ID: 1179929846

View in Genome Browser
Species Human (GRCh38)
Location 21:44559955-44559977
Sequence GGCTCTGTTGGAGGACTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179929838_1179929846 27 Left 1179929838 21:44559905-44559927 CCATAGGCTGCAGGGTTTGAAGC 0: 1
1: 1
2: 1
3: 8
4: 135
Right 1179929846 21:44559955-44559977 GGCTCTGTTGGAGGACTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 101
1179929839_1179929846 5 Left 1179929839 21:44559927-44559949 CCTCTGACCTTTGATGAGTATGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1179929846 21:44559955-44559977 GGCTCTGTTGGAGGACTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 101
1179929837_1179929846 28 Left 1179929837 21:44559904-44559926 CCCATAGGCTGCAGGGTTTGAAG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1179929846 21:44559955-44559977 GGCTCTGTTGGAGGACTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 101
1179929842_1179929846 -2 Left 1179929842 21:44559934-44559956 CCTTTGATGAGTATGGCTAAGGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1179929846 21:44559955-44559977 GGCTCTGTTGGAGGACTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179929846 Original CRISPR GGCTCTGTTGGAGGACTACC TGG Intronic
900086758 1:902285-902307 GGCTCTGTTGGGAGACACCCAGG - Intergenic
901185887 1:7372944-7372966 GGCACTGTGGAAGCACTACCTGG - Intronic
901844476 1:11973131-11973153 GGGTCTGTGGGAGGGCTTCCTGG + Intronic
903069901 1:20721944-20721966 GGCTCTGGTGGAGAACCACGCGG - Exonic
903417544 1:23194163-23194185 GGATCTGTTGGAGGCCTCCTGGG + Exonic
903608900 1:24595593-24595615 GGCTCTGGAGGTGGACTGCCTGG + Intronic
906841483 1:49144290-49144312 GGCTATGTTGGAGGACTCTAGGG + Intronic
908688607 1:66752425-66752447 GGCTCTGTTTGAGGTCACCCTGG + Intergenic
910125965 1:83842876-83842898 GGCACTGTTGCAGGACTCTCAGG - Intergenic
913233415 1:116760823-116760845 TGCTCAGTGGGAGGACTCCCAGG - Intronic
920665257 1:207958958-207958980 GCCTCTGCTGGAGGTCTGCCTGG + Intergenic
1063864164 10:10345724-10345746 GGCTCTCTTTCAGGACAACCCGG + Intergenic
1069897226 10:71687317-71687339 GGCTCAGCTGGAGGACCAGCGGG + Intronic
1070825534 10:79388359-79388381 GGAGCTGTTGGAGGTCTCCCTGG - Intronic
1074430575 10:113390738-113390760 GTGTCTCTTTGAGGACTACCAGG + Intergenic
1081873776 11:46395427-46395449 GTCTCTGTTGGAGCAGAACCTGG + Intergenic
1090599401 11:128354885-128354907 GGCTCTGCTGGAGAAAGACCAGG - Intergenic
1100817794 12:98402600-98402622 GTCTCTGTTTGTGGTCTACCTGG + Intergenic
1120900293 14:89569524-89569546 GGCTACTTTGGAGGTCTACCTGG + Intronic
1125319708 15:38472085-38472107 GGCTCTGGAGGTTGACTACCTGG - Intronic
1126047413 15:44655191-44655213 GGCTGAGTTGGAGGACTGCTTGG + Intronic
1134864524 16:17592906-17592928 TTCTCTGTTGGATGACTACAGGG - Intergenic
1135108749 16:19673751-19673773 GGCTTGGGTGGAGGACTCCCAGG - Intronic
