ID: 1179929442

View in Genome Browser
Species Human (GRCh38)
Location 21:44557675-44557697
Sequence GCATCCAGGCTGACAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179929442_1179929447 16 Left 1179929442 21:44557675-44557697 CCTGGTGCTGTCAGCCTGGATGC 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1179929447 21:44557714-44557736 CCCGAAGCTCCCACCCCACGCGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179929442 Original CRISPR GCATCCAGGCTGACAGCACC AGG (reversed) Intronic
900764861 1:4497992-4498014 CCCTCCAGGCTGGCACCACCAGG + Intergenic
902822422 1:18951400-18951422 GCCTCCAGGCTGACTTCAACTGG + Intronic
905099527 1:35506942-35506964 GCATTCAGGCAGACTGCAGCAGG - Exonic
907045722 1:51298925-51298947 GCCTCTAGGCTGCCAGCACTGGG + Intronic
908555711 1:65254742-65254764 GCATCCAGGCTCCCAGGGCCGGG - Intronic
911599283 1:99830751-99830773 GCATCCAGGCTGACATAAGTAGG - Intergenic
915076597 1:153312960-153312982 AGACCCAGGCTGAGAGCACCTGG + Intergenic
917964230 1:180168312-180168334 GCCTCCAGACGGGCAGCACCTGG + Intronic
918283084 1:183024045-183024067 ACAACCAGGCCGACACCACCTGG + Exonic
920059571 1:203218005-203218027 GCATCCAGGCTCCCAGCCCAAGG - Intronic
923401483 1:233619343-233619365 GCATCCTGGCTAAAGGCACCAGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063092503 10:2879706-2879728 CCCTCCAGGCTCACAGCAGCGGG - Intergenic
1064253059 10:13721669-13721691 TCTTCCAGCCTGTCAGCACCAGG + Intronic
1065552911 10:26887320-26887342 GTATCCAGGCAGACAGGACATGG + Intergenic
1065596641 10:27319789-27319811 GCGACCAGGCTGCCAGCACTGGG + Intergenic
1067327822 10:45286611-45286633 GCACCCAGGAGCACAGCACCAGG - Intergenic
1070744908 10:78927778-78927800 GCTTGCACGCAGACAGCACCAGG + Intergenic
1070754731 10:78984989-78985011 GCAACCTGGCACACAGCACCGGG - Intergenic
1071643226 10:87336855-87336877 GCATCAAAACTGACAGCAGCAGG + Intergenic
1074896233 10:117779978-117780000 CCATCCTGGCTGGCACCACCGGG + Intergenic
1075977178 10:126706170-126706192 GCATCAGGGCTGGCAGCTCCTGG - Intergenic
1076848654 10:133082335-133082357 GGACCCAGGCAGAGAGCACCTGG - Intronic
1082125691 11:48428938-48428960 GCATCCTTACTGACAACACCAGG + Intergenic
1083958130 11:65998145-65998167 GCATTCAGGATGACAGCCCTAGG - Exonic
1084653998 11:70504771-70504793 GGATCGAGGAAGACAGCACCGGG + Intronic
1085309715 11:75509002-75509024 TCATCCCGACTGACAGCTCCTGG + Intronic
1085397363 11:76213376-76213398 GCACCCAGGCTGAAAGGACATGG + Intergenic
1088532965 11:110830539-110830561 GCATCCTGGCTGTCACCTCCTGG + Intergenic
1090402621 11:126458713-126458735 GCAGGCAGGCTGACCGCACCAGG - Intronic
1091114875 11:133003924-133003946 TCACACAGGCTGGCAGCACCCGG + Intronic
1095581557 12:43806207-43806229 GCATCCAAGGTAACAGCGCCCGG - Exonic
1096153529 12:49329492-49329514 GCCTCCAGGCTGGCAGCACAGGG - Intronic
1097180300 12:57167947-57167969 GGCTCAAGGCTGACATCACCTGG - Intronic
1099711218 12:86227054-86227076 GCATCCAGGCTGACATATCCAGG + Intronic
1100103399 12:91138449-91138471 CCACCCAGGCTGCCTGCACCAGG + Intergenic
