ID: 1179940486

View in Genome Browser
Species Human (GRCh38)
Location 21:44636604-44636626
Sequence GGATGAGAAAAGTGTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179940486 Original CRISPR GGATGAGAAAAGTGTCAGAT GGG (reversed) Intronic
900488841 1:2936247-2936269 GGCTGAGAACAGTGTCATCTGGG - Intergenic
903374518 1:22857488-22857510 AGATGAGAGAGGTGACAGATGGG + Intronic
904256296 1:29257153-29257175 GAAAGAACAAAGTGTCAGATTGG + Intronic
905590600 1:39159878-39159900 GGATGAGGAAAGTGGCAGACAGG + Intronic
905794706 1:40809149-40809171 AGAAGAGAGAAGTGTCAGAGAGG - Intronic
906612217 1:47211604-47211626 AGATGAGGAAAGTCTCAGAGAGG - Intergenic
906827726 1:48999592-48999614 GCACGAGAAAAGTATCAGATTGG + Intronic
907650791 1:56292911-56292933 GGCTGAGAAATGGGTCAGCTGGG + Intergenic
907972026 1:59392445-59392467 AGATGAGAAAAGTCTGATATGGG - Intronic
908777166 1:67651316-67651338 GGATCAGCAAAACGTCAGATGGG + Intergenic
910666401 1:89729440-89729462 GGAAGGGAATAGAGTCAGATTGG + Intronic
910961162 1:92765072-92765094 ACATGAGAAAACTGTCATATAGG + Intronic
911813794 1:102316728-102316750 AAATGATAAAAGTGCCAGATGGG - Intergenic
914984695 1:152446422-152446444 GTATGAGATGAGTGTCAGAATGG + Intergenic
915112004 1:153569858-153569880 GGTTGAGAAATGAGACAGATAGG - Intergenic
915973936 1:160372677-160372699 GGGAGAGAAAAGAGGCAGATGGG - Exonic
916858300 1:168774763-168774785 GGATGAGAAAAGTGTGGGCCAGG - Intergenic
919054785 1:192556468-192556490 GGATAAGATAAATGTCATATTGG + Intergenic
919504373 1:198379683-198379705 GGAAGAAAAAAGTGCCACATTGG + Intergenic
920132384 1:203742497-203742519 GGATTTGAAAAGGGTCTGATGGG + Exonic
923035269 1:230281043-230281065 GTCTGAGAAAAGCGTCAGTTAGG + Exonic
923206861 1:231767590-231767612 GGATAAGAAAAATGCCAGCTTGG - Intronic
1068055154 10:52003944-52003966 AGATGAGAAAACTGACAGAGAGG - Intronic
1068708092 10:60099642-60099664 GGGTGAAAAAAGTGACATATAGG - Intronic
1070676197 10:78413243-78413265 GAAGGAGAAAAGAGACAGATGGG + Intergenic
1076298923 10:129409804-129409826 GGATGAGTATAGTGTCTGCTTGG + Intergenic
1076329420 10:129653834-129653856 AGATGTGAAGAGTGTCAGGTGGG + Intronic
1081229696 11:40570300-40570322 AGATGAGACAAGTCTCAGAGTGG + Intronic
1081743500 11:45457239-45457261 GAATGAGGAAAGTGCAAGATGGG + Intergenic
1083051060 11:59777136-59777158 TGATAAGAAAAGTGTCAGTAAGG + Intronic
1083171713 11:60927331-60927353 GGAGCAGAAAGGTCTCAGATCGG - Exonic
1086265754 11:84995856-84995878 GGAAAAGAAAAGGGACAGATGGG - Intronic
1087624934 11:100585436-100585458 GGATAAGAACAGTGTCAGGATGG - Intergenic
1088623452 11:111710368-111710390 GCATTAGCAAAGTGTCAGAATGG - Intronic
