ID: 1179932298

View in Genome Browser
Species Human (GRCh38)
Location 21:44578887-44578909
Sequence CTGAAAGCCCATGCGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179932291_1179932298 13 Left 1179932291 21:44578851-44578873 CCTGACGCACGGTCCTGCAGGTG 0: 1
1: 0
2: 0
3: 4
4: 133
Right 1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1179932288_1179932298 24 Left 1179932288 21:44578840-44578862 CCTAAGAGGGGCCTGACGCACGG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1179932295_1179932298 0 Left 1179932295 21:44578864-44578886 CCTGCAGGTGCGGACTCTGGGTC 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1179932287_1179932298 29 Left 1179932287 21:44578835-44578857 CCTCACCTAAGAGGGGCCTGACG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179932298 Original CRISPR CTGAAAGCCCATGCGGAACC TGG Intronic
900853242 1:5160457-5160479 CTGAAAACCCATCCGGAGCAAGG - Intergenic
903391292 1:22965228-22965250 CTCAAAGCCCAGGAGGACCCAGG + Intronic
908247348 1:62238296-62238318 CTGAGAGCCCACGCGGAGCAGGG - Exonic
908798924 1:67858883-67858905 CTGAGAGCCCCTGCTGAACCAGG + Intergenic
921049961 1:211504265-211504287 CTGAGATCCCATGCAGATCCTGG - Intergenic
1064296750 10:14085578-14085600 CTCAAAGCCCATGGGGATGCTGG + Intronic
1069818214 10:71212118-71212140 CTGTAAGCCCCCGCGTAACCAGG + Intergenic
1070693339 10:78543680-78543702 CTATAAGCCCAGGGGGAACCCGG + Intergenic
1071291047 10:84189391-84189413 CTGAAAATCCATGCTGAACCAGG - Intergenic
1076486780 10:130825606-130825628 CTGAAAGCCTCTGCTGGACCTGG - Intergenic
1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG + Intronic
1087143761 11:94791661-94791683 CAGAAAGCCCCTGCAGAGCCTGG - Intronic
1088357738 11:108960971-108960993 CAGACAGCCCATGCTGAAGCCGG - Intergenic
1099073496 12:78076231-78076253 CTGAAATCCCATACTCAACCTGG + Intronic
1103023206 12:117553333-117553355 CTGAAAGCCCATGCAAAATTTGG - Intronic
1109122156 13:58471018-58471040 CTGAAAGGTCATCCGGTACCAGG - Intergenic
1111105024 13:83633965-83633987 CTGGAAGCCCATGAGAAACATGG - Intergenic
1114633060 14:24171989-24172011 CTGACAGCCAATGGGGAACGGGG - Exonic
1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG + Intronic
1127461166 15:59200496-59200518 CTGAAAGCCCAGGCTGGACTCGG + Intronic
1128682386 15:69661492-69661514 CTTAAAGACCATGCTCAACCTGG - Intergenic
1128726453 15:69991711-69991733 CTGAAAGGCCCTGGGGAGCCAGG - Intergenic
1133768999 16:8856899-8856921 CTGAAAACCCTTGGGGAGCCGGG - Intronic
1139775127 16:69311847-69311869 CTGAACGCCCAGCCGGACCCCGG - Intronic
1140668495 16:77250227-77250249 CTGAAAACCCATGCTGATACTGG - Intronic
1142024036 16:87802942-87802964 CTCATAGCCCATGCAGCACCAGG + Intergenic
1143036283 17:4001115-4001137 CTGAAAACCCAGGTGGAAGCAGG + Intergenic
1143511223 17:7396191-7396213 CTAAAAGGCCATGCGTGACCTGG - Intronic
1144856446 17:18270993-18271015 CTGAGAGCCCATGGGGTAACTGG - Intergenic
1152147361 17:78576525-78576547 CTGAAAGCCCTGTGGGAACCTGG - Intronic
1157576639 18:48748206-48748228 CAGAAAGCCCATCCAGGACCAGG - Intronic
1158305143 18:56097112-56097134 CTGAAAGACCAAGCTGATCCAGG - Intergenic
1158819407 18:61142053-61142075 ATGAAAGCCCAAGAGAAACCAGG + Intergenic
1163545114 19:17936683-17936705 CTGAAAGGCCAGGAGGGACCAGG + Intronic
1164542358 19:29130300-29130322 CTTAATGCCCATGGGGAAACTGG + Intergenic