1103971610 12:124676043-124676065 GAATCAAGGCTGACAGCTTCAGG - Intergenic
1104676232 12:130714312-130714334 GCAGCCGGGCTGAGAGCTCCTGG - Intronic
1107566207 13:41607481-41607503 GTATCAAGGCTGACAGAAGCTGG + Intronic
1108022107 13:46138076-46138098 GCAAGCAGGCTGCCAGCACATGG - Intronic
1110781199 13:79466970-79466992 ACACCAACGCTGACAGCACCTGG - Intergenic
1112128945 13:96499832-96499854 GCGTCCAGGCTGAACGCACTGGG + Intronic
1113325994 13:109281990-109282012 GGTTCCATGCTGACAGCATCTGG + Intergenic
1114417826 14:22556169-22556191 GCAGCCAGAATGACAGCACTGGG - Intergenic
1117250827 14:53935737-53935759 GCGTCCAGGCTGAGTGCAGCAGG + Intergenic
1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG + Intronic
1122199370 14:100113193-100113215 GCATCCAAGATGGCAGCACTAGG - Intronic
1122640153 14:103155240-103155262 GCCTCCAGGCTGCCAGGGCCCGG - Intergenic
1124618578 15:31260923-31260945 GCATCCAGGCCAAAAGCACATGG - Intergenic
1125106802 15:35980822-35980844 GCATCCAGGCTTACAACCTCTGG - Intergenic
1125450896 15:39806002-39806024 CCCTCCATGCAGACAGCACCAGG + Intronic
1128260899 15:66232197-66232219 GCATTCAGGCTGGCTGCCCCAGG - Intronic
1128538196 15:68506273-68506295 GCATCCAGCCTGGAGGCACCAGG + Intergenic
1128710851 15:69870765-69870787 ACCTCCTGACTGACAGCACCAGG + Intergenic
1132080755 15:98863288-98863310 GGATCAAAGCTAACAGCACCAGG - Intronic
1132152902 15:99475095-99475117 CACTCCAGGCTGACAGCAGCTGG + Intergenic
1132899001 16:2243368-2243390 GCATCCTGGCGGACAACCCCAGG - Exonic
1136373233 16:29848928-29848950 GCACCCAGGCTGACTGCACCTGG - Intergenic
1138138556 16:54546289-54546311 CCAGCCAGGCTGACACCCCCGGG - Intergenic
1139776686 16:69320830-69320852 GCACCCGGGCTGCCAGCAGCAGG - Intronic
1141180770 16:81752205-81752227 GCCTCCAGGCTTCCAGCATCAGG - Intronic
1142002449 16:87671389-87671411 CCACCCCGGATGACAGCACCAGG + Intronic
1142421460 16:89972889-89972911 GCAGTGAGGCCGACAGCACCTGG + Intergenic
1142594615 17:1023391-1023413 GCCTCCAGGCTGCCTGCACAGGG - Intronic
1144668282 17:17116774-17116796 AGCCCCAGGCTGACAGCACCTGG - Intronic
1146650455 17:34603119-34603141 GCATCTAGGCTGACAGAAAGTGG + Intronic
1147514802 17:41105663-41105685 GCACGCAGGCTGGCAGCACTGGG - Exonic
1147522709 17:41189903-41189925 GCATGTAGGCTGACAGCAAGGGG - Exonic
1147522731 17:41190020-41190042 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147522767 17:41190221-41190243 ACAGCAAGGCTGACAGCAACTGG - Exonic
1147522789 17:41190353-41190375 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147526268 17:41226788-41226810 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147526802 17:41232620-41232642 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147527307 17:41238170-41238192 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147528409 17:41249737-41249759 GCATGTAGGCTGACAGCAAGGGG - Exonic
1147528431 17:41249854-41249876 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147528481 17:41250157-41250179 GCAAAAAGGCTGACAGCAGCTGG - Exonic
1147530419 17:41271327-41271349 GCATGTAGGCTGACAGCAAGGGG - Intergenic