1138658171 16:58502397-58502419 GGCTCTCCTGGAGGACAACAGGG + Intronic
1144181975 17:12760813-12760835 GGCTCTCCCTGAGGACTACCTGG - Intronic
1145308474 17:21688525-21688547 GGCTCTGTGGCAGGACCTCCGGG + Intergenic
1147372292 17:40001164-40001186 GGCTCTGATGGAGGGATACCAGG + Intergenic
1147439108 17:40436643-40436665 AGCCCTTTTGGAGGACTCCCTGG + Intergenic
1151315716 17:73321064-73321086 TGCTTTGCTGGAGGACTCCCAGG - Intergenic
1160385913 18:78496194-78496216 GCCGCTGTGGGAGGACTCCCCGG - Intergenic
1162348350 19:10134385-10134407 TGCTCAGATGGAGGACAACCTGG + Intronic
1163773723 19:19205898-19205920 GGCACTGTTGGAGGACTCTCTGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167646788 19:50710352-50710374 GGCTGTTTTGGAAGACTTCCTGG + Intronic
927078137 2:19600872-19600894 GGCTCTCTTGGAGGATAACTGGG - Intergenic
928555387 2:32418448-32418470 TGCTCTGATGGAAGACTCCCAGG - Intronic
929542473 2:42833021-42833043 GGCTCTGAGGCCGGACTACCTGG - Intergenic
932126421 2:69149239-69149261 GGCTGTGGTGGAGGACAGCCGGG - Intronic
935491431 2:103725182-103725204 GTATCTGTTTGAGGACTTCCCGG + Intergenic
936147009 2:109986879-109986901 GGCGCTGCTGGAGCACCACCTGG - Intergenic
936197683 2:110384604-110384626 GGCGCTGCTGGAGCACCACCTGG + Intergenic
937462050 2:122097954-122097976 GGCTCTGATGTAGGTCTCCCAGG + Intergenic
940013676 2:149081101-149081123 GGCTCTGTCAGAGGACTGCTGGG + Intronic
941625194 2:167823663-167823685 AGCACTGTTAGAGGACTGCCTGG - Intergenic
948945280 2:241216210-241216232 GGGTCTGTTTGACGAGTACCTGG + Exonic
1170048146 20:12109517-12109539 GGCTGTGTAGGAGAACCACCTGG - Intergenic
1173250650 20:41362656-41362678 GGCCCTGCTGGAGGAGTACGTGG - Exonic
1176005070 20:62857196-62857218 GGCTCACTAGGAGGACTCCCGGG - Intronic
1178583946 21:33857633-33857655 GCCGCTGTTGGAGGAGTACAGGG + Intronic
1179600752 21:42475997-42476019 GGCTCTGCTGGAGGGCTTCGAGG - Exonic
1179929846 21:44559955-44559977 GGCTCTGTTGGAGGACTACCTGG + Intronic
1183276403 22:36900850-36900872 GGCTCTGTGGGAGGCATCCCGGG - Intergenic
1184195925 22:42927972-42927994 GGCTCCGCCTGAGGACTACCTGG - Intronic
949900878 3:8813952-8813974 GGCTCTGTGGGAGGAATATAGGG - Intronic
950184526 3:10937004-10937026 GGCTCGGGTTGTGGACTACCTGG - Intronic
954395589 3:50291808-50291830 GGCTCTGTTGGGAAGCTACCTGG - Intronic
957041780 3:75341354-75341376 GCCTTTGATGGAGGGCTACCAGG + Intergenic
961545563 3:127630295-127630317 GGTGCTGCTGGAGGAATACCCGG + Intronic
961951796 3:130757271-130757293 GGCTGTGGTGGAGGCCTAGCTGG + Intergenic
964345675 3:155752241-155752263 GGCTCTGTGGGAGGTCTTTCTGG - Intergenic
964767724 3:160194945-160194967 GACTCTATTTGAGAACTACCTGG - Intergenic
967900015 3:194440295-194440317 GTCTCTGGAGGAGGACTCCCTGG - Intronic
968641594 4:1717590-1717612 GGCTCTGGTGGATGACCACATGG + Exonic
969473197 4:7401959-7401981 GGCTCTGTTTCATGAGTACCTGG - Intronic
