ID: 1179933238

View in Genome Browser
Species Human (GRCh38)
Location 21:44585957-44585979
Sequence ACACTGGGGCTCTCAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179933238 Original CRISPR ACACTGGGGCTCTCAGGGTG GGG Intronic
900228891 1:1546012-1546034 CCTCTGGGGTCCTCAGGGTGGGG + Intronic
900356786 1:2268800-2268822 CAGCTGGGGCTCTCTGGGTGGGG - Intronic
900368725 1:2322088-2322110 GCGCTGGGGCTCTCCGGGTGGGG + Intronic
900457860 1:2786110-2786132 ACCCTGGGGCAGTGAGGGTGGGG - Intronic
900520228 1:3101860-3101882 GGACTGGGGGTCTCCGGGTGGGG - Intronic
901748905 1:11393879-11393901 GCAGTGTGGCTCTCAGGCTGAGG - Intergenic
902466883 1:16624051-16624073 AAACTGTGGATCTCAGGGAGTGG + Intergenic
902507717 1:16948723-16948745 AAACTGTGGATCTCAGGGAGTGG - Intronic
903258471 1:22118320-22118342 ACACTGGGGCTCTAAGTTTCAGG - Exonic
903334490 1:22615900-22615922 GGACTGGGGCTCACAGGCTGGGG + Intergenic
903733694 1:25516646-25516668 ACACTGAGGCTCTGAGGTAGGGG + Intergenic
905233458 1:36529815-36529837 AGACTAGGGCTCCCAGGGTGGGG + Intergenic
906719086 1:47992817-47992839 CCACTGGGGCCCTCTGGGTAAGG + Intronic
907026970 1:51129565-51129587 AAACTGGGTCTCCCGGGGTGTGG - Intronic
907311274 1:53540459-53540481 ACACTGAGGCTCACAGGAAGAGG - Intronic
908194020 1:61731038-61731060 ACACTGGGGCTGTCAGGGGGTGG + Intergenic
909338993 1:74510814-74510836 ATACTGGGCCTCTCTGGGTAGGG - Intronic
912127731 1:106560598-106560620 ACACTGGGGCTTTTGGGGGGTGG + Intergenic
912182496 1:107235944-107235966 ACACTGGGACTCTGTTGGTGTGG - Intronic
912466296 1:109877259-109877281 ACGCAGGGGCTCTGAGTGTGGGG - Intergenic
912551861 1:110490013-110490035 ACAGGGAGGCTCTCAGGGTGAGG - Intergenic
913483577 1:119313459-119313481 ACACTGGTGCTGTCGGGGGGGGG - Intergenic
915048381 1:153040146-153040168 ACACTTTGGCTGGCAGGGTGGGG + Exonic
915052744 1:153093551-153093573 ACACTTTGGCTGGCAGGGTGGGG + Exonic
915054363 1:153112533-153112555 ACACTTTGGCTGGCAGGGTGGGG + Exonic
915056793 1:153140509-153140531 ACACTTTGGCTGGCAGGGTGGGG + Intergenic
915161187 1:153922252-153922274 CCAGTGGTGCCCTCAGGGTGCGG - Intronic
915594958 1:156891824-156891846 ACTCTGTGGCTCTCTGTGTGAGG + Intergenic
918108556 1:181434773-181434795 ACACTTCGGAGCTCAGGGTGAGG + Intronic
918240368 1:182615318-182615340 CCACTGGCCCTCTCAGGCTGCGG + Intergenic
919933334 1:202235789-202235811 TCTCTGGGGCTCTGAGGCTGGGG + Intronic
920286062 1:204880766-204880788 ACACCTGGGAACTCAGGGTGGGG - Intronic
920502221 1:206492673-206492695 ACACCAGGGCTCTCAGTGTGGGG - Exonic
921048760 1:211495890-211495912 ACTCTGAGGCCCTCGGGGTGGGG + Intergenic
922097455 1:222454563-222454585 CCACTGGAGCTTTCACGGTGGGG + Intergenic
922822807 1:228495492-228495514 AAACTGGAGGTCTCAGGGTCGGG - Exonic
1062797449 10:355107-355129 ACACCTGAGCTCTCAGCGTGGGG + Intronic
1062802628 10:391380-391402 AGACTGGGCTGCTCAGGGTGAGG - Intronic
1063716804 10:8535652-8535674 ACACTGGGGGTCACTGGATGGGG - Intergenic
1065013764 10:21442840-21442862 ACACTGGGGCTTGTGGGGTGGGG - Intergenic
1066449344 10:35514053-35514075 GAACTGGTCCTCTCAGGGTGTGG - Intronic
1067066968 10:43109657-43109679 ACAGTGGTGCCCTCAGGGGGAGG + Intronic
1067709831 10:48639127-48639149 ACACAGGTTCTGTCAGGGTGGGG + Intronic
1068195216 10:53707276-53707298 ACACTGGGCCTGTCAGGGGCTGG - Intergenic
1068382464 10:56274529-56274551 ACACTGGGGCTGTCGGGGGCCGG - Intergenic
