ID: 1179929845

View in Genome Browser
Species Human (GRCh38)
Location 21:44559946-44559968
Sequence ATGGCTAAGGGCTCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179929837_1179929845 19 Left 1179929837 21:44559904-44559926 CCCATAGGCTGCAGGGTTTGAAG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1179929838_1179929845 18 Left 1179929838 21:44559905-44559927 CCATAGGCTGCAGGGTTTGAAGC 0: 1
1: 1
2: 1
3: 8
4: 135
Right 1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1179929839_1179929845 -4 Left 1179929839 21:44559927-44559949 CCTCTGACCTTTGATGAGTATGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179929845 Original CRISPR ATGGCTAAGGGCTCTGTTGG AGG Intronic
900118453 1:1038577-1038599 ATGGCCAAGGGCACTGTTCCTGG - Intronic
901226330 1:7614866-7614888 ATGGGCAAGGGCCCTGATGGAGG - Intronic
904265803 1:29317999-29318021 AAAGCTGAAGGCTCTGTTGGGGG + Intronic
906177630 1:43789199-43789221 ATGGAAATGGGCTATGTTGGAGG + Intronic
907972206 1:59394050-59394072 AAGGAAAAGGGATCTGTTGGGGG + Intronic
908688605 1:66752416-66752438 AGGGCCGAGGGCTCTGTTTGAGG + Intergenic
916685011 1:167136373-167136395 ATGGCTAAGAGCTGTTCTGGGGG + Intergenic
918716906 1:187801071-187801093 CTGTCTAAGGGCTTTCTTGGAGG + Intergenic
920316112 1:205076700-205076722 AGGGCAAAGGGCTCTGTAAGGGG - Exonic
920361665 1:205421876-205421898 ATTGTTGAGGGCTCTATTGGAGG - Intronic
920805941 1:209233202-209233224 ATGGCTCAGGGAACTGGTGGAGG + Intergenic
923545294 1:234919149-234919171 AGGGCGAAGGACTCTGTTCGGGG - Intergenic
1063249958 10:4263795-4263817 CTGGTTAAGGGGTCTGTGGGAGG - Intergenic
1067085749 10:43237352-43237374 ATGGCCAGGGGCTCCATTGGAGG - Intronic
1067254149 10:44618921-44618943 GTGGCTAAAGGATATGTTGGAGG - Intergenic
1069657601 10:70101620-70101642 ATGGTTAGGGGGTTTGTTGGGGG - Intronic
1071810671 10:89177444-89177466 ATGGTTATGGGCATTGTTGGTGG - Intergenic
1074833230 10:117264247-117264269 ATGGCCCAGGGCACTGTTGCAGG + Intronic
1075952640 10:126495169-126495191 CTGGTTAAGAGCTCTGTTTGGGG - Intronic
1080452454 11:32389849-32389871 ATGTCTGAGGGCTCTTTGGGTGG - Intronic
1082044058 11:47710607-47710629 ATTGCAAAGGGCTGTGGTGGTGG - Intronic
1083259700 11:61516373-61516395 TTGGCTAAGAGCTCTGTGGGCGG + Intronic
1088345418 11:108818979-108819001 ATGGTTTGGGGTTCTGTTGGTGG + Intronic
1089802598 11:121047234-121047256 GTGGATGAGGGCTCTGTTGTTGG + Intronic
1093487237 12:19665254-19665276 ATGGCCAAGGGCTTTGTGGAAGG + Intronic
1094372754 12:29755859-29755881 CTGGATCAGGGCTGTGTTGGGGG - Exonic
1098106861 12:67076833-67076855 ATGACTAAGAGCTTTCTTGGTGG + Intergenic
1100524678 12:95408199-95408221 AGGGCCAGGGGCTCTGTTTGAGG + Intergenic
1105425908 13:20294961-20294983 ATGGCAAAGGGCTCTGAAAGGGG - Intergenic