1089247766 11:117135101-117135123 GGAAGAGAAATAAGTCAGATGGG - Intergenic
1089258949 11:117209460-117209482 GGAAGAGAAATAAGTCAGATGGG + Intronic
1089790536 11:120940016-120940038 GGAGGAGGAAATTGGCAGATTGG - Intronic
1090104068 11:123832974-123832996 GGATGAAAAAAAATTCAGATCGG + Intergenic
1091246566 11:134100751-134100773 GGATGAGAAAACAGAAAGATTGG + Intronic
1091434400 12:461198-461220 GGTTCAGAAAAGTGGCAGAAGGG - Intronic
1091461813 12:648775-648797 GGAAGAGAAAAGTGAGAAATAGG - Intronic
1093740803 12:22684721-22684743 GGATTAGAAAAGTGTCCAGTAGG + Intronic
1094719544 12:33049313-33049335 GGATCAGAAAAATGTCATTTTGG - Intergenic
1096107286 12:49003745-49003767 GGATGAGAAGGGTGAGAGATTGG - Exonic
1099446696 12:82761391-82761413 GGATGAGTACAGTGTCAGTTGGG + Intronic
1102620229 12:114188725-114188747 AGATGAGGACAGTGTCAGGTAGG + Intergenic
1105497555 13:20944141-20944163 AGAGGAGAAAAGAGTCAGTTGGG + Intergenic
1106067318 13:26367505-26367527 AGCTGAGAAAAGTGACAGACAGG - Intronic
1107881342 13:44834488-44834510 GGATGTGTGAAGTGGCAGATGGG + Intergenic
1109688640 13:65855248-65855270 GGATGAAGAATGTGTAAGATAGG + Intergenic
1111086160 13:83378181-83378203 GGATCAGAAAATTTTAAGATAGG - Intergenic
1113355078 13:109571498-109571520 GGATGAGAAAAGTGAGAGACAGG + Intergenic
1115006225 14:28488841-28488863 GCCTCAGGAAAGTGTCAGATTGG + Intergenic
1116154172 14:41182484-41182506 AGATAAGAAAAGTGTTAGAAAGG + Intergenic
1117021147 14:51571950-51571972 GGATGAGAAAACTTACAGGTAGG - Intronic
1118329291 14:64803208-64803230 AGAAGAGAAAAGTTTCTGATTGG + Intronic
1118447947 14:65868713-65868735 GGTGGAGTAAAGAGTCAGATTGG + Intergenic
1121888291 14:97564846-97564868 AGAGGTGAAAAGTGTCAGGTTGG + Intergenic
1122930325 14:104930393-104930415 GCATGAAAAACGTGTCAGAATGG + Intronic
1202834998 14_GL000009v2_random:71422-71444 GTATGAGAAGGGTGTGAGATTGG + Intergenic
1125141310 15:36410696-36410718 GGATGAGAAAAGGAGCAGCTTGG + Intergenic
1125784832 15:42307036-42307058 TGGTGAGAAATGTGACAGATGGG - Intronic
1127319321 15:57827076-57827098 GGATGAGAAAAGTATTAGGCGGG - Intergenic
1127992097 15:64127174-64127196 GGATGACAAAAGTGAAAGTTGGG + Exonic
1128352815 15:66902581-66902603 GGATTAGAAAAGTGTTTAATAGG - Intergenic
1128870161 15:71148913-71148935 GTATAATAAAAGTGTCTGATAGG + Intronic
1129893028 15:79084450-79084472 GGCTGAGAATAGTGCCAGCTGGG - Intronic
1132021161 15:98363877-98363899 GGCTGAGAAATGAGTCAGTTTGG - Intergenic
1135095667 16:19562494-19562516 AGATGAGAAAGGGGTCAAATGGG + Intronic
1135389630 16:22079715-22079737 GGATTAGTAAAGTGTCACAGTGG - Intronic
1136581163 16:31151709-31151731 GGATGAGATGAGAGTGAGATGGG - Intergenic
