAGGAGGG - Intronic
1185053159 22:48564211-48564233 CAGCGCCCGCAGCCTGAGGATGG + Intronic
1185284389 22:49993871-49993893 CAGGAGCAGGAACCTGGGGCGGG + Intergenic
1185370795 22:50460010-50460032 CCTGAGCAGCAGCCTGAGCCGGG - Exonic
949263501 3:2130317-2130339 CAGGAGCAGCAGTCCCAAGATGG + Intronic
950103150 3:10370540-10370562 CTGGAGCAGCAGGCTAAGGGAGG - Intronic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
950576021 3:13832484-13832506 GAGTAGGAGGAGCCTGAGGAGGG - Intronic
950682748 3:14596168-14596190 CAGGGGCAGCTGCCTGAGAAAGG + Intergenic
950684804 3:14608811-14608833 GAGGCCCTGCAGCCTGAGGAAGG - Intergenic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
953282925 3:41575981-41576003 CAGGAGCAGCTCCCTGGGGATGG + Intronic
954256758 3:49412536-49412558 CAGCAGCAGCAGCTTGAAGAGGG - Exonic
954675718 3:52314345-52314367 CAGGAGCAGCGGCCCAAGGGGGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956177427 3:66486193-66486215 CACAAGCAGAAGCTTGAGGAAGG - Intronic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
957435107 3:80164670-80164692 AAAGAGCAGAAGCCTGAGAAAGG + Intergenic
960044873 3:113186902-113186924 GAGGAGCAGGAGGCTGAGGGCGG + Intergenic
961212447 3:125136275-125136297 CAGCAGCCACACCCTGAGGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961810761 3:129520261-129520283 CATGACCAGCATCCTGGGGACGG + Exonic
962259124 3:133892096-133892118 CAGGAGCAGGTGTTTGAGGAGGG - Intronic
962626017 3:137226888-137226910 CAGGATCAGCAGCCTGTGCTAGG - Intergenic
962942040 3:140133840-140133862 CCTGAGCAGTAGCCTGAGCATGG + Intronic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966027053 3:175296913-175296935 CAGGAGCAGAAGACTCAGAATGG + Intronic
966823419 3:183943127-183943149 TACTAGCAGCAGCCTGGGGAGGG + Intronic
967087431 3:186108282-186108304 CCGGAACAGCGGCCTGGGGATGG - Intronic
968734300 4:2287428-2287450 CACGTGCAGCAGCCGTAGGATGG + Intronic
968922100 4:3527601-3527623 CAGAAGCAGCACCCTGGGGCAGG + Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969484468 4:7464421-7464443 AGGGAGCCGCAGCCTGTGGAGGG + Intronic
970340361 4:15100025-15100047 CAGGAGCTGTAGCCTTAGGTAGG + Intergenic
970574113 4:17411218-17411240 AAGCAGCAGCAGCCTGATGCAGG + Intergenic
972285750 4:37646412-37646434 CAGCAGCAGCTGCCAGTGGACGG + Intronic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973801468 4:54482837-54482859 AAAGAGCAGCTGCCTGGGGAAGG - Intergenic
974156293 4:58077544-58077566 CAGGACCAGGAGGCTCAGGAAGG + Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
976178125 4:82374322-82374344 CGGGAGCAGCAGCGTTAGGCCGG + Intronic
976612159 4:87041322-87041344 CAGCAGCAGCAGCCTGGCCAAGG - Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
978587658 4:110291547-110291569 CCTGAGGAGCTGCCTGAGGAGGG + Intergenic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
980080991 4:128343928-128343950 CAGGATGAGTAGGCTGAGGAGGG + Intergenic
980628832 4:135408293-135408315 CAGCAGCAGCTGCCTGATGGCGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983599205 4:169505329-169505351 CAGGTGGAGTAGGCTGAGGAAGG - Intronic
984612481 4:181856703-181856725 CAGGAGGAGCAGCCTGCCCAGGG - Intergenic
985553982 5:547190-547212 CAGGAGCAGCTGCCCAAGGATGG + Intergenic
985774119 5:1831787-1831809 CAGGAGGAGGAGCCGGGGGAAGG - Intergenic
985892284 5:2724959-2724981 CAGGTGCTGCTGCCTGAGGAGGG + Intergenic
986329401 5:6706516-6706538 CAGGAGCCACTGCCTGAGCAAGG - Intergenic
986614995 5:9606825-9606847 GAGAAGGATCAGCCTGAGGAAGG + Intergenic
987234786 5:15931804-15931826 GAGGGGCAGCAGGCAGAGGAGGG - Intronic
987526257 5:19053707-19053729 CAGGAGCAGCCTTCTGAAGAAGG + Intergenic