1106045681 13:26139116-26139138 ATAGCAAAGGACTCTGATGGGGG + Intronic
1113424599 13:110197677-110197699 ATGGATGAGGCCACTGTTGGGGG - Intronic
1113882911 13:113637820-113637842 ATGGCTCAGGGAACTGTTGGAGG + Exonic
1119993572 14:79227258-79227280 ATGCTCAAGGGCCCTGTTGGTGG + Intronic
1126537045 15:49777799-49777821 ATGACGGAGGGCTCTGTTGGAGG + Intergenic
1128280542 15:66390500-66390522 CTGGGTAAGGGCTATGTTAGAGG - Intronic
1128878440 15:71221446-71221468 TTGGCTAAGGGCTGCGGTGGGGG - Intronic
1129948060 15:79559457-79559479 ATGGCTCAGGGAACTGTGGGAGG - Intergenic
1130117766 15:81020348-81020370 ATGGCTAAGAGCTCTAGTTGGGG + Intronic
1133340386 16:5032145-5032167 ATGGATTTGAGCTCTGTTGGGGG - Intronic
1135082796 16:19450776-19450798 GTGGCTAATGCCTGTGTTGGTGG + Intronic
1135848143 16:25937911-25937933 AGTGTTGAGGGCTCTGTTGGTGG + Intronic
1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG + Intronic
1137261512 16:46833814-46833836 TTACCTAAGGGCTCTGATGGAGG - Intergenic
1137580632 16:49631587-49631609 GTTGCTCAGGGCTGTGTTGGGGG - Intronic
1138389390 16:56658983-56659005 GTGGCTGGAGGCTCTGTTGGGGG + Intronic
1141010079 16:80388935-80388957 AGGGATGAGGGCTCTATTGGAGG - Intergenic
1144758967 17:17696634-17696656 ATGGAGAAGGGCTCTGTCGGGGG - Intronic
1146713556 17:35063944-35063966 TTGGGTAAGGGCTCTGGAGGTGG - Intronic
1147328101 17:39679727-39679749 AGGGCTAGGGGCTCTGATGTAGG - Intronic
1147915261 17:43881874-43881896 TTGGAGAAGGGCTCTGGTGGAGG + Intronic
1150476714 17:65481118-65481140 ATGGCTCTGGGGTTTGTTGGTGG - Intergenic
1151200746 17:72466088-72466110 ATGCCTAGGGGCTGTGTTTGAGG - Intergenic
1152890858 17:82880951-82880973 ATAGCTCTGGGCTCTGTTTGTGG + Intronic
1152939674 17:83161585-83161607 ATGGTTTTGGCCTCTGTTGGAGG + Intergenic
1153355759 18:4133565-4133587 GTGGCTAAGGGCTCTGGTTTTGG + Intronic
1155968080 18:32054649-32054671 CTGCCCAAGGGCTCTGTTGTAGG + Intronic
1156678864 18:39565487-39565509 CTGGCTCAAGGCTTTGTTGGTGG - Intergenic
1158424883 18:57330015-57330037 ATGTCTAGAGCCTCTGTTGGAGG + Intergenic
1160971216 19:1768581-1768603 GTGGCCAAGGTCTGTGTTGGGGG + Intronic
1161587710 19:5114472-5114494 AGGGCTGAGGTCCCTGTTGGTGG - Intronic
1163015425 19:14451417-14451439 ATGGCTGAGGGGTCTGTGGAAGG - Intronic
1164250330 19:23469993-23470015 ATGGCTAATGGCTCAGTAAGAGG - Intergenic
1167513571 19:49909806-49909828 ATGGCTCCGGACTCTGGTGGCGG + Exonic
928876359 2:36044505-36044527 ATTGCAAAAGGCTCTGTAGGGGG + Intergenic
929830606 2:45343789-45343811 CTGGCTCAGGGCTCTGCTGGGGG + Intergenic
934053870 2:88235282-88235304 ATGACCAAGGTCTCTCTTGGAGG + Intergenic
934605555 2:95692584-95692606 ATGGATAAGGGATGTTTTGGGGG - Intergenic
934768714 2:96894748-96894770 ATGGGTAGGGGGTCTGTGGGGGG - Intronic
935623254 2:105146832-105146854 AGGGATAGTGGCTCTGTTGGGGG - Intergenic