1137534113 16:49304578-49304600 GGATGAGAAGTCTGCCAGATCGG - Intergenic
1137766157 16:50979299-50979321 GGATGACAAAAATGCCAGAGTGG - Intergenic
1137975128 16:53024727-53024749 GGATGAGAAAAGCATGAGTTTGG + Intergenic
1138356286 16:56383636-56383658 GGATGAGAGAAGTGGCTGAATGG - Intronic
1139110400 16:63883629-63883651 GGGTGTGAAAAGTGCTAGATAGG + Intergenic
1140650137 16:77079235-77079257 GGAACAGAAAAGTGTGAGGTTGG - Intergenic
1140677603 16:77348573-77348595 GGATGAGAGAAGAGGCAGAGGGG + Intronic
1141918278 16:87116264-87116286 GTATTAGAAAAGTGTCTGCTTGG - Intronic
1144220977 17:13099567-13099589 GGAAAAGAAAAGTGTCAGGGAGG - Intergenic
1150572516 17:66399866-66399888 GGATCAGAAATGGTTCAGATTGG + Intronic
1150979917 17:70129469-70129491 GGCTGAGAAATGGGTCAGATTGG + Intronic
1151078383 17:71300395-71300417 GGAGAAGAAAAGTGTCTGTTGGG + Intergenic
1151818334 17:76482800-76482822 GGGGGAGAAAAGTGCCAGACAGG - Intronic
1156118429 18:33815357-33815379 GACTCAGAAAAATGTCAGATTGG - Intergenic
1157093981 18:44669851-44669873 GGTTGAAAAAAATGTCAGACAGG + Intergenic
1158393715 18:57063677-57063699 GGATGGGAAAATTGTGGGATGGG - Intergenic
1162067595 19:8135799-8135821 GGATAAGAAGAGTCTCAGGTGGG + Intronic
1164086420 19:21906896-21906918 GCAGGAGAAAAGAGTCACATGGG - Intergenic
1164707641 19:30332262-30332284 GGGCCAGAAAAGTGGCAGATTGG - Intronic
1164872496 19:31657568-31657590 GGAGGAGAAGGGTGTCAGACTGG - Intergenic
1165212811 19:34249244-34249266 GGATGTGAAAGCTGTGAGATAGG + Intergenic
1165385932 19:35510726-35510748 GGTCGGGAAAAGTGTCAGACAGG - Intronic
926459392 2:13110101-13110123 AGATGAGAAAATTGTCTGAAGGG + Intergenic
927011192 2:18906340-18906362 GCATGAGAAAAATGTCAGCCTGG - Intergenic
927090188 2:19704768-19704790 GGAGGGGAAAGGTGTCAGGTAGG - Intergenic
927496233 2:23553697-23553719 GGCTGAGAAGAGTGACAGGTGGG - Intronic
927791654 2:26014861-26014883 GGAAAAAAAAAGTGTCAGAGGGG - Intergenic
931218445 2:60267364-60267386 GGCTGGGAAAAGTCTCAGAAAGG - Intergenic
931324249 2:61201980-61202002 GGATGAGAATATATTCAGATTGG - Intronic
931453360 2:62387256-62387278 GGACCAGAAATGTTTCAGATTGG - Intergenic
932021287 2:68089857-68089879 GGAGGGAAAAAGTGTTAGATGGG - Intronic
932274391 2:70441217-70441239 GTAAGAGAACAGTGTCATATGGG - Intergenic
932647082 2:73513561-73513583 GGATGAGAAGGGTGTCATACAGG - Intronic
932853406 2:75209557-75209579 GGTTGAGGAAACTGGCAGATAGG - Intergenic
932877932 2:75472991-75473013 GGATGAGTGAAGGGTGAGATGGG + Intronic
933204413 2:79489006-79489028 GAATGAGAAAACTGTCAGCCTGG - Intronic
934875963 2:97920368-97920390 AGATGAGGAAAGTGTCAAAGAGG + Intronic