988253480 5:28791955-28791977 CAGGAGCAGAAGCCTGCAGCTGG - Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
990450756 5:55929808-55929830 AAGGAGAAGCATCCTGCGGAGGG - Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
992195663 5:74336549-74336571 CAGAAGCAGCTGCCTGCGGAGGG - Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994612781 5:102066065-102066087 CAGGGGCAGCAACTTGTGGAAGG + Intergenic
997695205 5:135856178-135856200 AAGGAGCATGAGCCTCAGGAAGG - Intronic
997887326 5:137641854-137641876 CAGCAGCAGCAGCTCGAGGCTGG - Intronic
998161704 5:139816697-139816719 GAGAAGCAGCAGCCAGAGGTGGG - Intronic
998295654 5:140966822-140966844 CAGTAGCAGCAGCCAGGGCATGG - Exonic
999176552 5:149635833-149635855 CAGGGGCAGTTTCCTGAGGAAGG + Intergenic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999327232 5:150650791-150650813 CAGGAGCTTGAGCCTCAGGAGGG - Exonic
999456187 5:151718313-151718335 AAGGAACTGCAGCCTGATGATGG + Intergenic
999639792 5:153661048-153661070 GAGGAGCAGCAGCATGGGGCTGG - Intronic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000338579 5:160260125-160260147 CAGCAGCAGCAGCCAGGGGCTGG + Intronic
1001206679 5:169769742-169769764 CAGCTCCAGGAGCCTGAGGAGGG + Intronic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1001599347 5:172918944-172918966 CAGCAGCCGCAGCGTGATGAGGG - Intronic
1001893902 5:175362495-175362517 GAGAGGCAGCATCCTGAGGAAGG + Intergenic
1001995507 5:176154239-176154261 CCAGAGCAGCTGCGTGAGGATGG - Intergenic
1002479461 5:179490412-179490434 CAGGAGCAGCGGCGAGAGAACGG + Intergenic
1002524194 5:179806542-179806564 GAAGAGCAGCAGCGTCAGGAAGG + Intronic
1002533752 5:179864769-179864791 CTGGAGCACCAGCCTGACCATGG - Intronic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1003097237 6:3151989-3152011 CTTGAGCAGCAGGCTGGGGATGG + Intronic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003324410 6:5081907-5081929 CAGGGGCTGCAGACTGAGCAAGG + Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003637321 6:7844683-7844705 CACGTGAACCAGCCTGAGGAGGG + Intronic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1004425252 6:15502676-15502698 CATGAGATGCAGCCTGAGGCGGG - Intronic
1005700710 6:28398065-28398087 CAGGAGCAGCATCCAGAGAGTGG - Exonic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1005900589 6:30213623-30213645 CAAGAGCCGCAGCCTGAGTTTGG + Intergenic
1006444131 6:34069433-34069455 CTGGAGCAGCCGCATGGGGAGGG - Intronic
1006455591 6:34130093-34130115 CGGGAGCAGGAGCCTCGGGAAGG - Intronic
1006793477 6:36718101-36718123 CAGCAGCTGCAGGCTGAGGTGGG + Exonic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007521290 6:42453038-42453060 CAGGCGCAGCAGGCCGGGGAGGG + Intergenic
1007701966 6:43770968-43770990 GAGGAGCCGCAGCCGGAGGAGGG + Exonic
1007757852 6:44112040-44112062 CAGAGGCAGCTCCCTGAGGAAGG - Intergenic
1008516333 6:52322986-52323008 CAGCAGCCAGAGCCTGAGGAGGG - Intergenic
1008766039 6:54916120-54916142 TAGGAGCAGAAGCTTTAGGAAGG - Intronic
1009398727 6:63230213-63230235 CAGGAGCAGCAGGGTGAGCCCGG + Intergenic
1009408807 6:63341491-63341513 CAGTAGCAGCAGCCCCAGGAAGG + Intergenic
1010720651 6:79279739-79279761 CAGGAGCTGCAGGTTGAGGCCGG + Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011398734 6:86937458-86937480 CAGGAGCAGGAGCATGGGCAGGG - Exonic
1011702892 6:89971987-89972009 AATGAGCTGCAGCCTGAGGGAGG + Intronic
1011702909 6:89972104-89972126 CAGGAGCAGCAGCTGGGGCAAGG + Intronic
1015519320 6:134115007-134115029 CAGGTGCAGCAGCGTGAAGTGGG + Intergenic
