ID: 1179934460

View in Genome Browser
Species Human (GRCh38)
Location 21:44593242-44593264
Sequence GCCACCCCAGGCGGGGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179934460_1179934467 4 Left 1179934460 21:44593242-44593264 CCCTCGTCCCCGCCTGGGGTGGC No data
Right 1179934467 21:44593269-44593291 CTGTGTGCTCTGCTTCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179934460 Original CRISPR GCCACCCCAGGCGGGGACGA GGG (reversed) Intronic