935697910 2:105786015-105786037 AAATGAGAAAATTGACAGATGGG - Intronic
936833487 2:116678485-116678507 GGATGAGAAAGGTGACAGGAAGG + Intergenic
936846153 2:116836078-116836100 GGAAAAGAAAGGTTTCAGATGGG + Intergenic
937018728 2:118631387-118631409 GGATGAGGAAAGGGGCAGAGGGG - Intergenic
939149339 2:138455256-138455278 AGATGAAAAAAATGGCAGATAGG + Intergenic
939410524 2:141818885-141818907 TGATTAGAAATGTGTTAGATAGG - Intronic
939728090 2:145748386-145748408 GGATGAGAAAATAGACAGAGAGG + Intergenic
939790553 2:146569100-146569122 GGTTGAAGAAACTGTCAGATTGG + Intergenic
939904455 2:147893815-147893837 GGATGAAAAAAGTCACAGACTGG - Intronic
940016923 2:149116564-149116586 GGATGAGAAAAGGGTCAAAGTGG - Intronic
941329913 2:164167385-164167407 AGATGAGATTAGTGGCAGATTGG - Intergenic
942404466 2:175639157-175639179 GGATGGGAAATGTTTGAGATGGG + Intergenic
942559460 2:177205042-177205064 GGATGAGGAAAGGGACAGAGTGG - Intergenic
943740864 2:191406966-191406988 AGATGAGGAAAGCATCAGATGGG + Intronic
945377950 2:209101360-209101382 AGTTGAGAAAAGTTTCACATGGG + Intergenic
945768312 2:214008145-214008167 GGGTGAGCAAAATATCAGATTGG - Intronic
946350367 2:219147177-219147199 GGCAGAGAAAAGTGTCACCTAGG + Intronic
946918091 2:224547371-224547393 GAATGAGAAAAATGGCAGGTAGG - Intronic
947155112 2:227154398-227154420 GGAGGAGAAATGTCTAAGATTGG + Intronic
1169263282 20:4152964-4152986 GCATGAGAGAAGTGGCAGAGTGG - Intronic
1169568809 20:6884901-6884923 GGATGAAAAGAGTGTCAAATTGG + Intergenic
1169870258 20:10241527-10241549 GGACAAGAAAAATATCAGATGGG + Intronic
1169934246 20:10865871-10865893 GGAAGAGAACAGGGTCAGAAGGG + Intergenic
1169959708 20:11145679-11145701 AGCTTAGAAAAGTGTCAGACAGG + Intergenic
1172084057 20:32364867-32364889 GGATGACAACAGAGTCAGAATGG + Intronic
1172107389 20:32524860-32524882 GCATGAGAAGGGTGACAGATGGG + Intronic
1172213521 20:33217498-33217520 AGATGTCAAGAGTGTCAGATGGG - Exonic
1172982321 20:38953116-38953138 TAAAGAGAAAAGTGTCAGAGGGG - Intergenic
1172997850 20:39083947-39083969 GAATGTGACAAGTGGCAGATGGG + Intergenic
1173403633 20:42746297-42746319 GAAAGAGAAAAATGACAGATGGG - Intronic
1174487074 20:50868063-50868085 GCATGAGAAAAACATCAGATAGG - Intronic
1176409243 21:6438878-6438900 GGCTGAGAACAGTTTCAGTTCGG - Intergenic
1177269995 21:18835171-18835193 TTATAAGAAAACTGTCAGATAGG - Intergenic
1179684738 21:43047200-43047222 GGCTGAGAACAGTTTCAGTTCGG - Intergenic
1179940486 21:44636604-44636626 GGATGAGAAAAGTGTCAGATGGG - Intronic
1181957375 22:26597822-26597844 GGAGGAAAAAAGTCTCAGTTTGG + Intergenic
1182300303 22:29333371-29333393 AGAGGATTAAAGTGTCAGATGGG - Intronic