1015776905 6:136823263-136823285 CAGGAGCATCGTCCTTAGGAAGG - Intronic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1016738989 6:147508748-147508770 CATCAGAAGAAGCCTGAGGAAGG - Intergenic
1017450441 6:154549871-154549893 CAGGAAGAGGAGCTTGAGGATGG + Intergenic
1017874605 6:158514420-158514442 CAGAAGCAGGTACCTGAGGAAGG - Intergenic
1018043544 6:159946068-159946090 CAGCAGCCACAGCCTGAGAAGGG - Intergenic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019077885 6:169405072-169405094 CAGCAGCTGCAATCTGAGGAGGG - Intergenic
1019096852 6:169588713-169588735 CAGCAGCAGCAGCCTGACCTGGG - Intronic
1019221675 6:170478321-170478343 CAGGAGATGAAGCCTGAAGAGGG - Intergenic
1019486898 7:1293555-1293577 CAGGAGAAGCAACGTGAAGAGGG - Intergenic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1022342908 7:29485818-29485840 CAGAAGCAGCAGGCTGAGTGGGG - Intronic
1022537851 7:31108991-31109013 AAGGAGCAGCCCCCTGGGGATGG + Exonic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023230728 7:38025321-38025343 GAGGAGCAGAAGCCAGAGGCTGG - Intronic
1023862695 7:44225629-44225651 CAGGAGCAGCGGCTCGAGGAGGG - Intronic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024606502 7:51026545-51026567 CGGCACCTGCAGCCTGAGGAAGG - Exonic
1024813853 7:53244790-53244812 CAGGAGCTCCAGCCTGCTGAGGG - Intergenic
1025016020 7:55439761-55439783 CAGCATCTGCTGCCTGAGGATGG + Intronic
1026015788 7:66669733-66669755 CAGGAGGGGCAGGCTGGGGAAGG - Intronic
1026229600 7:68471439-68471461 CAGGGGGAGCAGTCTTAGGAGGG + Intergenic
1026334707 7:69383704-69383726 CAGGAGCAAGAGCCTGAAGTGGG - Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026699284 7:72625548-72625570 CAGGAGCGGGAGGCTGAGGTGGG + Intronic
1026830200 7:73605909-73605931 CTGCAGCTGCCGCCTGAGGATGG - Exonic
1027135004 7:75617758-75617780 CAGGAGCAGCAGCCTTACAAGGG - Intronic
1027176273 7:75905826-75905848 CAGGAGCAGCAGCCTCACCTGGG - Intronic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1028738001 7:94239864-94239886 CCGGAGCAGGAGCCTGAGCTGGG + Intergenic
1029467777 7:100736944-100736966 GAGCAGCAGCAGCCTGAGCTGGG - Exonic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030328101 7:108243211-108243233 CATGGGCAGGAGCCAGAGGACGG - Intronic
1031648210 7:124253338-124253360 GAAGAGCAGCAGTCTGAGGGAGG - Intergenic
1032006165 7:128303591-128303613 CTGGAGCAGCTGCCTGTGGGTGG - Exonic
1032364308 7:131285061-131285083 CAGAAGCTGCAGGGTGAGGATGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032803875 7:135337514-135337536 CAGGAACAGCAGCTGGAAGAAGG + Intergenic
1033012706 7:137639623-137639645 CAACAGCAGCAGCCAGAAGAAGG + Intronic
1033146363 7:138873659-138873681 CTGGAGCAGCAGCCTAAGACTGG + Intronic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1034069901 7:148174424-148174446 CTGAAGCACCAGCCTGAGGTGGG - Intronic
1034267505 7:149788383-149788405 CATGAGCAGCATCCTGAGCCCGG + Intergenic
1034281140 7:149855372-149855394 CAGCCGCAGCAGGTTGAGGAGGG - Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035047458 7:155978043-155978065 CAGCAGCAGCAGCCTGATGTGGG - Intergenic
1035233226 7:157479030-157479052 CCGGTGGAGCAGGCTGAGGAGGG + Intergenic
