ID: 1179932969

View in Genome Browser
Species Human (GRCh38)
Location 21:44583157-44583179
Sequence CTTAAATCAAGCAGACACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179932967_1179932969 -3 Left 1179932967 21:44583137-44583159 CCGGCCAGATCACATCATTTCTT 0: 1
1: 0
2: 1
3: 25
4: 275
Right 1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG 0: 2
1: 0
2: 0
3: 17
4: 155
1179932966_1179932969 -2 Left 1179932966 21:44583136-44583158 CCCGGCCAGATCACATCATTTCT 0: 1
1: 0
2: 4
3: 56
4: 380
Right 1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG 0: 2
1: 0
2: 0
3: 17
4: 155
1179932965_1179932969 6 Left 1179932965 21:44583128-44583150 CCACTGCACCCGGCCAGATCACA 0: 1
1: 6
2: 65
3: 629
4: 3313
Right 1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG 0: 2
1: 0
2: 0
3: 17
4: 155
1179932968_1179932969 -7 Left 1179932968 21:44583141-44583163 CCAGATCACATCATTTCTTAAAT 0: 1
1: 0
2: 4
3: 28
4: 354
Right 1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG 0: 2
1: 0
2: 0
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179932969 Original CRISPR CTTAAATCAAGCAGACACTC TGG Intronic
903541138 1:24097056-24097078 CATAAAGCAGGTAGACACTCAGG - Intronic
908363074 1:63389411-63389433 TTAAAATCAAGCAGAAATTCTGG - Intronic
909236879 1:73164177-73164199 CAGAAATCAAGCAGACCCTGAGG - Intergenic
910191714 1:84602032-84602054 ATTTAATGAATCAGACACTCTGG + Intergenic
910733281 1:90422070-90422092 TTAAAATCAAGCAGAAATTCTGG + Intergenic
912959000 1:114178514-114178536 CATAGAACAAGCAGAGACTCAGG + Intergenic
916994749 1:170284527-170284549 CTTTTATCAAGCAGACACTGTGG - Intergenic
917673176 1:177293389-177293411 CTTATATCAGGAAGCCACTCCGG + Intergenic
921542317 1:216431348-216431370 CTTAAATTATGCAAACTCTCAGG + Intergenic
921795583 1:219340316-219340338 GTTAAATCAAGAAGAGACTGTGG - Intergenic
923980459 1:239316324-239316346 TTTTAATCAAGCAGATATTCTGG + Intergenic
1063290623 10:4743454-4743476 CTCAATTAAAGCAGACAATCTGG - Intergenic
1063822075 10:9847269-9847291 CTGAAATGCAGTAGACACTCAGG + Intergenic
1064239690 10:13614988-13615010 CGTAAATCATCCAGTCACTCAGG - Intronic
1065119557 10:22515379-22515401 CTTTAAGCAAGAGGACACTCAGG + Intergenic
1065787829 10:29232571-29232593 CTAAAATTAAGCAGACACGGTGG + Intergenic
1067970784 10:50968116-50968138 CTCAACTCAAGCAGTCAGTCAGG - Intergenic
1069115222 10:64496747-64496769 TAAAAATCAAGCAGAAACTCCGG - Intergenic
1069434063 10:68364646-68364668 CTAAAACCAAGCAGACATTGGGG + Intronic
1071073815 10:81728160-81728182 CTTAAATCAATAAGACACCTTGG - Intergenic
1074329376 10:112489308-112489330 ATTAAATAAAGCAGAGATTCAGG - Intronic
1074902167 10:117827560-117827582 CTTTCATCAAGAAGACCCTCAGG - Intergenic
1076094785 10:127722187-127722209 TAAAAATCAAGCAGAAACTCTGG + Intergenic
1078803233 11:14668701-14668723 CTTGAATAAAGCAGACAGACAGG - Intronic
1079375742 11:19890288-19890310 CTTAAATCAGGTAGGCAGTCTGG - Intronic
1079429149 11:20371823-20371845 ATAAAATCAAGCAGATACTGAGG - Intronic
1079565843 11:21880903-21880925 TTTAAATCAAGCAGAAATTCTGG + Intergenic
1079891655 11:26063361-26063383 CTTCAATCTAGCAGTGACTCTGG - Intergenic
1082721335 11:56680535-56680557 ACTAAATCAAGCAGAAATTCTGG + Intergenic
1083987723 11:66227563-66227585 CTTGACTGAAACAGACACTCTGG + Exonic
1084474721 11:69382192-69382214 TTTCAAGCAAGCAGATACTCAGG + Intergenic