1183403959 22:37620788-37620810 GGATTAGATGAGTGTCAGAAAGG - Intronic
1183682271 22:39339363-39339385 GGAGGAGAAAACGGTAAGATGGG - Intergenic
1184164076 22:42717166-42717188 GGAAGACAAAGGTGGCAGATGGG + Intronic
949194854 3:1292707-1292729 GGATAAGAAGAGTGTCAGAAAGG - Intronic
950535891 3:13577920-13577942 GGAAGAGAAAACTGTCATCTTGG + Intronic
950816637 3:15710768-15710790 GGAAGAGGAAAGTTTGAGATTGG - Intronic
951797744 3:26560021-26560043 AGATGAGAAAAGTGTCAGTACGG + Intergenic
952183363 3:30942493-30942515 GAATGAGGAAAATGGCAGATAGG - Intergenic
954830000 3:53412657-53412679 GGATGTGGAAAGTATCAGGTGGG - Intergenic
955286670 3:57647960-57647982 GGATGAGAAAACTATTAGCTTGG + Intronic
959328244 3:104966586-104966608 GGATTAGAAAAATTTCACATAGG - Intergenic
964518108 3:157534393-157534415 GGCTGTGAGAAGTGTCAGAAAGG - Intergenic
966807883 3:183820453-183820475 GGATGAAGAAAGGGTCAGAGAGG + Intronic
967016132 3:185483433-185483455 GGAGGAGAAAAGGGTGAGAGAGG + Exonic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970879382 4:20910475-20910497 GGATGAGGAAAGTGAAACATGGG + Intronic
972057297 4:34819281-34819303 TAGTGAGAAAAGTGTCTGATAGG - Intergenic
974193408 4:58537889-58537911 GGAAGAAAAATGTGTCAGAAAGG - Intergenic
976058265 4:81095075-81095097 GGATGAGAAGAGAGTGAGAAAGG - Intronic
977559189 4:98515386-98515408 GGTTGAGAAATGTGTCAGGAGGG - Intronic
977702806 4:100039056-100039078 GGGTGACAAAAGTGTCAAACTGG + Intergenic
982986300 4:162211594-162211616 GGAAGAGAAAAGAATGAGATAGG - Intergenic
984275093 4:177599713-177599735 CGATGAGAAAAGTTTTAAATTGG + Intergenic
984501239 4:180562044-180562066 GGAGGAGAAAAGTGTAAGTAGGG - Intergenic
985547601 5:517848-517870 GGATGAGTGAATGGTCAGATGGG - Intronic
986048381 5:4063385-4063407 GGATAAGAAAAGAGTTTGATTGG - Intergenic
986129636 5:4915644-4915666 GGATAAGAATAATGGCAGATAGG + Intergenic
987925327 5:24333908-24333930 GGATGGGTAAAGTGTGATATGGG - Intergenic
990361006 5:55020031-55020053 GGATGAGGAAAGTGCCACATGGG - Intronic
991588721 5:68226340-68226362 GTGTGACAAAAGTGTCAGAAAGG + Exonic
993041896 5:82823982-82824004 GGGTGAGAAAAGTGAGTGATGGG + Intergenic
993566831 5:89486963-89486985 GGATGAGGAAAGTGCAAAATTGG + Intergenic
994499151 5:100552106-100552128 AGATGAGAATGATGTCAGATTGG + Intronic
995380322 5:111524473-111524495 AGATGATAAAAGTTGCAGATGGG + Intergenic
996031177 5:118705424-118705446 AGATGAGAAAAGGGACAAATGGG + Intergenic
997358091 5:133277337-133277359 GGATGATAATTGTGTCAGGTAGG + Intronic
998005289 5:138652693-138652715 TGATGAGAAACGGGTCAGACAGG + Intronic
998101735 5:139440152-139440174 AGAGGAGAAAAGTGTCAGAGGGG - Intronic