1165933467 19:39375191-39375213 CTAAAAGGCCATGCAGGACCTGG - Intronic
1166254990 19:41597605-41597627 CGGAAAGCACAAGCGGAGCCTGG - Intronic
925375123 2:3378674-3378696 CTGGAAGCCCCGGTGGAACCAGG - Intergenic
925405988 2:3605660-3605682 CTGAAGGCCCAAGCGGACCGCGG - Intronic
928166771 2:28977629-28977651 CTCAACACCCATGTGGAACCTGG + Intronic
928909245 2:36402056-36402078 CTGAAGGTCCATGGGGAGCCTGG + Intronic
928909550 2:36405426-36405448 CTGAAGGTCCATGGGGAGCCTGG + Intronic
929184365 2:39078494-39078516 CTCAAACCCCATTAGGAACCAGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933770554 2:85741516-85741538 CTGAGAGAGCATGCGGGACCTGG - Intergenic
937820980 2:126310423-126310445 CTAAAAAACCATGCAGAACCTGG + Intergenic
948894250 2:240920976-240920998 CTGACATGCCATGCAGAACCAGG - Intronic
1172883005 20:38213717-38213739 CTGACAGTCCATGTGGAACCAGG + Exonic
1179127682 21:38605298-38605320 CTGAATGCCCATGCTGTTCCTGG + Intronic
1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG + Intronic
1183776351 22:39968683-39968705 CTGAAATCCCATCGGGAACAAGG - Intronic
1184816551 22:46876192-46876214 CTGAAAGCACAGGCAGAATCTGG - Intronic
958727192 3:97920423-97920445 CTGAAGACCCATGTGGAATCTGG - Intronic
968518857 4:1026721-1026743 CTGAAAGACCAGGCGGGTCCCGG - Exonic
969313438 4:6367565-6367587 CTGAGACCCCATGCGGAGCTGGG - Intronic
971363502 4:25957807-25957829 TTCAAAGCCCATCAGGAACCAGG + Intergenic
981241740 4:142485036-142485058 CTAAAATCCCATGCAGAACAGGG - Intronic
983709775 4:170699525-170699547 TTGAAAACCCATTCTGAACCAGG + Intergenic
991286651 5:64984334-64984356 TTGAAAGCCCATTATGAACCAGG - Intronic
1003501538 6:6707254-6707276 CCTCAAGCCCATGCGGAAGCAGG + Intergenic
1005233156 6:23727975-23727997 CTGAAAGCCTATTCGCCACCTGG + Intergenic
1006839769 6:37021397-37021419 CTGAAAGCCCACTGGGTACCAGG - Intronic
1007620908 6:43213862-43213884 CTCAAAGCCCATGGGGAAAAGGG + Exonic
1017423883 6:154300721-154300743 TTCAAAGCCCATGGGGAATCTGG - Intronic
1017766005 6:157607859-157607881 CAGAAAGCCCATGCGGAGCTTGG - Intronic
1020955722 7:14738214-14738236 ATGAAGGCCCATGAGGAACCAGG + Intronic
1024517413 7:50270695-50270717 CTGAGAGCCAATGAGGAAACAGG + Intergenic
1024988340 7:55214555-55214577 CTGAAAACCCAACAGGAACCTGG + Intronic
1029211080 7:98908869-98908891 CTGCAAGCTCCTGCTGAACCTGG + Exonic
1035889670 8:3329692-3329714 CTGCAGGCCCATGCGGCCCCGGG - Intronic
1038151739 8:24947631-24947653 CTACAAGCCCATGCATAACCAGG + Intergenic
1041072235 8:54136584-54136606 CTCAAAGCCCAAGCGGGGCCGGG - Exonic
1044736691 8:95286108-95286130 CTGAAAGACCATGTGGAGCAGGG + Intergenic
1045779044 8:105842202-105842224 CTGAAAGATCATGAAGAACCTGG + Intergenic
1049649898 8:143761042-143761064 CTGAAGACCCATCCTGAACCAGG + Intergenic
1049746375 8:144264963-144264985 CTACAAGCCCCTGCGGACCCGGG - Exonic
1052613533 9:30808505-30808527 CTAAAAACGTATGCGGAACCTGG - Intergenic
1054160581 9:61670010-61670032 ATGAAACCCCAGGCGGAAACGGG - Intergenic
1061847348 9:133395130-133395152 CTGGGAGACCATGGGGAACCTGG - Intronic
1186006193 X:5075160-5075182 CTGAAAGCCTTTGCAGAATCTGG - Intergenic
1190016641 X:46833108-46833130 CAGAAAGGCCATGAGGAATCAGG + Intergenic
1197329930 X:125141232-125141254 CTGAAAGCCCATGCAGAGTTAGG + Intergenic
1200241525 X:154497395-154497417 CTAATAGCACATGCTGAACCTGG - Intergenic