971395883 4:26227002-26227024 GGCTCTTTTGTATGACTCCCAGG + Intronic
983113317 4:163780943-163780965 GGCTCTGATGGAAAATTACCAGG - Intronic
985484385 5:140451-140473 GGGTCTGTTGGGGGTCTCCCCGG - Exonic
989558383 5:42823621-42823643 GCCTCTGTTTGAACACTACCAGG + Intronic
990863800 5:60358106-60358128 GGCTCTGTTGCCAGACTGCCTGG - Intronic
995221544 5:109654187-109654209 GGCTCTGGAGTAGGACTATCTGG + Intergenic
1002195860 5:177501005-177501027 CTCTCTGCTGGAGGACTGCCAGG - Intergenic
1005813893 6:29535082-29535104 GGCTCTGTGGGAAGGGTACCTGG + Intergenic
1006278171 6:33022671-33022693 GGATCTGTTGGAGCCATACCTGG - Intergenic
1007375557 6:41453761-41453783 GGCGCTGTTGGAGGAATGGCCGG - Intergenic
1007418163 6:41704165-41704187 GGCTCTGTTGGGGAACTGCAAGG - Intronic
1008569248 6:52799410-52799432 GACTGTGTTGGAGGAGTTCCTGG + Intronic
1012242374 6:96888259-96888281 GGCACTGTTGGAGGACTTAAAGG - Intergenic
1018020437 6:159758369-159758391 CTCTCTGTATGAGGACTACCAGG - Intronic
1018303536 6:162429461-162429483 GGCTGTGGTGCAGGACTCCCAGG - Intronic
1019643037 7:2115020-2115042 GGCTCTGATGCAGGTCTCCCAGG - Intronic
1021534551 7:21688588-21688610 GGCTCTACTGGAGGTCTCCCAGG + Intronic
1024942290 7:54775452-54775474 GGCTGCTTTTGAGGACTACCAGG + Intergenic
1026111653 7:67463245-67463267 GGATCTCATGGAGGAATACCTGG + Intergenic
1029451422 7:100643395-100643417 GGGCCTGTTGGAGGATTCCCAGG - Intronic
1029968966 7:104770677-104770699 GGCTCTGGTGGAAGAGTGCCAGG - Intronic
1033297785 7:140156839-140156861 GGCTCTGTGGGAGCCCCACCCGG - Intronic
1037315691 8:17596984-17597006 GGCTTTGTTGGATGAACACCTGG - Intronic
1039587322 8:38718188-38718210 GGCTCTGCAGAAGGACTACCGGG + Intergenic
1045336794 8:101211973-101211995 GGATTTGTTGCAGGATTACCTGG - Intergenic
1049784446 8:144443893-144443915 GGCCGAGATGGAGGACTACCCGG - Exonic
1052614474 9:30820989-30821011 GGCCATGTTGGAGAACTTCCTGG + Intergenic
1053577272 9:39365200-39365222 GTCTCTGTGGGAGGACTCCATGG - Intergenic
1053841772 9:42193125-42193147 GTCTCTGTGGGAGGACTCCATGG - Intergenic
1054098843 9:60923890-60923912 GTCTCTGTGGGAGGACTCCATGG - Intergenic
1054120243 9:61199519-61199541 GTCTCTGTGGGAGGACTCCATGG - Intergenic
1054587511 9:66983043-66983065 GTCTCTGTGGGAGGACTCCATGG + Intergenic
1057757379 9:97848870-97848892 GGCTCTGTGGGAGGGCTTGCGGG + Intergenic
1057792076 9:98131023-98131045 GCCTCTGATGGAGGAGGACCTGG - Exonic
1058334998 9:103815850-103815872 GACTCTATTGGAGAACAACCAGG - Intergenic
1062334920 9:136060882-136060904 GGCTGTGTTGGGGGGCTTCCTGG - Intronic
1062377483 9:136268912-136268934 GGCTGAGCTGGAGGACTCCCTGG + Intergenic
1062592184 9:137279205-137279227 GGCGCTGATGCGGGACTACCTGG + Exonic
1185628672 X:1500680-1500702 GGCTAGGTTGGAGGATCACCTGG - Intronic
1192192109 X:68997217-68997239 GGCTCTGGTGTACGGCTACCTGG + Intergenic
1201927548 Y:19304740-19304762 GGCTCTGTGGGTGGGCTGCCAGG + Intergenic