998820537 5:146053785-146053807 GGTGGAGAAAAGTGACAAATGGG + Intronic
999948351 5:156621929-156621951 GTATGAGAAAACTGACAAATAGG + Intronic
999975869 5:156911552-156911574 GTAAGAGAAAAGTGGGAGATTGG - Intergenic
1000458919 5:161487654-161487676 AGATGAGAAAACTGACAGAAAGG - Intronic
1002047443 5:176549876-176549898 GGATGAGAAGAGTTCCAGAAAGG + Intronic
1002202323 5:177536758-177536780 GGAGGAGAAAGGGGTCAGAATGG + Intronic
1003873038 6:10416679-10416701 GGATGGGAACTGTGGCAGATTGG + Intronic
1004362989 6:14987412-14987434 GGAGGAGAAAAGTCTGAAATAGG + Intergenic
1010342750 6:74775344-74775366 TGATTAGAAAAGTGTCAGCTAGG + Intergenic
1010873494 6:81070909-81070931 GAATAAGAAAAGTTTCAGTTTGG - Intergenic
1012546328 6:100423725-100423747 GCATGAGAAAAAACTCAGATGGG + Intronic
1012790532 6:103688373-103688395 GGAAGAAAATAGTGTCAAATAGG + Intergenic
1012802051 6:103842982-103843004 GGAAGGGAAAAGTGCCAGAAGGG + Intergenic
1013168942 6:107619005-107619027 GGCTGAGAAAAGTGCCACAAGGG + Intronic
1016923046 6:149315591-149315613 GGAGGAGAAAAATGTCATATAGG - Intronic
1020265598 7:6557877-6557899 GGCTGAGAAAATTGGCAGAAGGG + Intergenic
1021503489 7:21355450-21355472 GAAAGAGCAAAATGTCAGATTGG + Intergenic
1022157581 7:27675718-27675740 GGATGAGAAAAGTCACAGTTGGG - Intergenic
1022757477 7:33309035-33309057 GGCTCAGAGAAGTGACAGATTGG - Intronic
1023189626 7:37565859-37565881 GGATGAGAAATGTACCAAATAGG - Intergenic
1023383088 7:39627792-39627814 GAATGGGAAAAGTATCAGATGGG - Intronic
1023760262 7:43459096-43459118 GGATGAGATATGTTTCAGGTGGG - Intronic
1024578054 7:50781032-50781054 GGGTGAGAGAAGTTCCAGATTGG - Intronic
1024966896 7:55031528-55031550 GAATGAGAAAAGTCCCAGAAGGG + Intronic
1027220417 7:76210367-76210389 GAATGACATATGTGTCAGATAGG - Intronic
1027776846 7:82475686-82475708 AGATTAGAAAAGGGACAGATGGG - Intergenic
1027946909 7:84758844-84758866 GGATGCTAAAAGTCTGAGATCGG + Intergenic
1029391753 7:100279897-100279919 GGCTGGGAATAGTGGCAGATGGG - Intergenic
1030372798 7:108719449-108719471 GGATGAGAGAAGTGGCAGTGGGG - Intergenic
1030557476 7:111044744-111044766 GGATAAAAAAAGTATCAAATTGG - Intronic
1031550989 7:123111327-123111349 GGATGACAGAAGAGTCAGATGGG - Intergenic
1032285725 7:130537224-130537246 GGATGAGAAAAGAATCAGGAAGG + Intronic
1032286488 7:130541650-130541672 GGATGAGAAAAGAATCAGGAAGG + Intronic
1032773127 7:135079834-135079856 GGAAGATAAAAGTGTGAAATGGG - Intronic
1033988050 7:147250547-147250569 GGTTGACAAGACTGTCAGATGGG - Intronic
1034422691 7:150997685-150997707 GGGTCAGGCAAGTGTCAGATAGG - Intronic
1035653924 8:1291316-1291338 GGATGGGAAAAGTGTGAAAATGG + Intergenic
1036616044 8:10388564-10388586 GCATCAGAAAAGTGAGAGATCGG - Intronic
1039513965 8:38115817-38115839 GGATCAGAATAGTTTCAGAATGG - Intronic
1039547657 8:38421422-38421444 GCATCTGAAAAGTCTCAGATAGG - Intronic
1039795173 8:40906671-40906693 GGATCAAGAAAGTGACAGATGGG + Intergenic
1040914975 8:52559462-52559484 GGAGGAGAAAGGTGGCATATTGG - Intronic
1041277900 8:56182067-56182089 AGATGAGAAAAGTGCCCAATGGG + Intronic
1042955529 8:74246128-74246150 TGAGGCGAAAAGTGGCAGATGGG - Intronic
1043520410 8:81039162-81039184 GGCTCAGAAAAGCGTCACATAGG - Intronic
1044319438 8:90786005-90786027 AGATGAGAAGAGAGCCAGATTGG + Intronic
1044340206 8:91038275-91038297 GAAAGAGAAAGGGGTCAGATTGG + Intronic
1044467121 8:92520457-92520479 TGATGAGGAAAGTGACAGACTGG - Intergenic
1046049968 8:109011107-109011129 GGATGAGAAAAGAGACATAAGGG - Intergenic
1047803353 8:128332805-128332827 GGAGGAGAAAAATGTCAGGCTGG - Intergenic
1048747382 8:137630038-137630060 GGATGAGAAAAGTGAGAAACGGG + Intergenic
1049190044 8:141282273-141282295 GGAGGAGCATAGTGTCAGGTCGG - Intronic
1049517058 8:143065601-143065623 GGAGGAGAATTCTGTCAGATTGG - Intergenic
1050488676 9:6163877-6163899 AGATGAGAAAAGTGAGATATAGG - Intergenic
1052608879 9:30743361-30743383 GGATAAGAAACTTGTCAAATAGG - Intergenic
1055254102 9:74345526-74345548 GGATGATTAGAGTGTCAGAAAGG - Intergenic
1056472328 9:86918068-86918090 GCAAGAGAAAAGTCTCAAATTGG + Intergenic
1059126703 9:111695046-111695068 GGAGGAAAACAGTGTCAGACAGG - Intronic
1059327205 9:113511291-113511313 GGAGGAGAAAAGGGTGATATGGG + Intronic
1059784862 9:117570459-117570481 GGATGAGAGAAGAGATAGATAGG + Intergenic
1060637238 9:125209031-125209053 GGTTGAGAAAAGTCTGAAATAGG - Intronic
1061662322 9:132138448-132138470 GGATGATAACAGTGCCTGATTGG + Intergenic
1187060721 X:15784436-15784458 GGGAGAGAAACTTGTCAGATAGG + Exonic
1188157911 X:26764163-26764185 GGGTAAGAAAAATGGCAGATTGG + Intergenic
1188627144 X:32298752-32298774 GGATAAGAAAAATGTCAAGTTGG + Intronic
1188646853 X:32579371-32579393 AGATGAGGAAACTGACAGATAGG + Intronic
1190152050 X:47957100-47957122 CGATGGGAAAAGGGGCAGATTGG + Intronic
1190160610 X:48029049-48029071 CGATGGGAAAAGGGGCAGATTGG - Intronic
1191916747 X:66209478-66209500 GGATGAAAAAAGGGACATATGGG + Intronic
1197007018 X:121514044-121514066 AGATTAGAAAAGTGTCTGTTTGG + Intergenic
1197119738 X:122876193-122876215 CTTTTAGAAAAGTGTCAGATAGG - Intergenic
1198550287 X:137737847-137737869 AGATGGGAAAAGTGACAGACAGG + Intergenic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic
1200894139 Y:8356572-8356594 GAATGACAAATGTGTCAGCTAGG + Intergenic
1200917207 Y:8581865-8581887 TGAGCAGAAAAGTGTCACATAGG + Intergenic