1084913354 11:72409082-72409104 CTTAATTCAGGCTGCCACTCAGG + Intronic
1086603991 11:88672356-88672378 CCTAAATCAAGCTTATACTCTGG + Intronic
1087890741 11:103535323-103535345 GTTACATAAAGCAGACACACTGG + Intergenic
1088009934 11:104987321-104987343 AATGAATCAAGCAGAAACTCTGG + Intergenic
1088601617 11:111483546-111483568 TTTAAATCAAGCAAAAATTCTGG + Intronic
1088962053 11:114678523-114678545 CTTTAATCAAGGAGAGTCTCTGG + Exonic
1089310195 11:117552878-117552900 CTTGTAGTAAGCAGACACTCGGG - Intronic
1090599733 11:128357943-128357965 ATTTAGTGAAGCAGACACTCAGG - Intergenic
1090602253 11:128385436-128385458 ATACAATCAAGCTGACACTCAGG + Intergenic
1090916265 11:131165732-131165754 ATTAAATCAATCAGAATCTCAGG + Intergenic
1095807978 12:46342296-46342318 TTAAAATCAAGAAGAAACTCTGG - Intergenic
1098496755 12:71144505-71144527 CTAAAATCTAGCAGAAACACAGG - Intronic
1100127514 12:91446703-91446725 CTAAAAACAACCAGACACTATGG + Intergenic
1103705041 12:122866984-122867006 CTAAAATCAGACAGACACGCTGG + Exonic
1104946377 12:132416673-132416695 CTCAAATCCAGCAGACCCTGAGG + Intergenic
1106366701 13:29088390-29088412 CTAAGATCAACCACACACTCAGG - Intronic
1106650189 13:31682121-31682143 CTTGAATCAAGCTGATATTCTGG - Intergenic
1108390196 13:49939968-49939990 CTAAATTCAAACAGACATTCTGG + Intergenic
1108421055 13:50250029-50250051 TTTAAATAAAGCAGAGAATCAGG - Intronic
1109519668 13:63492743-63492765 TTTAAATAAAGCAGACACACTGG - Intergenic
1109660488 13:65452440-65452462 TTTAAATCAAGCAAAAACCCAGG - Intergenic
1109981489 13:69913817-69913839 ATCTAATCAAGCTGACACTCAGG - Intronic
1110280858 13:73692966-73692988 TTTAAACCAAGCTGTCACTCAGG + Exonic
1111876253 13:93900123-93900145 CTTAAATCATACAGATAGTCCGG - Intronic
1113244075 13:108375776-108375798 TTTAAATCAAGCACAAATTCTGG - Intergenic
1115224079 14:31085459-31085481 TTTAAATCAAGAAAACATTCCGG - Exonic
1115931641 14:38503435-38503457 CTTAAATAAATCATACACACAGG + Intergenic
1116877035 14:50122335-50122357 TTTAAATCAAGCTGATAATCTGG + Intronic
1119041662 14:71279924-71279946 CATGAATAAAGCAGAAACTCTGG - Intergenic
1121759592 14:96433880-96433902 TAAAAATCAAGCAGAAACTCCGG - Intronic
1122219681 14:100229223-100229245 CTTAAAGGAATCAGACTCTCTGG - Intergenic
1124618297 15:31258584-31258606 ATTAAATGACGCAGACACTTTGG + Intergenic
1127504333 15:59583183-59583205 CTCAGAACAAGCAGAGACTCAGG - Intergenic
1127736823 15:61848768-61848790 TTTAAATTAAGCAGCCACTCTGG - Intergenic
1131855925 15:96594229-96594251 CTGAAATGAAGCTGTCACTCAGG - Intergenic
1137463183 16:48684538-48684560 CCTAAATGAAGCAAACTCTCTGG - Intergenic
1143945661 17:10589873-10589895 CTTTCATCATGCCGACACTCAGG + Intergenic
1147395067 17:40136167-40136189 CTGAAATCAAGAAGAAACTGAGG - Intronic
1148668818 17:49394897-49394919 CTTAAACCAAGAAGGCTCTCAGG - Intronic
1148918771 17:51009997-51010019 CTTAAATGAAGCACAAACTTAGG + Intronic
1151392342 17:73795813-73795835 CTGGAATCCAGCAGACACTGGGG - Intergenic
1153487458 18:5614359-5614381 CATGAATCAAGCAGAAACTTGGG - Intronic
1156288762 18:35725593-35725615 CTTAAAGACAGCAGACACTTGGG - Intergenic
1157326361 18:46671667-46671689 CTTAATTCAGGCAGACTCTGAGG + Intronic
1158117029 18:54006661-54006683 TTTTAATCAAGCAGAAATTCTGG + Intergenic
1160216233 18:76934588-76934610 CTTAAATCTAGAAGAAACTAAGG - Intronic
1160617734 18:80146339-80146361 CTGAAACAAAGCAGACACACAGG - Intronic