935743699 2:106173009-106173031 AAGGCTAAGTGGGCTGTTGGGGG - Intronic
937054911 2:118926541-118926563 AGGGCTAAGGGCTTTGGTGGAGG - Intergenic
938370912 2:130767932-130767954 AGGGCTGAGGGCTCTGAGGGGGG - Exonic
938552256 2:132393306-132393328 ATGTCTAAGGCCTCTGTTAATGG + Intergenic
939479064 2:142726225-142726247 ATAGCTAAGGGCTATGTAGTTGG + Intergenic
940913295 2:159227999-159228021 CTGGAGAAGGGCTCTGTTGCTGG - Intronic
941008008 2:160267169-160267191 ATAGCAAAGGGCTCTGTGAGAGG + Intronic
941939419 2:171018250-171018272 TTGGGTAAGGGCTCTCTTGCTGG - Intronic
944855842 2:203765634-203765656 TTGGCTGAAGGCTCTGTTGTTGG + Intergenic
946625377 2:221606536-221606558 ATGGCAAAGTGCTCTGAAGGAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1171393023 20:24813617-24813639 ATGGCTGAGGGCTCTTCTGCTGG - Intergenic
1172189671 20:33054311-33054333 ATGTCTAAGGCCTCTGTGCGTGG - Intergenic
1173150360 20:40561919-40561941 ATATCTCAAGGCTCTGTTGGTGG - Intergenic
1173330503 20:42072245-42072267 TTGGCTAAGGGCTCTATTCTAGG - Intergenic
1175296113 20:57909864-57909886 AGGGCTCAGGGCTCTGTCGCTGG + Intergenic
1175763374 20:61576274-61576296 AGGGTTAATGGCTCTGCTGGTGG - Intronic
1178236997 21:30854546-30854568 ATGGCTATGACCTCTGCTGGAGG - Intergenic
1178829827 21:36046592-36046614 ATTGCTAAAAGCTCTATTGGAGG + Intronic
1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG + Intronic
1180187205 21:46145742-46145764 AGGGGGAAGGGCGCTGTTGGGGG - Intronic
1180994675 22:19959592-19959614 AGGGGCCAGGGCTCTGTTGGTGG + Intronic
1183094609 22:35544513-35544535 ATGGCAAAGGGCTCTGTCTTTGG - Intronic
1183248245 22:36710313-36710335 GTGGCTCAGGACTCTCTTGGGGG - Intergenic
1183945887 22:41325470-41325492 ATGGCTGAGGTCTGAGTTGGAGG + Intronic
1184098617 22:42329873-42329895 ATGGCTGTGGGCTCAGTGGGAGG + Intronic
1184474374 22:44712569-44712591 GTGGCTAAGTCCTCTGCTGGAGG - Intronic
1184553473 22:45218656-45218678 AAGGATATGGGCTCTGTTGGAGG - Intronic
1185015257 22:48339117-48339139 ATGGCTGTGGGCTGTGTTTGTGG + Intergenic
950892917 3:16420772-16420794 ATGGCTAATGGCTGTGTTACAGG + Intronic
951844939 3:27075413-27075435 AAAGCTAAGGGCTTTGTGGGTGG + Intergenic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
953840082 3:46383065-46383087 ATGTCTAAGTGCACTGTTTGGGG - Intergenic
954670587 3:52289370-52289392 ATGGCTATGGGCTCAGTTATGGG + Intronic
954675485 3:52313191-52313213 ATGGCTGGGGGCCCTGTTGATGG + Intergenic
954960701 3:54562357-54562379 ATGGAATAGGGCTGTGTTGGTGG + Intronic
959324290 3:104917155-104917177 ATGGGTTATGGCTCTGTTGTTGG - Intergenic
961557623 3:127707355-127707377 ATGGCCAAGGACGCTGTGGGAGG - Intronic
964855787 3:161143960-161143982 ATGGCTAATGGCTGTGATGGGGG + Intronic
965608575 3:170521055-170521077 ATGGCTATGGGGTCTGGTTGTGG + Intronic