1147530439 17:41271444-41271466 GCAGCAAGGCTGGCAGCAGCTGG - Intergenic
1147530852 17:41275816-41275838 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147530916 17:41276179-41276201 GCAAGCAGGCTGACAGCAGCTGG - Exonic
1147535039 17:41315366-41315388 GCACACAGGCCCACAGCACCCGG + Exonic
1148850659 17:50553460-50553482 GGATACAGGCTGCCTGCACCAGG - Intronic
1150429140 17:65101535-65101557 GCTGCCTGGCTGACAGCACGTGG - Intergenic
1150450351 17:65261404-65261426 GCATCAACACTGACAGCAGCTGG + Intergenic
1152657098 17:81524805-81524827 GGATCCAGGATGACAGTCCCAGG + Intergenic
1152763495 17:82122188-82122210 GCATCCAGGCTGAGAGCCCGAGG - Intronic
1154345910 18:13543355-13543377 GAATTCAGGATGACAGTACCCGG - Intronic
1156841453 18:41614534-41614556 GCAGGCAGGCAGCCAGCACCAGG - Intergenic
1160817641 19:1043470-1043492 GCATCCAGGCTGCCCCCACCTGG - Exonic
1161027524 19:2043347-2043369 GCAGGCTGGCTGACAGCCCCAGG - Intronic
1161058391 19:2201789-2201811 GCAGCGAGGCTGGCAGCTCCTGG - Intronic
1161583490 19:5093004-5093026 GCACCCAGGCAGACAGCTCCAGG - Intronic
1162438842 19:10680398-10680420 GCATCTAGACAGACAGCAACGGG + Exonic
1163074871 19:14880905-14880927 TCATCCAGGATGCCAGAACCAGG + Exonic
1163479768 19:17548229-17548251 GCATCCATGCAGCCAGCACAAGG + Intronic
1164618022 19:29678229-29678251 GCTTCCAGGCTGACAGCCGAGGG + Intergenic
1164813610 19:31177353-31177375 GCAACCATGCTGACACCACCCGG - Intergenic
1165072002 19:33261135-33261157 GCATGAAGGCTGGCAGCACATGG - Intergenic
1165334230 19:35157761-35157783 GCAGACAGGATGACAGCCCCAGG - Intronic
1167178495 19:47883125-47883147 GTATCCAGGTTGACTGCCCCGGG - Intronic
1167749604 19:51371817-51371839 GCACCCAGGCTCAGGGCACCTGG + Exonic
1168249573 19:55134125-55134147 GGATCCAGTCCGACAGCTCCTGG + Exonic
925307814 2:2862459-2862481 GCCTCCAGACTCAGAGCACCTGG - Intergenic
925591293 2:5512551-5512573 GAATCCAGGCTTGCAGCACATGG - Intergenic
930444818 2:51456725-51456747 GTATCCAGACTTACAGAACCAGG + Intergenic
933382563 2:81568251-81568273 TCTTCCTGGCTGGCAGCACCAGG + Intergenic
933842415 2:86298245-86298267 GGACCCAGGATGATAGCACCAGG + Intronic
934862864 2:97779145-97779167 GCACCCAGGCTGAGAGCCACTGG + Intronic
936118561 2:109722147-109722169 GCAACCATCCTGTCAGCACCAGG + Intergenic
947624986 2:231613670-231613692 CCAGCCAGGTTTACAGCACCAGG + Intergenic
948874037 2:240818057-240818079 GCACCCAGGGGGGCAGCACCCGG + Intronic
1169039168 20:2479016-2479038 GCAGGCAATCTGACAGCACCTGG - Intronic
1169142734 20:3235415-3235437 GCATCGAGGCTGAGAGACCCAGG + Intronic
1169422211 20:5469866-5469888 GCAGCCAGGATGACAGCACATGG + Intergenic
1170815235 20:19708431-19708453 GAATTCAGGCTCCCAGCACCAGG + Intronic
1170873776 20:20232171-20232193 GCCTTCAGGCTGGCAGGACCTGG - Intronic
1172765140 20:37346771-37346793 CCTTCCAGGCCGGCAGCACCAGG - Intronic
1172954274 20:38744571-38744593 CCATCATAGCTGACAGCACCAGG + Intergenic
1173790150 20:45823129-45823151 CCATCCCGGCTGGCACCACCCGG - Intergenic
1174132718 20:48357406-48357428 TCACCCAGGCTCACAACACCAGG - Intergenic