1069149791 10:64945369-64945391 ACACTGGGACTATCAGAATGGGG + Intergenic
1069534276 10:69241438-69241460 GCACTGGGGGACTCTGGGTGGGG + Intronic
1069913265 10:71772504-71772526 ACACAGGGGCTCCCGGGCTGGGG - Intronic
1069957486 10:72060937-72060959 GCAGTGAGGCTCTCTGGGTGAGG - Exonic
1070293048 10:75134167-75134189 ACACTGGGCCTGTCAGTGGGGGG + Intronic
1070490315 10:76969886-76969908 ACTCTGGGCCTGGCAGGGTGAGG + Intronic
1070754671 10:78984615-78984637 ACACTGGGGCTTCCAGGCAGAGG + Intergenic
1071710604 10:88045435-88045457 CCCCTGGATCTCTCAGGGTGAGG - Intergenic
1072806288 10:98425710-98425732 GCGCTGGGGCTCTGAGGGTAAGG + Exonic
1073011530 10:100363675-100363697 ACATTGGGGCCCTCAGCCTGAGG - Exonic
1073517360 10:104088503-104088525 ACACAGGGCCTCACAGGCTGTGG + Intergenic
1075512713 10:123085189-123085211 ACACTGGGGCTCCCTGGCTATGG - Intergenic
1077108605 11:852513-852535 CCAGTGGGGGTCTAAGGGTGGGG + Intronic
1077188906 11:1247583-1247605 ACACTGGGGCTCACAGCCCGTGG - Exonic
1077189331 11:1249254-1249276 ACACTGGGGCTCACAGCCCGTGG - Exonic
1077514455 11:2992980-2993002 ACACTGCGGGGCTCAGGGCGTGG - Intergenic
1078548440 11:12263397-12263419 ACACTCGCGGTCTCAGGCTGCGG + Intronic
1079578358 11:22030918-22030940 ACACTGGGGCCTGCAGGGTGTGG + Intergenic
1080770453 11:35336150-35336172 ACACTGGGCCTCTCAGGGGGTGG + Intronic
1080918019 11:36679902-36679924 ACACTGGGCCTGTCATGGGGTGG + Intergenic
1081666017 11:44917534-44917556 GCCCTGGGGCTGGCAGGGTGGGG + Intronic
1083249556 11:61456968-61456990 TCACTGAGGCTCTCAAGATGAGG - Intronic
1083447058 11:62715196-62715218 AAACAGGGGCTGTCGGGGTGGGG - Exonic
1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG + Intronic
1083727250 11:64635007-64635029 ACACAGGTGGTCTCAGGGAGTGG + Intronic
1084385830 11:68842092-68842114 AAACTGAGGCTCGGAGGGTGAGG - Intronic
1085266939 11:75242705-75242727 ACCCTGGGGCTCTGAGGATTGGG + Exonic
1085521067 11:77139170-77139192 ACGCTGTGTCTCTCTGGGTGAGG - Intronic
1089151188 11:116365668-116365690 TACCTGGGGCACTCAGGGTGAGG - Intergenic
1089560620 11:119341419-119341441 TCTCTGGGGCTCCCAGGGAGGGG - Exonic
1089616660 11:119698646-119698668 AAACTGAGGCTCACAGGGTAAGG - Intronic
1090594825 11:128310093-128310115 ACACTGTGGCTCTCAGTGCTGGG - Intergenic
1091155157 11:133365477-133365499 ACAGTGGGGCTCTCATGGATGGG - Intronic
1093090364 12:14913449-14913471 ACACTGGGGCTTTCACAGTGTGG + Intergenic
1094658320 12:32441985-32442007 ATGCTGCTGCTCTCAGGGTGGGG + Intronic
1095940029 12:47720641-47720663 TCACAGGGGCTCTAAGGGTCTGG - Intronic
1096693756 12:53336116-53336138 ACACTGGGGAGCTCTGGGAGGGG - Intronic
1097052675 12:56232732-56232754 CCTCTGGGTCCCTCAGGGTGGGG + Exonic
1098732914 12:74061532-74061554 ACACTGGGTCTGTCATGGGGTGG + Intergenic
1099036227 12:77590496-77590518 ACACTGGGGTTATCAGAGGGTGG + Intergenic
1099698656 12:86056390-86056412 ACACTGGGGCCTTAAGGGGGTGG - Intronic
1102426578 12:112848653-112848675 AAAGTGGGGCTCAGAGGGTGGGG + Intronic
1102506793 12:113388976-113388998 ACTCTGGGGCTCCCATGGGGTGG + Exonic
1104205954 12:126638643-126638665 ACACTGGTGCTCGGGGGGTGGGG - Intergenic
1104959344 12:132480851-132480873 AGCCTGGGGCACACAGGGTGTGG - Intergenic
1105405213 13:20127758-20127780 ATGCTGGGGCCCTGAGGGTGAGG + Intergenic
1106400810 13:29428534-29428556 CCACTGGAGTCCTCAGGGTGAGG - Intronic
1107793299 13:44024608-44024630 CAACTGGGGCTCCCAAGGTGAGG + Intergenic