1164710082 19:30349716-30349738 CTTAAATCAAGCAGAGTAACAGG - Intronic
1166496543 19:43306945-43306967 TTTAAAGCAAGCAAACACTGGGG - Intergenic
1166628415 19:44382788-44382810 CTTAACTAAAGCAGACAATCTGG + Exonic
927876977 2:26664082-26664104 CCTAAATAAAGAAGACACACAGG - Intergenic
928020182 2:27698460-27698482 CCTAAATTAAGCAGAGACTGAGG + Intergenic
928312778 2:30224201-30224223 CTGGAATCTAGCAGGCACTCAGG - Intergenic
928559046 2:32459683-32459705 CTTAAATCCAGAATACACACTGG + Intronic
928695980 2:33850697-33850719 CTAAATTCCAGCAGTCACTCCGG - Intergenic
929289676 2:40175718-40175740 CTTAAATCACCCAGGAACTCAGG + Intronic
930041358 2:47127659-47127681 AAAAAATCAAGCAGATACTCTGG - Intronic
932387816 2:71353843-71353865 TTTACATCAAACAGACACACTGG - Intronic
935356437 2:102206068-102206090 TTTAAATCAAGCAGAAATTCTGG - Intronic
935715875 2:105938504-105938526 CTTAATCCATGCAGTCACTCAGG - Intergenic
938426806 2:131199325-131199347 CTTAGATCAAGCTGAAACTTTGG + Intronic
938545180 2:132322409-132322431 CTTAACTAAAGCAGACAATCTGG - Intergenic
940503619 2:154526235-154526257 TTTAAAAGAAGCAGAAACTCTGG - Intergenic
940930997 2:159430862-159430884 CTTACTTCAAGCCCACACTCTGG - Exonic
941017177 2:160370513-160370535 CTTAATTCAATCAGACAGGCAGG + Intronic
943208040 2:184926836-184926858 ATTAAAGCAAGCAGAAATTCTGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1171874033 20:30555192-30555214 CTTAACTAAAGCAGACAATCTGG - Intergenic
1172449672 20:35013118-35013140 AATAACACAAGCAGACACTCTGG + Intronic
1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG + Intronic
1179941763 21:44644121-44644143 CTTAAATCAAGCAGACACTCTGG - Intronic
1183007956 22:34918959-34918981 CTGGAAGGAAGCAGACACTCCGG + Intergenic
1184638528 22:45855984-45856006 CTTTACTGAAACAGACACTCTGG - Intergenic
949420306 3:3858214-3858236 CTTAAATCAAGGAGGCTCTCTGG - Intronic
954006012 3:47591107-47591129 CTAAAATAAAGCACTCACTCTGG + Intronic
955212172 3:56952400-56952422 CTGAAATCAAGCTGTCAGTCAGG - Intronic
955242921 3:57195931-57195953 CCTAAACCAAGCAGACGTTCAGG + Intergenic
956379863 3:68654206-68654228 CTTAAGCCAATCAGAAACTCTGG - Intergenic
959964241 3:112335605-112335627 CTGAAGACAAGAAGACACTCAGG + Intronic
962483498 3:135817779-135817801 TTAAAATCAAGCAGAAATTCTGG + Intergenic
962494687 3:135927187-135927209 CTACAATCTTGCAGACACTCTGG - Intergenic
964296268 3:155237439-155237461 CTAAAATCAACCACACAATCCGG - Intergenic
964668364 3:159198416-159198438 CTTATATGAAGAATACACTCAGG - Intronic
965136262 3:164773408-164773430 CTTCAATCAAGGAAAAACTCAGG - Intergenic
969905822 4:10395148-10395170 CTTAAATCAATCAGAACTTCTGG - Intergenic
970484478 4:16510436-16510458 CTAAAGTCCAGCAGATACTCAGG + Intronic
973716314 4:53680698-53680720 ATTAAATCAAGTAGAAACACTGG - Intronic
975554177 4:75643989-75644011 CTTAAATTCAGGAGCCACTCGGG + Exonic
976822676 4:89224253-89224275 CTTAATTTAGGAAGACACTCAGG - Intergenic
976823520 4:89234082-89234104 CTGAAATCAAGGAGACCATCAGG + Intergenic
980351630 4:131691893-131691915 CTAAAGTTAAGAAGACACTCTGG - Intergenic
981297945 4:143155100-143155122 ATTAAAACAAGCAGAAATTCTGG - Intergenic
983165805 4:164476426-164476448 AAAAAATCAAGCAGAAACTCTGG - Intergenic
983373420 4:166894453-166894475 CTTAATTCAAGCAGTCTCTAAGG + Intronic
985119091 4:186621875-186621897 CTGAAATTAAGCAGAAACTCAGG + Intronic
985213119 4:187616847-187616869 CTTAAAGCAAGAAGACATTCTGG + Intergenic