1035783670 8:2247411-2247433 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783683 8:2247449-2247471 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783696 8:2247487-2247509 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783707 8:2247525-2247547 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783733 8:2247601-2247623 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783746 8:2247639-2247661 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783771 8:2247715-2247737 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783823 8:2247867-2247889 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783836 8:2247905-2247927 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783849 8:2247943-2247965 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783887 8:2248056-2248078 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783900 8:2248094-2248116 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783913 8:2248132-2248154 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783973 8:2248322-2248344 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783997 8:2248398-2248420 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784019 8:2248474-2248496 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784081 8:2248664-2248686 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784202 8:2249044-2249066 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784215 8:2249082-2249104 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784265 8:2249234-2249256 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784290 8:2249310-2249332 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784335 8:2249462-2249484 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784382 8:2249614-2249636 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784427 8:2249766-2249788 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784474 8:2249918-2249940 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035808335 8:2471795-2471817 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808369 8:2471909-2471931 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808382 8:2471947-2471969 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808395 8:2471985-2472007 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808418 8:2472061-2472083 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808444 8:2472137-2472159 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808457 8:2472175-2472197 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1036116173 8:5962720-5962742 TGGGAGCAGCAGCCTTGGGAAGG - Intergenic
1036223053 8:6936927-6936949 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036228288 8:6978662-6978684 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036230741 8:6997779-6997801 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036233187 8:7016878-7016900 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036501873 8:9321592-9321614 CAGGAGCACCAGCCTCAGCTCGG - Intergenic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1039381623 8:37091040-37091062 CAAGAGGAGAAGCCAGAGGAGGG + Intergenic
1040072226 8:43197875-43197897 CAGGACCAGCAGGATGAAGAAGG - Exonic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1040575163 8:48645684-48645706 GAGGAGCAGGAGACAGAGGAAGG - Intergenic
1040664681 8:49618741-49618763 CAAGAGCAGCAGCCTTAGGAGGG - Intergenic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1041113266 8:54507535-54507557 CAGTAGCAGAAGACTGAGGCTGG + Intergenic
1041305003 8:56448594-56448616 CAGGAGCGGGAGGCTGAGGTAGG + Intergenic
1041460705 8:58108654-58108676 CAGGAGCTGGCGCCTGAGGACGG - Intronic
1041523426 8:58779201-58779223 AAGGAGCAGCAGGCCGTGGAAGG + Intergenic
1041608221 8:59810958-59810980 CAAAAGCAGAACCCTGAGGATGG + Intergenic
1042655079 8:71087104-71087126 AAGTAGCGGCAGCCTGGGGAGGG - Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1047446893 8:124927746-124927768 CCAGAGGAGCAGCCTGAGAAGGG + Intergenic
1048306832 8:133290277-133290299 CAGGAAGAGCAGCCACAGGAAGG + Intronic