1110829751 13:80017501-80017523 ACACTGGGGCTTGCTGGGGGTGG + Intergenic
1111167345 13:84476897-84476919 ACACTGGGCCTGTCGGGGGGTGG + Intergenic
1111257882 13:85696539-85696561 ACACTGAGGCCGTCAGGGGGTGG - Intergenic
1112375528 13:98836540-98836562 CTACAGGGGCTCTCAGAGTGTGG - Intronic
1113454605 13:110439136-110439158 AGGCTGGGGCTCTGAAGGTGAGG - Intronic
1114324482 14:21574992-21575014 TCACTGGGGCTATGAGGATGCGG + Intergenic
1114648049 14:24266610-24266632 ACAGAGGGGCTCACAGGGTCAGG + Intronic
1114713808 14:24804271-24804293 ACAGTGCTGCTCTCAGGGAGTGG + Intergenic
1115087865 14:29539027-29539049 ACCCTGGGGCTCACAAGGAGGGG + Intergenic
1118397740 14:65352003-65352025 ACACTGGGAATCACATGGTGAGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119949098 14:78726346-78726368 ACACTGGGCCTGTTAGGGGGTGG - Intronic
1120852688 14:89185712-89185734 CCCCTGAGGCTCTCAGGATGAGG + Intronic
1120894757 14:89519477-89519499 CCACTGGAGCTCTCTGCGTGTGG + Intronic
1122115654 14:99526084-99526106 ACACTGTGGGGCTCAGGGAGAGG + Intronic
1126996762 15:54452952-54452974 ACAATGGGATTCTAAGGGTGTGG + Intronic
1127282833 15:57506356-57506378 AGACTGTGGCTCTCATGGTGAGG + Intronic
1128054319 15:64688581-64688603 ACACTGAGGGGCTCAGGGTGAGG - Exonic
1129241518 15:74255095-74255117 ATTCTGGGGCTTTCAGGATGGGG - Intronic
1129820629 15:78599436-78599458 AGACTGGGGCTGGCAGGGGGAGG + Intronic
1129893406 15:79086902-79086924 GCACTTGGGCTTTCAGTGTGTGG + Intronic
1131540438 15:93270895-93270917 GCACTTTGGCTCTCGGGGTGTGG + Intergenic
1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG + Intergenic
1132701764 16:1225076-1225098 ACACGGGGCCCCACAGGGTGGGG + Intronic
1133006387 16:2883758-2883780 ACACTCGGGGCCTCAGGGTGTGG + Intronic
1133473524 16:6098186-6098208 ACACAGGCCCTCCCAGGGTGGGG - Intronic
1133903508 16:9999576-9999598 ACACTGGGCCTGTCAGGGGTTGG + Intronic
1134271807 16:12739608-12739630 ACACTGGGGCTGCAAGAGTGGGG + Intronic
1137722396 16:50635126-50635148 ACCCTGGGGCTAGCAGTGTGGGG + Exonic
1138981218 16:62271246-62271268 ACACTGGGGCCCATAGGGGGTGG + Intergenic
1139392597 16:66614378-66614400 ACCCTGGGGCTCTCCTGGTTTGG + Intergenic
1139789907 16:69425156-69425178 AAACTGAGGCTCACAGGTTGAGG + Intronic
1139969505 16:70765111-70765133 ACTTTGGGGCTCACAGGGTCAGG - Intronic
1140785253 16:78335281-78335303 ACACTGGGGCTTGCAGGTGGTGG - Intronic
1141883840 16:86878569-86878591 CCCCTGGGACCCTCAGGGTGAGG + Intergenic
1141961297 16:87411170-87411192 ACACTGGGGCCCTCAGGCTGTGG - Intronic
1142418392 16:89955471-89955493 TCACTCAGGCTCTGAGGGTGGGG - Intronic
1142981754 17:3676518-3676540 ATACTGCTGCTTTCAGGGTGGGG + Intronic
1143008375 17:3851903-3851925 ACGCGGGGGCCCTCAGCGTGTGG - Intergenic
1143204246 17:5131646-5131668 ATTCTGGGCCTCTCACGGTGAGG + Intronic
1143419401 17:6777008-6777030 ACACTGGTGCTGTAAGGGTGGGG - Intronic
1143729945 17:8875753-8875775 GCACTGCGGGTCTCAGGGTTTGG - Intergenic
1144020984 17:11240416-11240438 ACGCCCGGGCGCTCAGGGTGCGG - Intergenic
1144672133 17:17138825-17138847 ACCCTGGGACTGCCAGGGTGAGG - Intronic
1145185273 17:20788472-20788494 ACATTGGGGCCCTCAGCCTGAGG - Intergenic
1145280722 17:21464955-21464977 ACACTGGCGTCCTCAGGGTCAGG - Intergenic
1145397176 17:22505564-22505586 ACACTGGTGTCCTCAGGGTCAGG + Intergenic
1146570017 17:33944448-33944470 AGACTGGTGCTCACAGGGAGAGG + Intronic