1174486811 20:50866324-50866346 GGCTCCAGGCTCACACCACCAGG - Intronic
1174693994 20:52538881-52538903 GCATACAGGCTGGCAGCACGAGG - Intergenic
1175302506 20:57952887-57952909 GCTTCCAGGCCCACAGCCCCGGG + Intergenic
1175743121 20:61434751-61434773 ACAGCCAGGCAGACAGGACCAGG + Intronic
1175790527 20:61737522-61737544 CCATCCATGCTGTCATCACCTGG + Intronic
1178695992 21:34792960-34792982 CCACCCAGGATGACACCACCTGG + Intronic
1179887469 21:44320331-44320353 GCAGCCAGGGTCCCAGCACCCGG - Intronic
1179929442 21:44557675-44557697 GCATCCAGGCTGACAGCACCAGG - Intronic
1180018598 21:45104297-45104319 GAATCCAAGCTGACAGCACCCGG - Intronic
1181047728 22:20223568-20223590 GTATCCAGGGCGACAGCTCCTGG + Intergenic
1181639234 22:24188085-24188107 CCTGCCAGGCTGACGGCACCTGG + Exonic
1183021859 22:35033755-35033777 GGAGCCAGGCTGTCACCACCAGG + Intergenic
1184029891 22:41886363-41886385 GAATCTAGGCTGACAGCAGGAGG + Intronic
1184147959 22:42622546-42622568 GCCTCCAGGCTGAGAGACCCAGG - Intronic
1184309024 22:43629134-43629156 GAATCCAGGCTGGCCCCACCTGG - Intronic
1184944836 22:47795790-47795812 GCCTCCTGGCTCACAGCTCCTGG + Intergenic
1185042766 22:48513883-48513905 TCATCCAAGCTGAGAACACCAGG - Intronic
1185085402 22:48738100-48738122 GCAGCCAGGCTCACTGCAGCAGG - Intronic
1185105500 22:48867279-48867301 GCATCCAAGCTCACAGCTCTGGG - Intergenic
1185129616 22:49031764-49031786 GCATCCATGCTGACAGCTGGAGG - Intergenic
949682182 3:6526854-6526876 GCAGCCTGGCTGACAGAACAAGG + Intergenic
949950644 3:9226027-9226049 GCTTGCAGACTGACAGCACATGG - Intronic
950668639 3:14512179-14512201 GCAGCCAGGCTGACTGCGGCTGG + Intronic
950964844 3:17138991-17139013 CCATCCGGGCTGCCAGCACCTGG + Intergenic
954242449 3:49304538-49304560 GAATCCAGGCTCAGAGAACCTGG + Intronic
960054727 3:113269030-113269052 CCATCCAGGCTCTCAGCACATGG + Intronic
964129708 3:153273103-153273125 GGATCCAGAGGGACAGCACCTGG + Intergenic
969592521 4:8130133-8130155 CCTTCCAGGCTGAGACCACCAGG - Intronic
969698347 4:8748560-8748582 GCATGCAGGCTGGCAGGACAGGG + Intergenic
969876174 4:10137141-10137163 GCACACAGGATGACAGCCCCTGG - Intergenic
977343595 4:95791219-95791241 GTATTCTGGCTGATAGCACCAGG + Intergenic
983323760 4:166227425-166227447 GCGTCCAGGCTGTCTGCACCAGG - Intergenic
983784677 4:171716174-171716196 GCAGCCAGGCAGGCAGCTCCAGG - Intergenic
985861793 5:2477242-2477264 TCCTCCAGGCAGGCAGCACCCGG - Intergenic
985882870 5:2653753-2653775 TCATCCTGGCTGACAGCCACTGG - Intergenic
986100290 5:4602160-4602182 GTATCCAGGCTGACTCTACCAGG + Intergenic
986232699 5:5881412-5881434 TCATCCACTCTGACAGCACATGG - Intergenic
986642681 5:9888018-9888040 GCAGCCCCGCTGAGAGCACCAGG + Intergenic
987987388 5:25165177-25165199 GCAGCCTGGCTGACAGAGCCAGG - Intergenic
990371489 5:55123582-55123604 GCCTCCTGGCAGTCAGCACCTGG - Intronic
992614048 5:78532893-78532915 TGAGCCAGGCTGACAGCACGTGG + Intronic
994762309 5:103870473-103870495 TCATCCAGGCTCAAAGCATCTGG - Intergenic
1001453938 5:171846618-171846640 ACATCCAGGCTGACATCTCACGG + Intergenic
1002596708 5:180328479-180328501 GCATCCGGGGTGACATCACGAGG + Intronic
