ID: 1179928892

View in Genome Browser
Species Human (GRCh38)
Location 21:44553981-44554003
Sequence GCTTAGAAAGTACTCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179928892 Original CRISPR GCTTAGAAAGTACTCCACCC AGG Intronic
900993660 1:6109082-6109104 GCTTCCAAAGAACTCCTCCCAGG + Intronic
901352464 1:8609653-8609675 GCTTAGAAAGAACTCCAATCTGG - Intronic
901847270 1:11991403-11991425 GCTTAGACAGCACTGCCCCCAGG - Intronic
906376135 1:45298271-45298293 GCTTAGAAAGCACTTCAACATGG + Intronic
914673442 1:149889397-149889419 GCTGAGATAGTGCTCCAGCCTGG - Intronic
917152249 1:171957618-171957640 GCTTAGAAATTTCTCCCGCCAGG + Intronic
921161989 1:212479427-212479449 CCTTAGAAAACACTCCATCCAGG + Intergenic
921990124 1:221356892-221356914 GCTTAGAACTTACTCCCCACAGG + Intergenic
1062978832 10:1704993-1705015 GCTTTGAAAGGACTTCTCCCAGG - Intronic
1064304219 10:14150850-14150872 TTTTAGAAATTACTCCACCAAGG + Intronic
1075750071 10:124761167-124761189 GCTTAGCAAGAACTCAACACAGG - Intronic
1080088449 11:28315409-28315431 GCTTAGAAATTTCTTCCCCCAGG - Intronic
1081270597 11:41077936-41077958 GCTTAGAAATTTCTTCAACCAGG + Intronic
1092258985 12:6942381-6942403 GCTTAGAGAGAACTGCAGCCAGG + Intergenic
1092300494 12:7244043-7244065 GCCAAGATAGTACTCCAGCCTGG + Intergenic
1092360842 12:7834846-7834868 GCTTAGATAGTCCTTCACCCTGG + Intronic
1092373977 12:7940001-7940023 GCTTAGATAGTCCTTCACCCTGG + Intergenic
1095580785 12:43795171-43795193 GCTTAGAAAATACTCTAGCCTGG + Intronic
1095761536 12:45843415-45843437 GCTGAGATAGCACTCCAGCCTGG - Intronic
1106005339 13:25764810-25764832 GGTTACAAGGAACTCCACCCAGG - Intronic
1107127795 13:36863311-36863333 GCTTAGAAATTACTCCAATGTGG - Intronic
1107760058 13:43668751-43668773 ACTTAGAAAGTACCTGACCCAGG + Intronic
1109407386 13:61919347-61919369 GCTTAGAAATTTCTTCAGCCAGG + Intergenic
1112472810 13:99704600-99704622 TCATAGAAAGTACTCAACACAGG - Intronic
1112510702 13:100006575-100006597 GCCTAGATCGTACTCCAGCCTGG + Intergenic
1116319155 14:43437497-43437519 GCTTAGAAATTACTTCAACTTGG - Intergenic
1120032136 14:79653943-79653965 CCTTGGAAAGTACCCCACTCTGG + Intronic
1120400564 14:84025493-84025515 CCCTAGAAAGTAGTCCGCCCAGG - Intergenic
1122164757 14:99813948-99813970 GCTAAGAAAGGTCTCCACGCAGG - Intronic
1135936127 16:26781754-26781776 TCTGGGAAAGCACTCCACCCAGG + Intergenic
1138230018 16:55329904-55329926 CCTTAGAGAGCACTCTACCCAGG + Intronic
1141335442 16:83150574-83150596 GCTTAGAAATTACTTCCTCCAGG + Intronic
1141918433 16:87118147-87118169 GCGTAGAAAGTTTTCCACCTGGG - Intronic
1144092509 17:11870729-11870751 ACTCAGAAAGTGCTCCAGCCAGG - Intronic
1146011995 17:29203009-29203031 GCTTAGAAAATACTCTAGCCTGG + Intergenic
1149404246 17:56330642-56330664 GCTCTGAAAGTACTGCATCCTGG + Intronic
1149669299 17:58391723-58391745 GCTTTGGAAGGACTCCAGCCAGG - Intronic
1153523643 18:5975452-5975474 ACTGAGAAGTTACTCCACCCAGG + Intronic
1155268371 18:24115984-24116006 GCTTAGAAATCACCCAACCCAGG + Intronic
1161402941 19:4076874-4076896 GCTCAGAAAGTATTTCTCCCAGG - Intergenic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
932821705 2:74906926-74906948 GCTTAGAAATTTCTCCTGCCAGG + Intergenic
936797108 2:116219739-116219761 GCTTAAAAAATACTCCAACTAGG + Intergenic
941606430 2:167603033-167603055 GCTAAGAAAGTTCTCCAAGCAGG - Intergenic
947829164 2:233126617-233126639 GCTTTGAAAGTATTCCACATAGG + Intronic
948169698 2:235891110-235891132 GCTATGAAAGTCCTGCACCCTGG - Intronic
948274516 2:236697836-236697858 GCTTGCAAAGCACTCCACCCTGG + Intergenic
1168978268 20:1983993-1984015 GATTAGATATTACTTCACCCAGG + Intronic
1170569679 20:17625678-17625700 GCCTCGAAGGTACTCCTCCCTGG - Intronic
1171560623 20:26121790-26121812 GCTAAGAAAGACCACCACCCTGG + Intergenic