974298647 4:60036531-60036553 AGAGCCAAGAGCTCTGTTGGAGG - Intergenic
980603929 4:135064486-135064508 ATGGCTTAGGGCTCTCTCTGGGG - Intergenic
982038727 4:151373552-151373574 ATGGCTTAGTGCTGTCTTGGTGG - Intergenic
985614307 5:910386-910408 ATAGCTCAGGGTTCTGTGGGGGG + Intronic
991215991 5:64157851-64157873 AGGGTTAAGGGCACTGTTAGTGG - Intergenic
995380959 5:111532684-111532706 CTGGCTAACTGTTCTGTTGGTGG + Intergenic
996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG + Intronic
997614978 5:135240109-135240131 CTGGCTGAGGGCTGTGTGGGCGG - Intronic
997945986 5:138201939-138201961 ATAGCTGAGGGCTGTCTTGGGGG - Intronic
998012563 5:138707235-138707257 CTGGCTGAGGGCTCTGCAGGAGG + Intronic
998039416 5:138943102-138943124 AGAGCTCAGGGCTCTGCTGGCGG - Intergenic
1001972427 5:175967578-175967600 GTGGCTAGGGGCTGTGGTGGTGG - Intronic
1002245011 5:177876202-177876224 GTGGCTAGGGGCTGTGGTGGTGG + Intergenic
1002586687 5:180253101-180253123 CTGGCTGACGGCTCTGTGGGAGG - Intronic
1007833414 6:44655994-44656016 ATGGAAAACGGCTCTCTTGGAGG - Intergenic
1009356952 6:62761818-62761840 ATGGCTTTGGGCTGTGTTGCAGG - Intergenic
1011488121 6:87864355-87864377 AAGGCTATGGTCTCAGTTGGAGG + Intergenic
1021963632 7:25895983-25896005 TTGGCCAAGGACTCTGGTGGAGG - Intergenic
1029737239 7:102471776-102471798 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1029737260 7:102471837-102471859 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1030779642 7:113584307-113584329 TGGTCTAAGGGGTCTGTTGGTGG + Intergenic
1039098110 8:33908643-33908665 ATGGCTCAGGGCTGAGTTGCAGG + Intergenic
1039464574 8:37775353-37775375 ATGGCTATGGTCTCTGAAGGTGG - Exonic
1039944386 8:42117249-42117271 ATGGCTATGGGGACTGTTGGCGG - Intergenic
1040286402 8:46102704-46102726 ATGGAAAAGGCCTCTTTTGGAGG + Intergenic
1050144441 9:2551271-2551293 ATGGGTTATGGCGCTGTTGGTGG + Intergenic
1053304808 9:36976863-36976885 ATGGCAAAGGGATCTGTCAGGGG + Intronic
1056476905 9:86961551-86961573 ATGGCAAAGCGCAATGTTGGTGG + Intergenic
1056606412 9:88089439-88089461 CTGGAGAAGGGCCCTGTTGGTGG + Intergenic
1060248259 9:121964721-121964743 AAGGCACAAGGCTCTGTTGGGGG - Intronic
1060438148 9:123613941-123613963 AAGGAAAAGGGCTCTGTTGCTGG + Intronic
1186507946 X:10109198-10109220 ATGGCCAGGGGCTCTGGTGCAGG + Intronic
1189002566 X:36962398-36962420 ATGGCTCAGGGAACTGTTGGAGG - Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1196457026 X:115898233-115898255 GTGGCCATTGGCTCTGTTGGTGG - Intergenic
1196464370 X:115958053-115958075 ATGGCTCAGGAGTCTGGTGGTGG - Intergenic
1198078553 X:133217244-133217266 ATGGCTCAGGGAACTTTTGGAGG - Exonic
1200102366 X:153694454-153694476 ATGGCTGAGGGCTGGGCTGGGGG + Intronic
1202194783 Y:22288833-22288855 TTGGCTTAGGACACTGTTGGTGG + Intergenic