ID: 1179943467

View in Genome Browser
Species Human (GRCh38)
Location 21:44654597-44654619
Sequence GTGGCTGGTGTGGCACATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179943460_1179943467 6 Left 1179943460 21:44654568-44654590 CCAGGGCAGGCCATTGGGCAGCC 0: 1
1: 0
2: 7
3: 26
4: 254
Right 1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG 0: 1
1: 0
2: 4
3: 24
4: 228
1179943461_1179943467 -4 Left 1179943461 21:44654578-44654600 CCATTGGGCAGCCCGAAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG 0: 1
1: 0
2: 4
3: 24
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179943467 Original CRISPR GTGGCTGGTGTGGCACATGA TGG Exonic
900147308 1:1163866-1163888 GTGGCTGGTCTGGTACAGGTGGG + Intergenic
900161399 1:1225618-1225640 GTGGCAGGTGGGGCACCTGGTGG + Intronic
900402362 1:2477821-2477843 GTGGCGCTTGTTGCACATGAGGG + Intronic
900800575 1:4734669-4734691 GGGGCTGGAGTGGCACCTGTGGG + Intronic
901806359 1:11741085-11741107 GTGGCTGGAGTGGAAGGTGAGGG - Intronic
902162805 1:14545318-14545340 GTGGTGGGTGTTGCACATGGAGG - Intergenic
903260084 1:22126927-22126949 TTGGCTGGTGAGGCAGATGGAGG - Intronic
904615297 1:31746311-31746333 TAGGCTCGGGTGGCACATGAGGG - Intronic
907706701 1:56838841-56838863 TTGGCTGGGGTGGCTCATGTGGG + Intergenic
911265891 1:95742840-95742862 GTGGCTGCTGTGGGATATGGGGG + Intergenic
911708728 1:101044430-101044452 GTGGCTGGTGTCTGAAATGAGGG - Intergenic
914026565 1:143917725-143917747 GAGGCTGGTCAGGCCCATGAAGG + Intergenic
914664945 1:149825155-149825177 GAGGCTGGTCAGGCCCATGAAGG + Intergenic
914670820 1:149868665-149868687 GAGGCTGGTCAGGCCCATGAAGG - Intronic
915565151 1:156708818-156708840 GTGGCTGGTCTTACACCTGAAGG + Intergenic
919849184 1:201660887-201660909 GTGGCAGGGGGAGCACATGAGGG + Intronic
921874301 1:220176834-220176856 GAGGCTGGTGTGTCTCATGTTGG - Intronic
922776135 1:228214996-228215018 GTGGCTGATGTGGCGGAGGAGGG + Exonic
922880862 1:228979430-228979452 GTGGGTGGTGTGGCACAGAGTGG - Intergenic
1063425186 10:5945273-5945295 GTGGCTGCAGAGGCACCTGAGGG - Intronic
1064789565 10:18940866-18940888 GTGGCTGCTGTGGCATTTGTGGG - Intergenic
1065462348 10:25982211-25982233 GTGGCTGCTGTGGGGCATGACGG - Intronic
1069211357 10:65764070-65764092 TTGGCTAGTGTGGGACATAAGGG + Intergenic
1069915414 10:71784028-71784050 CTGCTTGGTCTGGCACATGAGGG + Intronic
1070282957 10:75063122-75063144 GTGGGGAGTGTGGCACATCAGGG + Intergenic
1070697178 10:78572026-78572048 GTGGGTGGTGGGGCACAGGTGGG + Intergenic
1070803140 10:79255150-79255172 GTGGCTGCTGTGGGGAATGAGGG - Intronic
1071520927 10:86331074-86331096 GTGGCAGGGATGGCACATGCAGG + Intronic
1072609767 10:97010415-97010437 GGGGCTGGTGTGACAGATAAAGG + Intronic
1074118656 10:110476935-110476957 GTGGCAGGGGTGGGGCATGAGGG - Intergenic
1074300481 10:112228672-112228694 GAGGCTGCAGTGACACATGATGG + Intergenic