1007751204 6:44073053-44073075 GCCTCCAGGCTGAGAGATCCTGG + Intergenic
1007809670 6:44476956-44476978 ACAGCCAGGCTGACAGGGCCTGG + Intergenic
1011558247 6:88590685-88590707 CCATCCAGGCTGATGGCTCCGGG - Intergenic
1013183656 6:107738828-107738850 CCTTACAGGCTGACAGCTCCGGG - Intronic
1013412295 6:109892943-109892965 GCCTCCAGTCTGGCCGCACCTGG - Intergenic
1014218417 6:118775634-118775656 GCAGGCAGGATGACAGCTCCAGG - Intergenic
1016841904 6:148533472-148533494 GCAGCCTGGCTGAGAGCACCAGG + Intronic
1017681648 6:156870337-156870359 GCATCCAGCCTCTCAACACCAGG - Intronic
1018228258 6:161651371-161651393 ACATACAGGTTGACAGCACCTGG - Intronic
1018869176 6:167768598-167768620 GGAACCTGGCTGAGAGCACCCGG - Intergenic
1019150202 6:170000528-170000550 GCCTCCAGGGGGACAGCAGCAGG - Intergenic
1020255860 7:6502940-6502962 GCCTCCAGGCTGGAAGCCCCAGG + Intronic
1020529042 7:9306537-9306559 CTTTCCAGGCTCACAGCACCCGG + Intergenic
1022588843 7:31642200-31642222 GCTGCCAGTCTGACAGCAGCGGG + Exonic
1024054831 7:45653349-45653371 GCAGCCAGGCTGACAAGACCAGG + Intronic
1024777166 7:52800718-52800740 GCGTCCAGGCTGTGAGCACCAGG - Intergenic
1026353561 7:69538259-69538281 GCATCCAGCATTACATCACCTGG + Intergenic
1027880370 7:83827988-83828010 GCATCCAGGCTGAGACTTCCAGG + Intergenic
1030699431 7:112622217-112622239 GAATCCAGGGTGGCAGCAGCAGG + Intergenic
1032017624 7:128389823-128389845 GCATTCAGGCAGCCTGCACCAGG - Intergenic
1032087934 7:128893462-128893484 CCATCCAGGCTGTGAGTACCAGG - Exonic
1034075693 7:148229129-148229151 CCATATCGGCTGACAGCACCAGG - Intronic
1034931466 7:155167087-155167109 GCATGAAGACTGTCAGCACCTGG + Intergenic
1036750162 8:11438762-11438784 CCAGACAGGCTGAAAGCACCGGG + Intronic
1039259816 8:35759340-35759362 GCATCAAGGTGGACAGCTCCTGG + Exonic
1043916916 8:85933520-85933542 GTATCCAGACAGGCAGCACCAGG - Intergenic
1044147329 8:88733300-88733322 GGCCCCTGGCTGACAGCACCTGG + Intergenic
1046780267 8:118207314-118207336 GCATCCCTGCTGAGAGCATCTGG - Intronic
1047417187 8:124674401-124674423 ACATCAAGGCTGACAGCTCCTGG - Intronic
1047417342 8:124675410-124675432 ACATCCAGGCTGACAGGTCCTGG + Intronic
1050650021 9:7766067-7766089 GCTTCCATGCTGACAGCTGCTGG - Intergenic
1050733318 9:8734672-8734694 GCATCAAGAGTGACAGCACAAGG + Intronic
1052986490 9:34491699-34491721 GCATCCAGGCTCTGAACACCAGG + Intronic
1059372145 9:113850755-113850777 GCATCCTGGCTGTCTTCACCTGG - Intergenic
1060960685 9:127678574-127678596 GCATCCAGGCTGACAAGCCAAGG - Intronic
1061001710 9:127906362-127906384 GCATCCCAGCTGACAGCCCGAGG + Intergenic
1062178225 9:135176156-135176178 GACTCCAGGCTGAGAGCACCTGG - Intergenic
1187621628 X:21062677-21062699 GCACCCAGCCTCACAGAACCTGG - Intergenic
1189238198 X:39505187-39505209 GCATCCATTCTGCCAGCACAGGG + Intergenic
1192153017 X:68723748-68723770 GCATCAGGGCTTCCAGCACCTGG - Exonic
1195040527 X:101010012-101010034 GAACCAAGGCTGACAGCAACAGG + Exonic
1197597852 X:128488682-128488704 GCATCAAGGCTGACTGAACTGGG - Intergenic
1197700370 X:129595123-129595145 GCATGCTGGCTGACTGCCCCTGG + Intergenic