1173454543 20:43191737-43191759 GCTTAGAAATCTCCCCACCCGGG - Intergenic
1177741070 21:25154414-25154436 GCTTAGAAAGTTCTTCCTCCAGG - Intergenic
1179187270 21:39094449-39094471 TCTTAAAAAGTACTTCTCCCAGG + Intergenic
1179928892 21:44553981-44554003 GCTTAGAAAGTACTCCACCCAGG + Intronic
1180339293 22:11605551-11605573 GCTTAGAAAGGGCAGCACCCTGG + Intergenic
1182491032 22:30671996-30672018 GCTGTGATAGTACTCCAGCCTGG + Intergenic
1182925346 22:34117558-34117580 GCTTAGAAAGTAGTCTATCTTGG + Intergenic
958981943 3:100731606-100731628 GCTGAGATTGTACTCCACTCTGG - Intronic
961763036 3:129185462-129185484 GCTGAGACAGCACTCCAGCCTGG - Intergenic
962487637 3:135860588-135860610 GCTTAGAAATTACTTCCTCCAGG + Intergenic
963339842 3:144020650-144020672 GCTTAGAAATTTCTTCAGCCCGG + Intronic
963528277 3:146441180-146441202 GATTAAAAAATACTCCAGCCTGG + Intronic
967565672 3:190968772-190968794 GCCAAGCAAGTTCTCCACCCAGG + Intergenic
969600823 4:8175241-8175263 GATTAGAATGTACTTCACCTTGG - Intergenic
975435342 4:74344832-74344854 GCTTAGAAAGTTCTTCCTCCAGG + Intergenic
984573502 4:181421406-181421428 GCTTTGAAAGTACTGAAGCCTGG + Intergenic
987453164 5:18111386-18111408 GCTTAGGAAGTAGTTAACCCAGG + Intergenic
988070814 5:26285742-26285764 GCTTAGAAAGTTCTTCCGCCAGG + Intergenic
991032029 5:62092333-62092355 GCTTAGAAGCTACTACAACCAGG - Intergenic
992005658 5:72475092-72475114 GCTTACTGAGAACTCCACCCTGG + Intronic
1003960380 6:11203658-11203680 GCTAAGAAAGCACTTCATCCTGG - Intronic
1004583378 6:16975895-16975917 GCTTGGAAAATTCTCCATCCAGG + Intergenic
1005807708 6:29490528-29490550 GCTCAGCAAGTTCACCACCCTGG + Intergenic
1007054556 6:38869409-38869431 GCTTAGACTGCACTCCAGCCTGG - Intronic
1008351729 6:50499427-50499449 CCACAGAAAGTACTCCTCCCAGG + Intergenic
1016467261 6:144337909-144337931 GCTTAGAAAATATTCCAGGCTGG - Intronic
1016503314 6:144747368-144747390 GCTTAGAAAGGTCTCCAGCATGG - Intronic
1019922523 7:4172020-4172042 CCTTAGACACTACTCCAGCCTGG - Intronic
1024773795 7:52758387-52758409 CCTCAGAAAGCAGTCCACCCTGG - Intergenic
1028478000 7:91272615-91272637 GCATTGAAAGTACTCCACAGTGG + Intergenic
1031170833 7:118290467-118290489 GCTTAGAAATTTCTCCTGCCAGG - Intergenic
1031619573 7:123919321-123919343 GGTTAGAAAGTACTATAACCAGG + Intergenic
1035297752 7:157876753-157876775 TCTTAGAAAGTTCTCCGCCCTGG - Intronic
1038284609 8:26195985-26196007 GCATAAAAAGTACCCCAACCTGG + Intergenic
1043026508 8:75076814-75076836 GCATCCAATGTACTCCACCCTGG - Intergenic
1043459118 8:80441622-80441644 GCTTAGAAAGGACTTCCTCCAGG - Intergenic
1043925617 8:86032857-86032879 GCTTAGAAAGCACTTAGCCCAGG + Intronic
1044034767 8:87287042-87287064 GCTTAAATAGTTATCCACCCAGG - Intronic
1049302740 8:141880274-141880296 GCTTAGACAGTTCTCCTCCCTGG - Intergenic
1054868384 9:70026021-70026043 GCTTAGAAATTTCTCTCCCCAGG + Intergenic
1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG + Intergenic
1056011514 9:82335734-82335756 GCTCAGAAATTACTCCAGTCTGG - Intergenic
1056186124 9:84136762-84136784 GTATATAAAGCACTCCACCCAGG + Intergenic
1058494079 9:105535668-105535690 TCTTAGAAATTACCCAACCCAGG + Intronic
1186542205 X:10412001-10412023 GCTAAGAAATTATTCCACCTAGG + Intergenic
1187598142 X:20797501-20797523 GCTTAGAAGAAACTCCATCCTGG + Intergenic
1191095012 X:56664806-56664828 GCTTAGAAATTTCTTCAGCCAGG - Intergenic
1194301743 X:92195686-92195708 GTTTAGAAATGACTCAACCCCGG - Intronic
1194878302 X:99218279-99218301 TCTTATAAATTACTCCAGCCAGG - Intergenic
1196258004 X:113545517-113545539 GCTTAGAGTGTGCTCCACCCTGG + Intergenic
1197901249 X:131375243-131375265 ACTTAGAAAGTTCTCCACTCTGG - Intronic
1200330360 X:155289941-155289963 GCTTAGAAAATACTCTAGCCTGG + Intronic