ID: 1179937283

View in Genome Browser
Species Human (GRCh38)
Location 21:44613601-44613623
Sequence CTCGCTTAGCAGCAATGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 47}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179937277_1179937283 -3 Left 1179937277 21:44613581-44613603 CCGCCCGCCCGAGGGTTCTGCTC 0: 1
1: 1
2: 1
3: 12
4: 111
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937270_1179937283 18 Left 1179937270 21:44613560-44613582 CCTGGTCACCCTCCCTGTGTGCC 0: 3
1: 0
2: 0
3: 29
4: 337
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937269_1179937283 23 Left 1179937269 21:44613555-44613577 CCAGGCCTGGTCACCCTCCCTGT 0: 3
1: 0
2: 2
3: 51
4: 433
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937275_1179937283 5 Left 1179937275 21:44613573-44613595 CCTGTGTGCCGCCCGCCCGAGGG 0: 2
1: 1
2: 0
3: 8
4: 69
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937278_1179937283 -6 Left 1179937278 21:44613584-44613606 CCCGCCCGAGGGTTCTGCTCGCT 0: 1
1: 0
2: 2
3: 7
4: 81
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937272_1179937283 9 Left 1179937272 21:44613569-44613591 CCTCCCTGTGTGCCGCCCGCCCG 0: 3
1: 0
2: 2
3: 16
4: 174
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937280_1179937283 -10 Left 1179937280 21:44613588-44613610 CCCGAGGGTTCTGCTCGCTTAGC 0: 1
1: 0
2: 1
3: 6
4: 48
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937271_1179937283 10 Left 1179937271 21:44613568-44613590 CCCTCCCTGTGTGCCGCCCGCCC 0: 3
1: 0
2: 2
3: 34
4: 422
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937273_1179937283 6 Left 1179937273 21:44613572-44613594 CCCTGTGTGCCGCCCGCCCGAGG 0: 2
1: 1
2: 0
3: 7
4: 113
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937279_1179937283 -7 Left 1179937279 21:44613585-44613607 CCGCCCGAGGGTTCTGCTCGCTT 0: 1
1: 0
2: 2
3: 1
4: 64
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47
1179937268_1179937283 26 Left 1179937268 21:44613552-44613574 CCTCCAGGCCTGGTCACCCTCCC 0: 3
1: 0
2: 7
3: 83
4: 680
Right 1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG 0: 1
1: 0
2: 1
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179937283 Original CRISPR CTCGCTTAGCAGCAATGCGA GGG Intronic
1064464206 10:15562974-15562996 CTCACTTAGCGCCAATGGGATGG - Intronic
1069023615 10:63517117-63517139 CTCTCTTAATAGAAATGCGAAGG + Intergenic
1074707999 10:116152542-116152564 CTCACTCATCACCAATGCGATGG + Intronic
1088369527 11:109074107-109074129 CTCGTTTAGGACCAATGAGAGGG - Intergenic
1088506199 11:110529970-110529992 CTTGCTGAGCAGGAATGAGAAGG + Intergenic
1107664092 13:42671436-42671458 CTCTCTTAACACCAATGAGATGG + Intergenic
1119102806 14:71895873-71895895 CTCTCTGAGCAGAAATGCCATGG - Intergenic
1125212561 15:37234217-37234239 CTCACTTAGCACCAAGGAGATGG - Intergenic
1126342317 15:47654636-47654658 CTCACTTATCACCAATGAGATGG - Intronic
1126651669 15:50929051-50929073 CTTGATTAGGAGCAATGAGATGG - Exonic
1129314662 15:74734208-74734230 CTCACTTAGCACCAAGGGGATGG - Intergenic
1131398233 15:92103966-92103988 CTGGCTTGGCAGCACTGCTAAGG - Intronic
1140699500 16:77568157-77568179 CTCACTTAGCAGGTATGCGCTGG + Intergenic
1141545926 16:84769133-84769155 ATCGCTTTGCAGGAATGCTATGG - Intronic
1143516845 17:7423711-7423733 CTGGCTCTGCAGCAATGGGATGG - Intergenic
1150210495 17:63438740-63438762 CTAGCGAAGCAGCAATGAGAAGG + Intronic
1157187385 18:45552313-45552335 CCCGCATAGCAGCAAGGAGAAGG + Intronic
1157478930 18:48040409-48040431 CTCCCTTAGCAGAGATTCGATGG + Exonic
927464342 2:23325685-23325707 CTGGCTTTGCAGCAAAGGGAAGG - Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
933852498 2:86381657-86381679 CTCTCTTAACAGAAATGCTAAGG - Intergenic
935349247 2:102139621-102139643 CTCGCTTATCACCAAGGGGATGG - Intronic
938911668 2:135890926-135890948 CTCACTCATCAGCAAGGCGATGG - Intergenic
943578834 2:189661316-189661338 CTCCCTAAGCAGCCATGCGCAGG + Intergenic
944508163 2:200436913-200436935 CTCGCTTATCACCAAGGGGATGG - Intronic
945755986 2:213847532-213847554 CTCACTTAGCACCAAAGGGACGG + Intronic
1177696997 21:24585786-24585808 CTCACTTATCACCAAGGCGATGG + Intergenic
1178499393 21:33113235-33113257 CTGGCTTTGCAGCAATGCCAAGG - Intergenic
1179926624 21:44538562-44538584 CCGTTTTAGCAGCAATGCGAGGG - Intronic
1179932334 21:44579040-44579062 CCCGCTTAGCAGCAATGCGGGGG - Intronic
1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG + Intronic
1184807421 22:46804068-46804090 GCAGCTCAGCAGCAATGCGATGG + Intronic
1185209705 22:49563816-49563838 CTCACTCAGCAGCAAGGGGATGG + Intronic
955130462 3:56161068-56161090 TTCACTTAGCAGCAAGGGGATGG - Intronic
957494215 3:80969671-80969693 CTCGCTCTGGAGCAATGCCATGG + Intergenic
963849357 3:150194784-150194806 CTCACTTATCACCAATGGGATGG + Intergenic
970628525 4:17916409-17916431 CTCACTTATCAGCAAGGGGATGG - Intronic
977874007 4:102128201-102128223 CTCGCTTATCACCAAGGGGATGG - Intergenic
993956077 5:94234727-94234749 CTCACTTATCACCAATGGGATGG + Intronic
998673578 5:144381660-144381682 CTCACTTATCACCAATGGGATGG + Intronic
1000435185 5:161199473-161199495 CTTGCTTAGAAGCAAGGGGACGG - Intergenic
1011448668 6:87470559-87470581 CTCACTTATCACCAAGGCGATGG + Intronic
1014680061 6:124416927-124416949 CCCACTTAGCAGCAATGAAATGG + Intronic
1023500358 7:40843542-40843564 CTCACTGAGCAGAAATGTGAAGG + Intronic
1023543021 7:41287168-41287190 CTCACTTATCATCAAGGCGATGG - Intergenic
1030086587 7:105820796-105820818 CTCACTTATCACCAAGGCGATGG - Intronic
1045564684 8:103301083-103301105 CTCTCTTAGCAACAATCTGAGGG - Intronic
1049487493 8:142874184-142874206 CAGGCTAAGCAGCAATGCCAGGG - Exonic
1050353351 9:4761013-4761035 CTCTCTTGGCAGCAATGCTGAGG - Intergenic
1055102801 9:72482565-72482587 CTGGCTTAGCACCAATTCTATGG - Intergenic