1074983210 10:118635983-118636005 GAGGCTGGGGTGGCAGATGGGGG - Intergenic
1075464462 10:122641273-122641295 GGGGCTGGAGTTGCACATCATGG - Intronic
1075796580 10:125124206-125124228 AAGGCTGGTGTGGCATTTGAGGG - Intronic
1076666311 10:132094903-132094925 GTGGCTGCTGTGGGGCATGGGGG + Intergenic
1076940961 10:133608188-133608210 CTTCCTGGTGTGGCTCATGATGG - Intergenic
1077234811 11:1475629-1475651 GTGGCTGGGGTCGCATATCAGGG + Intronic
1078965578 11:16336770-16336792 GTGGCTGGTGAGGCAGAGAATGG - Intronic
1079351050 11:19692268-19692290 GTGCCTGGTGAGTCACATGCAGG - Intronic
1080672549 11:34394749-34394771 ATGGCTGCTGTGGCAGATGGGGG + Intergenic
1082620603 11:55417020-55417042 GTATCTGGTGTGTCACATGTTGG + Intergenic
1082807984 11:57462015-57462037 GTGGCTGGTGGGCCAGATGGGGG + Intronic
1084399522 11:68935631-68935653 GTGGCTGGGGTGGCAGCTGGGGG + Intronic
1084457964 11:69279297-69279319 ATGGCTGGTGGGTAACATGATGG - Intergenic
1088849746 11:113695188-113695210 GTGGCTGGTGAGGGACATGATGG + Intronic
1089572422 11:119419389-119419411 GTGACTGGTGGGGCCCATGGAGG - Exonic
1089775374 11:120832002-120832024 GAGGATGGTGTGGGACATGGAGG - Exonic
1090777497 11:129978233-129978255 GTGGACAGTGAGGCACATGATGG + Intronic
1091452334 12:580761-580783 GTGGCTGCCGTGGCATATGGAGG - Intronic
1091819898 12:3468147-3468169 GTGGCTGGTGAGTCTCAGGAGGG + Intronic
1092074455 12:5661631-5661653 GAGGCTGGGATGGGACATGAGGG + Intronic
1092533065 12:9361284-9361306 GTGGCTGGTGAGTCTCAGGAGGG - Intergenic
1093604499 12:21073768-21073790 GTGGCTGCTGTGGGGGATGAGGG + Intronic
1095620540 12:44248572-44248594 CTGGCAGATGTGGCACATGTGGG + Intronic
1096571093 12:52523796-52523818 GGGGCTGGGGTGGCACGTGCAGG - Intergenic
1097295487 12:57958200-57958222 GTGACTGTTGTGGGAGATGAGGG - Intergenic
1098500595 12:71187511-71187533 GTGGCTGCTGTGGGAGATGGGGG - Intronic
1098590060 12:72200597-72200619 GTGGCTGGATTGGGACATGCAGG + Intronic
1099851154 12:88098931-88098953 CTGCCTGGTGTGGCCCCTGATGG - Intronic
1100669514 12:96795455-96795477 GTGGCTGCTGTGGGAGATGATGG + Intronic
1101376545 12:104176075-104176097 GTGGCTGTTGTGGCTGTTGAGGG + Intergenic
1101785704 12:107881537-107881559 GAGGCTGGTTTCGCACATTAAGG + Intergenic
1103922663 12:124407178-124407200 GTGGCTGGTGTGCCCCTTGGGGG - Intronic
1104479625 12:129096280-129096302 GTGGCATGTGAGGCATATGACGG - Intronic
1107009747 13:35657015-35657037 GGGGATGGAGTGGGACATGAAGG - Intronic
1107514560 13:41116320-41116342 GTGGATGGTGAGGCAGATGGAGG + Intergenic
1108298724 13:49052893-49052915 GTGGCTGCTGTGGGAGATGAGGG + Intronic
1108469790 13:50756390-50756412 GTGGCTGCTGTGGGAGATGAGGG + Intronic
1108831664 13:54487006-54487028 GTGGCTGCTGTGGGGCATGAGGG - Intergenic
1110748085 13:79079549-79079571 GTGGCTGCTCTGGCAGATGCGGG - Intergenic
1111686219 13:91503820-91503842 CAGGCTGTTGTGGCACATTAGGG + Intronic
1113063383 13:106349420-106349442 GGGGATGATGTGGCACAGGAAGG + Intergenic
1113672510 13:112184551-112184573 GAGTCTGGTGTGGCACAGCAGGG - Intergenic
1113875599 13:113592741-113592763 GTGACAGGTGTGGCATATGCTGG + Intronic
1114787958 14:25622742-25622764 GTGGTATGTGTGGCAAATGAGGG + Intergenic
1114995306 14:28343285-28343307 GTGGCTTTTGTGTCACATGGTGG - Intergenic
1116111751 14:40594121-40594143 GTGGCTAGTGTGACAGAGGAAGG - Intergenic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1116876593 14:50118424-50118446 GTGGCAGTTTTGGCAGATGAGGG + Exonic
1117606199 14:57431388-57431410 GTGGCTGATGTGGTACCTTAAGG - Intergenic
1117786530 14:59291732-59291754 ATCGCTGGTTTGGAACATGAAGG - Intronic
1118223755 14:63879522-63879544 GTGGCTGGTGTATCCTATGAAGG + Intronic
1119697041 14:76721280-76721302 GTAGCTGGTGTGACCCAGGATGG - Intergenic
1119731058 14:76951311-76951333 GTGGCTTGTGGGGCCCACGAGGG - Intergenic
1121328150 14:93033807-93033829 GTGTGTGGTGGGGCACAGGAGGG + Intronic
1121565851 14:94908546-94908568 GAGGCTGGTGTGGAAAATGGAGG + Intergenic
1121728151 14:96167839-96167861 GTTGATGGTGAGGCCCATGAGGG - Intergenic
1122987312 14:105218442-105218464 GTGGCTGGGATGGCAGATGTGGG - Intronic
1125514553 15:40310508-40310530 CTGGCAGCTGTGGCACCTGAAGG - Intergenic
1128999163 15:72318972-72318994 GGGGCTGTTGTTGAACATGAGGG + Intronic
1129826647 15:78638819-78638841 GTGGCAGGGGTGGCCCAGGATGG + Intronic
1130398799 15:83529954-83529976 ATGGGTGGTGTGGCACACCAGGG - Intronic
1131340109 15:91591025-91591047 CTGGCTGGGGTGGCGCATGCCGG + Intergenic
1132457120 16:30103-30125 GAGGCTGGGCTGGCACATGGAGG - Intergenic
1134624731 16:15715323-15715345 GTAGCTGGTGTGTCACCTGGAGG + Intronic
1135193441 16:20374449-20374471 ATGCCTGGTGTTGCACATAAAGG + Intronic
1137487107 16:48900662-48900684 GTGGCTGATGTGGCAGAGGAGGG - Intergenic
1137628636 16:49926111-49926133 GTGTCTGTTGTGGCAAAAGATGG - Intergenic
1139370725 16:66467867-66467889 GGGGCAGGTGTGGCCCATGCTGG - Intronic
1142680994 17:1548576-1548598 GTGGCTGGTGGGGCACGTCGTGG - Intronic
1143130116 17:4672562-4672584 GGGGGTGGTGTGGCACCTGAGGG + Exonic
1143594411 17:7905945-7905967 GTGGCTGGTGCGGGACCTGAGGG + Exonic
1144729116 17:17516697-17516719 CAGGCTGGTCTGGCACCTGAGGG - Intronic
1145013540 17:19382924-19382946 GTGGCTGATGGGCCACAGGATGG + Exonic
1145899810 17:28483162-28483184 GTGGCAGGTGTGGGACCTGTGGG - Intronic
1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG + Intronic
1147538972 17:41340714-41340736 CTGGCTGCTGTGAAACATGAGGG - Intergenic
1147589072 17:41669647-41669669 GTGGCTGCTGTGTCGAATGAAGG + Intergenic
1147953457 17:44119743-44119765 CTGTCTGGGGTGGGACATGAAGG + Intronic
1148018541 17:44539060-44539082 CTGGCTGGTGTGGCATCAGAGGG + Intergenic
1152794781 17:82301588-82301610 GGGGCAGGGGTGGCTCATGATGG + Intergenic
1152961109 18:80624-80646 GAGGCTGGGCTGGCACATGGAGG - Intergenic
1156378078 18:36532409-36532431 GTGGCTTCTGTGGCACCTGGGGG + Intronic
1157687566 18:49654951-49654973 AAGGATGGGGTGGCACATGATGG + Intergenic
1157815666 18:50728055-50728077 GTGACTGGAGAGGCACAGGAAGG - Intronic
1158403742 18:57143142-57143164 CTGGCTGGAGCAGCACATGATGG + Intergenic
1158945221 18:62442106-62442128 GTGCCTGGGGTGCCCCATGATGG - Intergenic
1164950581 19:32333468-32333490 GCGGTTAGTGAGGCACATGAAGG + Intergenic
1165710549 19:38007693-38007715 GTGCCTGGTATGGAAAATGAAGG - Intronic
1166072629 19:40395809-40395831 GTGGATGGTGAGGCTCATGTGGG - Exonic
1166733678 19:45072141-45072163 CTGGCTGGTGTCGGCCATGAGGG + Exonic
1168073051 19:53963288-53963310 GTTGGTGGTGTTGCAGATGAGGG - Exonic
1168264869 19:55217180-55217202 GTGGCTGGTGCGGCTCCCGATGG + Intergenic
926076982 2:9950503-9950525 GTGGCTGGTGGGGCACAGGGAGG - Intergenic
926493653 2:13557269-13557291 GAGGCAGGTGTGGCACATGTGGG - Intergenic
927176818 2:20415682-20415704 GTGGCTGTTGTGGGAGATGGGGG + Intergenic
927450365 2:23204465-23204487 GTGGATGGGGTGCCCCATGATGG - Intergenic
927523078 2:23712965-23712987 CTGGCTGGTGCTGCACATCAGGG - Intergenic
928270719 2:29852407-29852429 CTGGCTGGTGTGGCCCATCTTGG - Intronic
928816564 2:35302468-35302490 GGAGCTGGTGTGTCACATGGTGG - Intergenic
929941574 2:46337912-46337934 GGGGCTGGTGTGCCAGCTGAGGG + Intronic
930735732 2:54776721-54776743 GGGGGTGGGGTGGCACAGGAGGG - Intronic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
931494371 2:62786179-62786201 GTGGTTGGGGTAGAACATGAGGG + Intronic
931993015 2:67809780-67809802 GTGGCTGCTGTGGCAGATGGGGG - Intergenic
935316427 2:101839211-101839233 GTGGCTAGTATGGCAAATGTAGG + Intronic
937328292 2:121005423-121005445 GGTGCTGGGATGGCACATGATGG + Intergenic
938790333 2:134670490-134670512 GTGGCTGTTGTGGTAGAGGAAGG - Intronic
942484242 2:176422569-176422591 GTGGGTGTTGTGACAGATGAGGG + Intergenic
942990072 2:182189954-182189976 AAGGCTGGTGTTGCTCATGAAGG - Intronic
945989199 2:216379615-216379637 GAGACTGATGTGGCACATTAGGG + Intergenic
946036453 2:216746264-216746286 GTGGCTGCTATGGGACATGGGGG - Intergenic
946228889 2:218279554-218279576 GAGGCTGGTGTTGGACAGGAGGG - Intronic
946758757 2:222972621-222972643 GTGGCTGCTGGGGCAGGTGAAGG + Intergenic
946810065 2:223514268-223514290 GTGGTTGGTGAGTCACATTAGGG + Intergenic
946812973 2:223545967-223545989 GTGGCTTGCGTGGCTCCTGAAGG - Intergenic
947524619 2:230870585-230870607 GTGGCAGGTGTGGCAGAGAAGGG - Intronic
947645837 2:231739099-231739121 GTCCCTGGTGTGGAGCATGAAGG - Exonic
947838981 2:233195441-233195463 GTGGCTGGTGAGGCTCTTCAGGG - Exonic
948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG + Intronic
948315848 2:237027626-237027648 GTGGCCGGTGGGTGACATGAAGG + Intergenic
1171509937 20:25673962-25673984 TTGGCTGGTGGGGCACAGGTAGG - Intergenic
1172705263 20:36878108-36878130 GTGGCTGGTGTAGGGCAGGAGGG - Intronic
1172900748 20:38332845-38332867 GTGGCTGGTGTTGAACAGCATGG - Intronic
1173024045 20:39291277-39291299 GTGGCTGGTGTCTTAAATGAAGG + Intergenic
1173860271 20:46278436-46278458 GTGGCTGGGGTGGCAGAGGCAGG - Intronic
1174114599 20:48218281-48218303 GTGTCTGGTGTGGCAGAGGAAGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179403478 21:41106294-41106316 GTGGCCGGTGTGTCACATGTTGG + Intergenic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG + Exonic
1179943922 21:44657975-44657997 GCAGCTGGTGTGGCACATGGTGG - Exonic
1179946581 21:44682106-44682128 GCAGCTGGTGTGGCACATGGTGG + Exonic
1182521262 22:30885755-30885777 GTGGCTGCTGTTGCTCATTATGG - Intronic
1182737002 22:32537916-32537938 GTGGATGGTGAGGCACTGGACGG + Intronic
1183404900 22:37625655-37625677 GGGGCTGGTGTGGCCAAGGAAGG + Intronic
1183428029 22:37750121-37750143 CTGCCTGATGTGGCAAATGACGG - Intronic
1184254349 22:43278607-43278629 GTGGCTGAGGTGGCTCAGGAGGG + Intronic
1184669748 22:46006491-46006513 GTGGCTGCAGTGACACATGGTGG - Intergenic
1184806373 22:46797127-46797149 GTGCCTGGGGTGGCAGATCAGGG - Intronic
1184914357 22:47559001-47559023 ATGGCTGGGTTGGGACATGAGGG + Intergenic
1185296973 22:50059138-50059160 GGGGCTGGTGGGGGACTTGAAGG + Intergenic
949799172 3:7884303-7884325 GTGGCTGCTGTGGCAGATTGGGG - Intergenic
950151266 3:10689245-10689267 GTGGGTGGCGGGGCACATGAGGG + Intronic
955621074 3:60864558-60864580 GTGGATGGTGTGGCATATTCTGG + Intronic
956240304 3:67122681-67122703 GTGTTTGGGGTGGCAGATGAAGG - Intergenic
956296829 3:67724112-67724134 TTGGCTGCTGTGGCTCAGGAAGG + Intergenic
963141612 3:141950365-141950387 ATGGCTGGGGTGGCCAATGATGG + Intergenic
964335115 3:155646465-155646487 GAGGCTGGAGTTGCACATTATGG - Intronic
969827331 4:9767862-9767884 GTGGCAGGTGTGGCTACTGAAGG - Intergenic
970437602 4:16050494-16050516 CTGGATGTGGTGGCACATGACGG - Intronic
972330172 4:38057100-38057122 TTGGGTGGTGGGGCACAGGAGGG - Intronic
977635544 4:99293781-99293803 GTGGCTGATTTGGGAGATGAGGG - Intergenic
978437333 4:108699556-108699578 TTGGCTGGTGTGGCCTAAGAAGG - Intergenic
980861058 4:138500056-138500078 GTGGCTGCTGTGGAGGATGAAGG + Intergenic
982342780 4:154320687-154320709 GTGACTAGTGTGCCAAATGAGGG + Exonic
982960322 4:161827626-161827648 GTGGCTGCTGTGGAAGATGGGGG + Intronic
987436899 5:17905901-17905923 GTGGCTGCTGTGGCATATGAGGG + Intergenic
987527620 5:19073798-19073820 GTGGCTGCTGTGGGGGATGAGGG - Intergenic
987714347 5:21547440-21547462 GTGGCTGTTGTGGTGCATGCAGG + Intergenic
988574357 5:32405726-32405748 GAGGCAGGTGTGGCACAGGTAGG - Intronic
992068218 5:73126444-73126466 GAGGCTGCTGTGGCTCATGAAGG + Intronic