1150378418 17:64701279-64701301 TCATTGGGGCTCCCAGGGTGTGG - Intergenic
1151368134 17:73630394-73630416 ACACTTGGGCTCTCAGAATGTGG + Intronic
1151454002 17:74215343-74215365 TCTCTGGGGCCATCAGGGTGAGG - Intronic
1151785082 17:76271521-76271543 TCACTAGGGCTCTGTGGGTGGGG - Intergenic
1152013990 17:77737536-77737558 CCTCTGGGGCTCTCCGGGTGTGG - Intergenic
1152207254 17:78980772-78980794 ACACTGCTGGTTTCAGGGTGGGG + Intergenic
1152336476 17:79702168-79702190 ACACTGGGGCCCCCTGGGGGCGG + Intergenic
1152566394 17:81102246-81102268 GCCTCGGGGCTCTCAGGGTGCGG + Intronic
1152992845 18:378502-378524 ACACAGAGGCCCACAGGGTGTGG + Intronic
1155583983 18:27343752-27343774 ACCCTGGGGAGCTCAGGCTGAGG - Intergenic
1160122708 18:76145077-76145099 ACCCTGGAGCACGCAGGGTGCGG + Intergenic
1160776566 19:859360-859382 ACCCTGGGGGACTCTGGGTGTGG + Intergenic
1161026367 19:2039104-2039126 CCAGGGGTGCTCTCAGGGTGAGG + Exonic
1161385175 19:3987850-3987872 ACGCTGGGTCTTTTAGGGTGGGG + Intergenic
1164562571 19:29302851-29302873 ACACAGGGGCTCTCAGCGCGTGG + Intergenic
1164616181 19:29668051-29668073 ACACGGGGGCTCTCAGGATGTGG + Intronic
1167723349 19:51194115-51194137 AGCCTGGGGTTCTCAGTGTGAGG - Intergenic
1167745296 19:51347235-51347257 ACACCGTGGCTCTCAGGGAAAGG - Intronic
1168115793 19:54220894-54220916 ACACTGAGGGTCCCAGGGAGAGG - Intronic
1168118777 19:54240640-54240662 ACACTGAGGGTCCCAGGGAGAGG - Intronic
1168187664 19:54710021-54710043 ACACTGAGGGTCCCAGGGAGAGG + Intergenic
1168250798 19:55140849-55140871 ACATTTGGGCTCTCAGGGCAGGG + Intronic
1168565644 19:57420011-57420033 ACACAGGGACACTCATGGTGTGG + Exonic
925057157 2:864366-864388 CCACCAGGGCTCTCGGGGTGAGG - Intergenic
925328036 2:3037812-3037834 CCGCTGGTGCTCTCGGGGTGAGG + Intergenic
926686809 2:15704464-15704486 ACACTGGGGGTCCCAGGGTAAGG - Intronic
927152853 2:20205677-20205699 AGACTGAGCTTCTCAGGGTGAGG - Intronic
927517815 2:23682316-23682338 ACCCTGAGGCTCTGAGGATGTGG + Intronic
928112979 2:28525491-28525513 CCACTGGGGTTCTCAGGCAGAGG - Intronic
928772907 2:34722922-34722944 ACTCTGGGGATCTCACGATGTGG + Intergenic
929916049 2:46136725-46136747 ACAGTGGGGCTCACAGGTAGGGG - Intronic
930153380 2:48080350-48080372 ACCCTGGGGATCTGATGGTGTGG + Intergenic
930730349 2:54723333-54723355 AGCCTGCGGCTCTCGGGGTGAGG - Intergenic
930908135 2:56598539-56598561 ACACTGGGCCTTTCAGGGGGTGG - Intergenic
932873413 2:75426165-75426187 ACACTGGGGCCTTTGGGGTGAGG - Intergenic
934734177 2:96680256-96680278 TGCCTGGGGCTCTCAGTGTGAGG - Intergenic
935192640 2:100791269-100791291 ACTCTGGGGCCATCTGGGTGAGG + Intergenic
935707427 2:105869156-105869178 TCACTTCGGCTCTCAGGGTCAGG - Intronic
936043785 2:109170746-109170768 GCACTGGGGCTCAAGGGGTGCGG + Intronic
937281566 2:120720863-120720885 ACACCGAGGCCCTGAGGGTGGGG + Intergenic
937836383 2:126474410-126474432 ACACTGGGGGTATCAGAGAGTGG + Intergenic
937993961 2:127679448-127679470 ACAGTGGGGCTCTGAGGCTGAGG + Intronic
939233957 2:139467469-139467491 GCACTGGGGTTCTCAGAATGTGG + Intergenic
940142500 2:150508619-150508641 TCACTGAGGCACTCAGGCTGGGG - Intronic
940656765 2:156496391-156496413 ACACTGGGGCCTTTGGGGTGGGG - Intronic
941372219 2:164679766-164679788 ACACTGGGCCTCTCGGGGGGTGG + Intronic
941560019 2:167033274-167033296 ACACTGGGCCTGTCAGGGTTTGG + Intronic
944336220 2:198538567-198538589 ACACCGGGGCTGTCAGGGGGTGG - Intronic
948546191 2:238730463-238730485 ACACAGCGGTTCTCAGAGTGGGG + Intergenic
948548140 2:238746897-238746919 AGGCTGGAGCTCACAGGGTGTGG - Intergenic
948860942 2:240752347-240752369 ACACTGAGGCCCACAGGGCGGGG + Intronic
1168964142 20:1888894-1888916 GCTCTGGAGCTCTCAAGGTGTGG + Intergenic
1169122905 20:3107926-3107948 ACGCTAGGGCTCTCGGGGTTGGG + Exonic
1171206330 20:23284018-23284040 ACACTGGGCCTGTCGGGATGGGG - Intergenic
1172182115 20:33009882-33009904 ACTCTGGGGCTTGCAGGATGGGG - Intronic
1173205673 20:40991297-40991319 ACCCTGGTGATCTCAGGGTCAGG + Intergenic
1173652889 20:44678557-44678579 ACCCTTGGGCCCTCAGGATGGGG - Intergenic
1174487488 20:50870564-50870586 ACCGTGGGGATCTCAGGCTGGGG + Intronic
1175538418 20:59732117-59732139 GCACTGGGGCTCTCATGAAGAGG + Intronic
1175605050 20:60305868-60305890 GCATTGGGACTCTCAGTGTGGGG - Intergenic
1176261076 20:64180628-64180650 ACTTTGGGGTTCACAGGGTGTGG + Intronic
1176512744 21:7760868-7760890 ACTCTGGGGCTCTCCGTGGGTGG - Intronic
1178215547 21:30593274-30593296 ACACTGGGACTCTTGGAGTGGGG - Intergenic
1178476759 21:32944027-32944049 ACCCTGGGGGTCTCTGAGTGTGG - Intergenic
1178646857 21:34391392-34391414 ACTCTGGGGCTCTCCGTGGGTGG - Intronic
1179571564 21:42281678-42281700 ACACCAGGGCTCTCGGGGAGGGG - Intronic
1179730739 21:43365936-43365958 ACCCTGGCGCTCTTAGGGTCAGG + Intergenic
1179933238 21:44585957-44585979 ACACTGGGGCTCTCAGGGTGGGG + Intronic
1181059302 22:20274201-20274223 AGCCTGGGGCCCTCGGGGTGTGG + Intronic
1181546916 22:23607449-23607471 ACACTGGGACCCTCATTGTGAGG + Intergenic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1181968608 22:26673390-26673412 CCCCTGGGGCAGTCAGGGTGAGG - Intergenic
1183484154 22:38080481-38080503 ACACTGAGGCTCTCATTCTGGGG + Intronic
1184239623 22:43205310-43205332 ACACTGGGGCTCAGAGAGGGCGG - Intronic
1184402297 22:44281118-44281140 AGACCTGGGCTGTCAGGGTGAGG + Intronic
1184411770 22:44330333-44330355 ACACAGGGACTCTCTGGGGGTGG - Intergenic
1184413274 22:44338012-44338034 ACCCTGGGGCGGGCAGGGTGAGG + Intergenic
1185172914 22:49304015-49304037 ACCCTGGGGTACACAGGGTGTGG + Intergenic
1185226749 22:49657784-49657806 AGAGAGGGGCTCTCAGGGAGGGG - Intergenic
1185314832 22:50174494-50174516 TCACTGGGGCTCTGAGGGCTGGG + Intronic
1185372998 22:50469494-50469516 ACAGTGGGACACTCAGGGTGTGG + Intronic
952332139 3:32373915-32373937 ACACTGGGGCTATAAGAGGGTGG - Intergenic
952497639 3:33929770-33929792 ACACTGGGGCTGTCAGTGGGAGG - Intergenic
952651726 3:35735679-35735701 AGAATGGGGCTCCCAGGATGGGG - Intronic
952686510 3:36155341-36155363 ACACTGGAACTCTGTGGGTGTGG - Intergenic
953280913 3:41556010-41556032 ACACTGGGCCTTTCAGAGGGTGG + Intronic
953436946 3:42885064-42885086 ACAATGGGGCTCAGAGTGTGAGG + Intronic
953901792 3:46847612-46847634 ACACTGGGGCAAGCTGGGTGAGG + Intergenic
953913060 3:46902439-46902461 AGCCTGGGGCTCGCAGGGTGGGG + Intronic
954434792 3:50490291-50490313 GCACTGAGGCTCCCAGGGTTGGG - Intronic
954914409 3:54136582-54136604 TCACTGAAGCACTCAGGGTGAGG - Intronic
956112603 3:65884752-65884774 ACACTGGGCCTCCCAAAGTGGGG - Intronic
958661918 3:97079432-97079454 ACACTGGGCCTATCAGAGGGTGG + Intronic
959017516 3:101152508-101152530 ACACTGTGGCTTTCTGGATGTGG - Intergenic
959166955 3:102792419-102792441 ACCCTGAGGCTCTGAGGGAGAGG + Intergenic
959506473 3:107162240-107162262 ACACTGGGGATGTCAGGGGGTGG + Intergenic
961467859 3:127092452-127092474 ACCCTGGGGTGTTCAGGGTGGGG - Intergenic
962325668 3:134430006-134430028 TGACTGGGGATCTCTGGGTGTGG - Intergenic
962650400 3:137483115-137483137 ACACTGGGCCTTTCAGAGGGTGG + Intergenic
964641710 3:158915673-158915695 CCCCTGGGGCACCCAGGGTGGGG + Intergenic
964703773 3:159596783-159596805 ACACTGGGGGTGTCATGGGGTGG + Intronic
964805369 3:160603924-160603946 ACACTGGGGCTGTTTGGGGGTGG - Intergenic
967190819 3:186983518-186983540 ATCCAGGGGCACTCAGGGTGAGG + Intronic
967409911 3:189156892-189156914 TCACTGGGGTCCTCAGGTTGAGG + Intronic
968217150 3:196902622-196902644 GCACTGTGGTTCTCAGAGTGTGG - Intronic
968478254 4:822766-822788 ACAATGAGGCTCGCCGGGTGAGG + Intronic
968495738 4:914443-914465 ACACTGGGGCTGTGTGTGTGGGG - Intronic
969058860 4:4419368-4419390 AGACTGGGGCCCTCAGTGAGGGG - Exonic
969333829 4:6495153-6495175 ACACTGTGGCTCTCAGCCTGAGG - Intronic
971055413 4:22907671-22907693 ACACTGGGGCTCTCGGGGAGTGG - Intergenic
971320359 4:25600525-25600547 ACACTGGGAATCTCTGGATGGGG + Intergenic
971946642 4:33287233-33287255 ACACAGGGGGGCTCAGTGTGAGG - Intergenic
976023784 4:80663292-80663314 ACACTGTGCCTGTCAGGGGGTGG - Intronic
977077642 4:92476442-92476464 AAACTGTGGCACACAGGGTGAGG + Intronic
977734007 4:100390277-100390299 AATCTGAGGGTCTCAGGGTGGGG + Intergenic
979228067 4:118313195-118313217 ACACAGGCTCTCTCTGGGTGAGG - Exonic
979512782 4:121573287-121573309 ACACTGGGCCTGTCAGGGGGTGG + Intergenic
980798360 4:137714678-137714700 AAACTGGTGATCTCAGGGGGTGG + Intergenic
980989709 4:139728787-139728809 ACCCTGGGGAGCACAGGGTGTGG - Intronic
981847073 4:149181814-149181836 ACACCAGGGCCTTCAGGGTGTGG + Intergenic
984162782 4:176274628-176274650 ACACTGTAGATCACAGGGTGTGG - Intronic
985621480 5:958412-958434 ACACTGCGGCACTCAGGGAAGGG + Intergenic
985621495 5:958472-958494 ACACTGCGGCACTCAGGGAAGGG + Intergenic
985668531 5:1194396-1194418 ACACTGGGCCTGTCAGAGGGTGG - Intergenic
985726399 5:1518130-1518152 ACCCTGGGTCCCACAGGGTGGGG + Intronic
986241330 5:5962184-5962206 ACACTGGGGCTCTCTGATTCGGG + Intergenic
991150530 5:63362505-63362527 ATACTGGGCCTGTCAGGGAGTGG + Intergenic
992290603 5:75275534-75275556 ACTCTGGGGCTCCCACTGTGTGG + Intergenic
993785679 5:92132319-92132341 ACACTGGGGCTTTCAGAGGTCGG - Intergenic
994119456 5:96097490-96097512 ACACTGTGGCCTTCAGAGTGGGG - Intergenic
994195058 5:96913881-96913903 CCACAGGGGCTCTAGGGGTGAGG - Intronic
994385690 5:99128884-99128906 ACACTCTGCCTCTCAGCGTGAGG - Intergenic
994705792 5:103205011-103205033 ACACTGGGCCTGTCAGTGGGTGG - Intronic
996289866 5:121840107-121840129 ACACTGGGCTTCTCTGAGTGTGG - Intergenic
997215773 5:132109315-132109337 ACACTGGGGCTGTTGTGGTGGGG + Intergenic
998505633 5:142669856-142669878 GCACTGGGGATCTCAGAGTGTGG - Intronic
1000243752 5:159432107-159432129 AACCTGGAGCTCTCAGGGAGGGG - Intergenic
1002037161 5:176480785-176480807 ACACGGGGCCTCTCGGGGGGTGG + Intronic
1002166435 5:177350389-177350411 ACACTGAGGCAGTCAAGGTGAGG - Intronic
1002710096 5:181190215-181190237 ACTCGGGGGCTCTCAGAGTCTGG - Intergenic
1002713209 5:181207467-181207489 CCACTGGAGCTCTCACCGTGTGG - Intergenic
1002925656 6:1604616-1604638 AGGCTGGGGCTCTCAGGCTGGGG - Intergenic
1003076795 6:2989238-2989260 ACCTGGGGGCTCTCAGGGTGGGG + Intronic
1004067704 6:12265405-12265427 AAAATGGGGTTATCAGGGTGTGG + Intergenic
1004845591 6:19638374-19638396 ACACTGGGGCTGTCAGGGAGTGG - Intergenic
1006030816 6:31175443-31175465 ACCCAAGGGCTCTCAAGGTGGGG - Intronic
1006053045 6:31357960-31357982 ACACAGGGAAACTCAGGGTGGGG - Intergenic
1006840460 6:37025333-37025355 ACAGTGTGGCTCTCAGGGTCAGG + Intronic
1007427975 6:41759481-41759503 AGACTAGGTCTCTCTGGGTGGGG + Intergenic
1007548277 6:42710123-42710145 ACACTGGGGCTCCCTGAGTCAGG + Intronic
1007704525 6:43782763-43782785 AGACTGGGGCTCTGAGGGCAAGG + Intronic
1009754449 6:67918520-67918542 ACACTGGGGCTTACTGGGTGTGG + Intergenic
1010593719 6:77739556-77739578 ACACTGGGCCTGTCAGGGGGTGG + Intronic
1012188616 6:96253275-96253297 ACACTGGGCCTGTCATGGGGTGG + Intergenic
1012188626 6:96253309-96253331 ACACTGGGCCTGTCATGGGGTGG + Intergenic
1014183488 6:118409146-118409168 GCACTGGGGGTATCAAGGTGTGG - Intergenic
1016660153 6:146568999-146569021 ATACTGGGGCTGTCAGGGGGTGG + Intergenic
1018291834 6:162299051-162299073 CCACAGGGGCTCACAGGGTCAGG + Intronic
1019258393 7:66018-66040 AAACTGAGGCGGTCAGGGTGGGG - Intergenic
1020005938 7:4783847-4783869 GCACAGGAGCTCTCAGGGAGGGG - Intronic
1021748709 7:23773200-23773222 ACACTGGGCCTGTCAGGGGGTGG - Intronic
1022443720 7:30453221-30453243 AGCCTGGGGCCCTCAGGGTCAGG - Intronic
1023829232 7:44029355-44029377 GCAGTTGGGCTCTGAGGGTGGGG + Intergenic
1023851665 7:44153508-44153530 AGGCTGGGGACCTCAGGGTGGGG + Intronic
1024004670 7:45216703-45216725 TCAGTGGGCCTCTGAGGGTGAGG + Intergenic
1024270014 7:47635190-47635212 AGGCTGGGGCTCTCTGGGAGTGG - Intergenic
1024955582 7:54915784-54915806 ACACTTGGGATAACAGGGTGTGG + Intergenic
1026497941 7:70919644-70919666 GCACTTGGGGTTTCAGGGTGTGG + Intergenic
1027727321 7:81824234-81824256 ACACTGGGCCTGTCATGGGGTGG - Intergenic
1029739538 7:102483613-102483635 GCAGTTGGGCTCTGAGGGTGGGG + Exonic
1029757539 7:102582792-102582814 GCAGTTGGGCTCTGAGGGTGGGG + Exonic
1029775477 7:102681853-102681875 GCAGTTGGGCTCTGAGGGTGGGG + Intergenic
1031240038 7:119226079-119226101 ACACTGGAGCTCTCAGAGGTTGG + Intergenic
1031269772 7:119633885-119633907 ACACTGGGCCTTTCAGAGGGTGG - Intergenic
1031865670 7:127036563-127036585 ACTATGGGGATCCCAGGGTGGGG - Intronic
1033659901 7:143395994-143396016 ACACTGGGCCTCTGATGGGGTGG + Intronic
1033928920 7:146499598-146499620 ACACTAGGGCCTTCGGGGTGTGG - Intronic
1036112815 8:5923378-5923400 ACATTGGCCCTCTCAGGTTGAGG + Intergenic
1037512919 8:19602245-19602267 ACACTGGGGTTTCCAGGTTGGGG + Exonic
1038100401 8:24367430-24367452 ACTGAGGGGCTCCCAGGGTGGGG - Intergenic
1040695557 8:49993562-49993584 ACACTTGGCCTTTCGGGGTGTGG - Intronic
1041522411 8:58770966-58770988 ACACCTGGGATCTCTGGGTGAGG + Intergenic
1041568750 8:59311838-59311860 ACCCTGGGGCTTGCTGGGTGTGG + Intergenic
1044107155 8:88223676-88223698 ACACTGGGCCTGTCATGGGGTGG + Intronic
1044254189 8:90040630-90040652 ACACTGGGTCTGTCAAGGGGTGG - Intronic
1045544368 8:103114948-103114970 AAACTCTGCCTCTCAGGGTGCGG - Intergenic
1046046622 8:108972754-108972776 TCAGTGGGGCTCCCAGGATGTGG + Intergenic
1046388568 8:113537248-113537270 ACACTGGGGCTATCAGAGAGTGG - Intergenic
1046458461 8:114501691-114501713 ACACTGGGCCTTTCAGAGGGAGG + Intergenic
1047796007 8:128256739-128256761 ACACTGGCCCTGTCAGAGTGTGG + Intergenic
1048043499 8:130752481-130752503 TCACTGGGGCCCTGGGGGTGGGG + Intergenic
1048430791 8:134368648-134368670 ACACTGGAGCCATCATGGTGGGG - Intergenic