1048937041 8:139366027-139366049 AAGGAGCAGCACCGTGAGGGAGG + Intergenic
1048993305 8:139774023-139774045 CTGGACCAGGAGCCTGGGGAAGG + Intronic
1049212807 8:141394522-141394544 CAAGTGCAGCAGCCCGAGGCTGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049415226 8:142491970-142491992 CAGGAGGAGCAGGCAGAGGCAGG + Intronic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049519515 8:143080812-143080834 CGGGAGCAGGAGCCTGGGGGTGG + Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049719415 8:144108683-144108705 AACGAGCAGCAGCCTGAGGTCGG - Exonic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052703817 9:31970087-31970109 CATTGGCAGCAGCCTGAGAATGG - Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1053461507 9:38274819-38274841 AAGGAGCAGGAGGCTAAGGATGG + Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1055713155 9:79087808-79087830 TAGGAGGAGCAGCCTGGTGATGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057423079 9:94927675-94927697 CTGGGGCAGCAGCCAGGGGAGGG - Intronic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057854944 9:98594658-98594680 GAAGAGCAGCAGCCTTTGGAAGG + Intronic
1057906490 9:98987408-98987430 CAGCAGCCGCAGCCTGGGGAGGG + Intronic
1058919606 9:109600332-109600354 CAGGAGCTGCAGCCTGCAGTAGG - Intergenic
1059065009 9:111074597-111074619 CAAGAGCAGCACCAAGAGGATGG + Intergenic
1059251347 9:112890304-112890326 CTTGAGCAGCAGCCCGAGGCGGG + Exonic
1059588816 9:115635264-115635286 CAGGAGCACAAGACAGAGGAAGG - Intergenic
1060235589 9:121860409-121860431 CAGCAGCAGCAGCCTGTCCATGG - Exonic
1060406967 9:123377611-123377633 CAGGAGCAGCCCCCAGAGGCGGG - Exonic
1060896659 9:127223291-127223313 CAGGAGCAGCATCCTCAGGAAGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061239224 9:129359436-129359458 CAGCAGCAGCGTCCTGAGGCTGG + Intergenic
1061405795 9:130392368-130392390 CAGGAGACGAGGCCTGAGGACGG + Intronic
1062022004 9:134324183-134324205 AAGGAGCAGCAGGCCGCGGACGG - Intronic
1062175229 9:135158321-135158343 CCGGACCTGCAGCCTGAGGCTGG - Intergenic
1062285920 9:135772428-135772450 CAGCACCAGATGCCTGAGGAGGG - Intronic
1062391777 9:136336758-136336780 CAGGGGCGGAAGCCTGAGGACGG - Intronic
1062536241 9:137022260-137022282 CAGGCTGAGCATCCTGAGGATGG + Intronic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062652915 9:137587478-137587500 CAGGACCGGCAGCCTCTGGAGGG - Intronic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1186342878 X:8662109-8662131 CAGGGGCATCAGCCTGATGCAGG - Intronic
1186379287 X:9040161-9040183 CAGAAGTAGGAGCCTGAGGCTGG + Intronic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187279959 X:17850618-17850640 CAGAAACAGCAACCTGAGGAAGG - Intronic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1190114076 X:47614317-47614339 CAGCAGCTACAGCCTGAGAAGGG + Intronic
1190794476 X:53728223-53728245 GAGTACCAGGAGCCTGAGGATGG - Intergenic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1191995384 X:67089535-67089557 CAGTAGCAGCAGCCTTGGGCAGG + Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1193538296 X:82739257-82739279 TAGGTGTAGCATCCTGAGGAGGG + Intergenic
1194314394 X:92357010-92357032 CAAGAGCAGGTGGCTGAGGATGG + Intronic
1195320930 X:103721497-103721519 TAGAGGCAGCAGCCTGAAGAGGG - Intronic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196179155 X:112671369-112671391 CATGAGGAGCAGCCTGACCATGG - Exonic
1198185946 X:134254217-134254239 CAGCAGCCCCAGCCTGAGAAGGG - Intergenic
1200622455 Y:5468540-5468562 CAAGAGCAGGTGGCTGAGGATGG + Intronic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic