ID: 1179933756

View in Genome Browser
Species Human (GRCh38)
Location 21:44590161-44590183
Sequence CCCTTGCATGTCAACGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179933756_1179933763 6 Left 1179933756 21:44590161-44590183 CCTCTGGCGTTGACATGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1179933763 21:44590190-44590212 GCTGGGGCAGGAGGCAGACCTGG 0: 1
1: 1
2: 7
3: 118
4: 999
1179933756_1179933761 -6 Left 1179933756 21:44590161-44590183 CCTCTGGCGTTGACATGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1179933761 21:44590178-44590200 CAAGGGTCATTTGCTGGGGCAGG 0: 1
1: 1
2: 1
3: 17
4: 191
1179933756_1179933762 -3 Left 1179933756 21:44590161-44590183 CCTCTGGCGTTGACATGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1179933762 21:44590181-44590203 GGGTCATTTGCTGGGGCAGGAGG 0: 1
1: 0
2: 1
3: 25
4: 289
1179933756_1179933764 7 Left 1179933756 21:44590161-44590183 CCTCTGGCGTTGACATGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1179933764 21:44590191-44590213 CTGGGGCAGGAGGCAGACCTGGG 0: 1
1: 0
2: 8
3: 99
4: 785
1179933756_1179933760 -10 Left 1179933756 21:44590161-44590183 CCTCTGGCGTTGACATGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1179933760 21:44590174-44590196 CATGCAAGGGTCATTTGCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179933756 Original CRISPR CCCTTGCATGTCAACGCCAG AGG (reversed) Intronic
902184899 1:14717740-14717762 CCCTTCCATGTCAGCCCCACAGG - Intronic
905914498 1:41675397-41675419 CCCTTGCATGTCACCTCCTCAGG + Intronic
912875202 1:113350723-113350745 CCCATGCATGTCAACCCAACAGG + Intergenic
1062809630 10:452885-452907 CCCTTGAGAGCCAACGCCAGCGG + Intronic
1065182180 10:23137321-23137343 CCCTTTCTTGTCATCCCCAGCGG - Intergenic
1071075983 10:81753493-81753515 CCCTTGGATGTCATCCCCTGTGG - Intergenic
1075327223 10:121543628-121543650 ACCTTGCATGTCAAGGACAGAGG + Intronic
1076451362 10:130559300-130559322 TCCGTGCATGTCAATTCCAGTGG - Intergenic
1078337992 11:10478759-10478781 GCCTTGCATGCAAAGGCCAGGGG + Intronic
1091623980 12:2108697-2108719 CCCTGTCATCTCAACCCCAGTGG - Intronic
1104384607 12:128339418-128339440 CGCTTGCATATCAAGGCCTGCGG + Intronic
1104583310 12:130026969-130026991 TCATTTCATGTCAACGCCAAGGG - Intergenic
1104600754 12:130151836-130151858 CCCTTGCACGGCCACGGCAGAGG + Intergenic
1106477260 13:30109225-30109247 CCCTTGCAGGCTAACCCCAGGGG - Intergenic
1116040399 14:39679549-39679571 CCCTTGCATGAGGACGCCAGAGG - Intergenic
1119636591 14:76278319-76278341 CCCCAGCATGTCAACAGCAGTGG - Intergenic
1121947128 14:98134000-98134022 CCCTGGAATGTCAACACCAAGGG - Intergenic
1123939155 15:25208431-25208453 CCTATGCTGGTCAACGCCAGGGG - Intergenic
1127295963 15:57608721-57608743 CCTTTGAATGCCAAAGCCAGTGG + Intronic
1138269004 16:55681304-55681326 CCCTTGCCTGTGATCCCCAGGGG + Intronic
1150232886 17:63567906-63567928 CCCTGGGATGCCAAGGCCAGAGG - Intronic
1155203682 18:23538669-23538691 TCCCTGCATGTCTCCGCCAGTGG - Exonic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1167003823 19:46762457-46762479 CCCTGGTATGGCCACGCCAGTGG + Intronic
925017144 2:538783-538805 CACTTGCGTGTGTACGCCAGAGG - Intergenic
926094829 2:10074356-10074378 CCCTTGCTTGTCAAACTCAGTGG + Intronic
930969742 2:57381017-57381039 CCCTTGCCTGGCAAGGCCATAGG - Intergenic
937319372 2:120951850-120951872 CCCTTGCAGGTTAACGCAGGAGG + Intronic
947933399 2:233983102-233983124 CCCTTGCCTGGCCACGCCAAAGG - Exonic
1170557529 20:17526974-17526996 CCCTTGCATGCCCATGCCATGGG + Intronic
1173604664 20:44323293-44323315 CCCTGGAATGTCAGCTCCAGAGG + Intergenic
1174257757 20:49270945-49270967 CTCTTCTATGTCAACACCAGAGG + Exonic
1179933756 21:44590161-44590183 CCCTTGCATGTCAACGCCAGAGG - Intronic
1179941134 21:44639355-44639377 CCCTTGCGTGTCAATGACAGAGG + Intronic
1181602163 22:23959120-23959142 CCCTTGCATGTCCACGCGCTTGG + Intronic
1181606347 22:23982187-23982209 CCCTTGCATGTCCACGCGCTTGG - Intronic
1183007970 22:34919029-34919051 CCCTTTCCTATCAAAGCCAGAGG + Intergenic
1183282378 22:36938506-36938528 CCCTTGCCTGTCTAGGCCTGGGG - Exonic
1183834971 22:40444822-40444844 CCCTGGCAGGCCAAGGCCAGTGG + Intronic
1184011947 22:41755593-41755615 CCCTTGCTTGTCAAACCAAGGGG + Intronic
954422455 3:50425853-50425875 CCCTTGCACCTCACCACCAGAGG - Intronic
955004134 3:54953704-54953726 CCCTTGCCTGTGAACGCTTGGGG + Intronic
956394230 3:68807899-68807921 CTCTGGCATGACAACACCAGAGG - Intronic
956751733 3:72348843-72348865 CCCTGGCCTGCCAACGTCAGGGG - Intergenic
957921640 3:86756662-86756684 TCCTTGCATTTCAACCCCATAGG - Intergenic
959087162 3:101863750-101863772 CCCTTGCCTGTCAGCTCAAGAGG + Intergenic
970510807 4:16779797-16779819 ACCTTGCATGTCATCTCCAGTGG - Intronic
999304101 5:150508700-150508722 CCATGGCTTGTCAAAGCCAGAGG + Intronic
1015747625 6:136526928-136526950 CCCTTGCCTGTCTTCACCAGAGG - Intronic
1019610998 7:1936579-1936601 CCCCTGCCTGTCATCCCCAGAGG - Intronic
1029515357 7:101020094-101020116 CACTTGCCTGTCACCCCCAGAGG - Exonic
1033138345 7:138803243-138803265 CCCTTGCATGTCACTCCCAAGGG + Exonic
1038261366 8:25998543-25998565 TCCTTCCATGTAAACTCCAGTGG + Intronic
1041453424 8:58032111-58032133 CGCATGCATTTCAAGGCCAGTGG - Intronic
1045265288 8:100613706-100613728 AGCTTTCATTTCAACGCCAGTGG + Intronic
1048460667 8:134618899-134618921 CACTAGCATGTAAACTCCAGAGG - Intronic
1049749512 8:144276657-144276679 CCCATTCATGTCAAAGCCACAGG + Intronic
1056166162 9:83942852-83942874 CCCATCCATTTCAACTCCAGAGG - Intronic
1058581941 9:106467838-106467860 CCTTTGCATGGCAAGGCCATGGG - Intergenic
1058804405 9:108577173-108577195 CCCTTACATGTCAAAGCCCATGG - Intergenic
1187126130 X:16456114-16456136 CTCTTGCATGACAAGGCCAATGG - Intergenic
1189512389 X:41676075-41676097 CCCTTTCTTGTCATCACCAGTGG + Intronic
1197691863 X:129509802-129509824 CCCTTCCTTTTCCACGCCAGAGG - Intronic
1199679596 X:150215719-150215741 CCCTTGCAAGTCAAGGCCCCGGG - Intergenic
1199695635 X:150341330-150341352 CCCTTGCAAGTCAAGGCCCCGGG + Intergenic
1201512986 Y:14786099-14786121 CACTCGCATTTCAAGGCCAGAGG + Intronic