1049373611 8:142279058-142279080 ACGCTGGGGCTCTGGGGCTGGGG + Intronic
1049644548 8:143730176-143730198 ATACTGGGGCTGTCGGGGGGCGG + Exonic
1049747410 8:144268870-144268892 ACCCGGGGGCCCTGAGGGTGAGG + Intronic
1050380265 9:5020823-5020845 TCAGTGGGGCTCTAGGGGTGTGG + Intronic
1051701103 9:19825004-19825026 ACACCGGGCCTATCAGGGGGTGG + Intergenic
1055182190 9:73401932-73401954 ACAATGGGGCTATGAGGGTCTGG + Intergenic
1055348809 9:75363794-75363816 ACACTGGGGCTTGTAGGGGGTGG - Intergenic
1055640868 9:78317988-78318010 ACCCTGGGGCTCTCAGGCTTTGG + Intronic
1056822638 9:89854308-89854330 ACACAGGGGCTCCCAGGGAAGGG + Intergenic
1057948960 9:99354426-99354448 AACCTAGGGTTCTCAGGGTGAGG - Intergenic
1058767129 9:108192478-108192500 AAACTGAGGCTCTGAGGGTGGGG - Intergenic
1059653596 9:116337299-116337321 CCACTGGGGCACTCAGGAGGAGG - Intronic
1059681421 9:116590170-116590192 ACACTGTGCCTCGGAGGGTGGGG - Intronic
1059705092 9:116815452-116815474 AAACTGAGGCCCTCAAGGTGGGG - Intronic
1059824540 9:118013472-118013494 ACACTGGGGCTTCCAGAGGGTGG - Intergenic
1059899500 9:118907489-118907511 TCACTGAGGCTCTCAGAGAGAGG + Intergenic
1060188768 9:121579328-121579350 ACTGTGGGGTCCTCAGGGTGGGG - Intronic
1060526381 9:124323572-124323594 CCACTGGGGCTGAGAGGGTGAGG - Intronic
1060918889 9:127406731-127406753 CCACCGGGGGCCTCAGGGTGGGG + Intronic
1061040331 9:128137976-128137998 ACACAGGGGCTCCCAGGGAAGGG - Intergenic
1061502079 9:131009634-131009656 CCACTGGGGGTCTGAGGCTGAGG + Intronic
1061573828 9:131494070-131494092 ACACTGGCCGTCTCAGGGTCTGG - Intronic
1061907288 9:133705194-133705216 ACATAGGGGTTCTCAGGGTGAGG - Intronic
1061907300 9:133705243-133705265 AGATGGGGGTTCTCAGGGTGAGG - Intronic
1061907313 9:133705292-133705314 AGATGGGGGTTCTCAGGGTGAGG - Intronic
1061907326 9:133705341-133705363 AGATGGGGGTTCTCAGGGTGAGG - Intronic
1061907339 9:133705394-133705416 AGATGGGGGTTCTCAGGGTGAGG - Intronic
1061907352 9:133705447-133705469 AGATGGGGGTTCTCAGGGTGAGG - Intronic
1062209034 9:135353292-135353314 CCCCTGGTGCTCTCAGGGTAAGG + Intergenic
1062287353 9:135779059-135779081 GCTGTGGGGGTCTCAGGGTGTGG - Intronic
1062387200 9:136317485-136317507 GCCCTGGGGCTGCCAGGGTGAGG - Intergenic
1062442700 9:136578268-136578290 ACACTGAGGCCCAGAGGGTGGGG + Intergenic
1186121994 X:6373405-6373427 AAACTGCGGGTCACAGGGTGTGG - Intergenic
1186505336 X:10086981-10087003 ACACTGGGACACTCTGAGTGAGG + Intronic
1186638065 X:11427488-11427510 CCACTGGGCCGCTCCGGGTGGGG - Intronic
1186758336 X:12696960-12696982 AGATGGGGGCACTCAGGGTGAGG + Intronic
1188647655 X:32590739-32590761 ACAGTGCAGCTCTCAGTGTGAGG - Intronic
1188681303 X:33010835-33010857 ACACTGTGGTTCTCAAAGTGTGG + Intronic
1188821001 X:34775053-34775075 ACACTGGGCCTGTCAGGGGTTGG + Intergenic
1189440934 X:41035287-41035309 ACACCGGGGCTGTCAGGGGTGGG + Intergenic
1190907279 X:54739391-54739413 ACACTGGGGCTCACAAAGAGTGG - Intergenic
1193674944 X:84438551-84438573 ACACTGGGGCTCACTAGATGTGG - Intronic
1195414768 X:104608213-104608235 ACACTGGGCCAGTCAGGGGGTGG + Intronic
1200278053 X:154752464-154752486 ATAGTGGGGCTCTCAGGGACTGG - Intergenic
1200287215 X:154834778-154834800 ACATAGGGCCCCTCAGGGTGTGG - Intergenic
1200946445 Y:8845097-8845119 ACACTGGGGTCCAGAGGGTGAGG + Intergenic
1200963260 Y:9013993-9014015 TCACAGGGGCTCTCTGGGAGAGG + Intergenic
1201454555 Y:14155467-14155489 ACACTGGGCCTGTCATGGGGTGG + Intergenic