985289680 4:188375143-188375165 ATGAACTCAAGCAGGCACTCAGG - Intergenic
987451070 5:18084670-18084692 ATAAAATCAGGTAGACACTCTGG + Intergenic
987583620 5:19825821-19825843 TTTGAAGCAAGAAGACACTCTGG - Intronic
989790100 5:45388558-45388580 ATTTAATGAAGCAGAAACTCAGG + Intronic
990979066 5:61585426-61585448 TTTAAATGAAGCAGCCTCTCAGG + Intergenic
995290105 5:110442448-110442470 TTTAAATCAAGCAGAGATTCTGG - Intronic
995572986 5:113501691-113501713 TTAAAAACAAGCAGACATTCTGG - Intergenic
997241453 5:132311378-132311400 CTTAAGTCAAACTGAAACTCTGG + Intronic
998811335 5:145969514-145969536 CATAAACCAAGCAGACAATCAGG - Intronic
1002459238 5:179364617-179364639 CTTAGCTCAAGCATGCACTCTGG + Intergenic
1003952151 6:11126466-11126488 TTTAAATCAAGCAGAAATTCTGG - Intronic
1007752527 6:44079190-44079212 CAGAAATGAAGCAGCCACTCTGG + Intergenic
1012762533 6:103320371-103320393 CATAAAGCAAGCATACAATCTGG + Intergenic
1018025669 6:159803830-159803852 CTGAAACACAGCAGACACTCGGG + Intronic
1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG + Intronic
1020448117 7:8291562-8291584 TTTAAATAATGCAGACTCTCAGG - Intergenic
1023208801 7:37781221-37781243 TTTAAATCAAGCAGAAATTCTGG - Intronic
1023504267 7:40883936-40883958 CTTAAATCACAGAAACACTCTGG + Intergenic
1028040134 7:86041431-86041453 ATTAAATGATGCAGACACTGTGG + Intergenic
1028043397 7:86087752-86087774 ATCCAATCAAGCTGACACTCAGG - Intergenic
1035980538 8:4365571-4365593 ATGATATCAAGCAGATACTCTGG + Intronic
1039002191 8:32994268-32994290 CAAAAATCAAGCAGAAATTCTGG - Intergenic
1039616197 8:38956753-38956775 AATAAATAAAGCAGAGACTCTGG + Intronic
1040576674 8:48658519-48658541 CATCAATCAAGCAGAATCTCTGG + Intergenic
1043785470 8:84393184-84393206 CTGCAATCAAGAAGTCACTCAGG + Intronic
1044730673 8:95226359-95226381 CATCAATCATGCAGACCCTCAGG - Intergenic
1047553548 8:125903554-125903576 CTTTAATGTAGCAGACACACTGG + Intergenic
1048920659 8:139227099-139227121 CTTGACTCAATCAGACCCTCTGG - Intergenic
1049527395 8:143134573-143134595 CTTTTATAAAGCAGACACTCCGG + Intergenic
1050162539 9:2733272-2733294 TTTAAATGAAGCAGAAACTGAGG - Intronic
1050906756 9:11014968-11014990 TTGAAATCAAGAAGAAACTCTGG - Intergenic
1051342980 9:16128543-16128565 CCTAAGTCAAGCTGACACCCAGG + Intergenic
1051678873 9:19586501-19586523 CATTAATCAAGCAGAAAGTCTGG - Intronic
1052600811 9:30627721-30627743 ATTGAAACAAGCAGGCACTCTGG - Intergenic
1053255041 9:36609794-36609816 CTTATATAAAGCAGAAATTCAGG - Intronic
1186752251 X:12633209-12633231 CTTAAACCATGCTGCCACTCTGG + Intronic
1186784969 X:12948740-12948762 CTAGAATGCAGCAGACACTCAGG + Intergenic
1189855611 X:45222189-45222211 TTAAAATCAAGCAGAAATTCTGG - Intergenic
1193235999 X:79108396-79108418 CTTAAAACATGCAGACCCTTGGG + Intergenic
1193555643 X:82950712-82950734 AAAAAATCAAGCAGAAACTCTGG - Intergenic
1194228175 X:91287561-91287583 TTTTAATCAAGCAGAAATTCTGG + Intergenic
1194834236 X:98661157-98661179 ATTCAATCAAGTTGACACTCAGG - Intergenic
1197365355 X:125558835-125558857 CTTAAATCAAGTAGAAATTCTGG + Intergenic
1197789943 X:130244220-130244242 CTTACATTAATCAGATACTCTGG - Intronic
1199076066 X:143528596-143528618 ATTGAATCAAGCAGAAATTCTGG - Intergenic
1199558009 X:149130182-149130204 TTAAAATCAAGCAATCACTCAGG + Intergenic
1199892908 X:152105260-152105282 CTTAACTCAAAGAGACAATCAGG - Intergenic