995205466 5:109474968-109474990 GAAGCTGGTGTGGCTCAAGATGG + Intergenic
996343142 5:122460262-122460284 CTGGGTGGGGTGGCACATGCTGG - Intronic
999234106 5:150080182-150080204 GTAGTTGGTGTGGCGCATGAGGG + Exonic
1001177149 5:169480937-169480959 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1001279178 5:170373950-170373972 ATGGCTGGTGAGGTACAGGAAGG + Intronic
1001704760 5:173733834-173733856 ATGGCTGGTGTAGCACTTCAGGG + Intergenic
1001854636 5:175000249-175000271 GGGACTGCTGTGGTACATGATGG - Intergenic
1002301192 5:178257998-178258020 GTGGCTGTAGTGCCCCATGATGG + Intronic
1003287534 6:4747476-4747498 GTGGCAGGAGTGGGACATGAGGG - Intronic
1004792281 6:19039958-19039980 GTGTCTGGTGTGGGACATTCAGG - Intergenic
1006984286 6:38167007-38167029 CTGGCTGGTGTGGCGGAGGAGGG - Intergenic
1007159491 6:39777503-39777525 GTGGCTGTTGTGGCCCCTGTAGG + Intergenic
1007166638 6:39832955-39832977 GTGGCTGGTCTGGGATGTGAGGG + Intronic
1007210413 6:40189358-40189380 GTGGGTGGTGGGGGATATGAAGG + Intergenic
1007335475 6:41152148-41152170 GTTCCTGGTGTGGCATAGGATGG - Intronic
1007849213 6:44788086-44788108 GTGGCTGGTGTGGCACATCTCGG - Intergenic
1007864673 6:44955545-44955567 GTGGCTGTTGTGGGGGATGAGGG - Intronic
1008535268 6:52502592-52502614 GTGGCTGCTGTGCCTCAAGATGG + Exonic
1009002380 6:57734638-57734660 GTGGCTGTTGTGGCCCCTGCAGG - Intergenic
1011860482 6:91748916-91748938 GTTGCTGGTGTTGAAAATGAAGG + Intergenic
1014183311 6:118408193-118408215 GGGGGAGGTGTGGCACATGTCGG - Intergenic
1017946571 6:159100917-159100939 GTGGCTGGTGGAGCAAATGGGGG + Intergenic
1024174762 7:46827729-46827751 GTGGCTGCTGTGAGGCATGAGGG - Intergenic
1024426576 7:49232808-49232830 GTGGCGAGGGTGGCACAAGATGG - Intergenic
1026215216 7:68342505-68342527 GTGGCTTGATTGGCAGATGATGG + Intergenic
1026217005 7:68358474-68358496 GCTGCTGGGGTGGCAGATGAGGG + Intergenic
1031796898 7:126186217-126186239 GTGGCTGCTGTGGGGAATGAGGG + Intergenic
1034683200 7:152946998-152947020 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1035038675 7:155911774-155911796 GTGGCAGGTGTGGACCATGCTGG + Intergenic
1035307523 7:157942839-157942861 GTGGCTGGGGTGGCACCAGTGGG - Intronic
1035342725 7:158174505-158174527 GTGGATGGTGTGGATGATGATGG - Intronic
1035563647 8:627504-627526 TTGCCTGGTGTGGAAAATGATGG - Intronic
1037540644 8:19867178-19867200 GTGGCTGGCATGGCAGGTGATGG + Intergenic
1037588443 8:20294348-20294370 GTGGCTGGTGGGGCAGGTGTGGG - Intronic
1038633630 8:29268168-29268190 GTAGCTGGGGAGGCAGATGAAGG - Intergenic
1041330233 8:56716313-56716335 GTGGATGTTGTGGCAAATCAAGG + Intergenic
1041537488 8:58943254-58943276 GTGACTGCTGGGGCACGTGAAGG + Intronic
1043556762 8:81439267-81439289 GTGGCTGCTGTGGGGCATGGGGG + Intergenic
1051801942 9:20944662-20944684 TTGGCTGCTGTGGCTCATGAGGG - Exonic
1052894586 9:33735224-33735246 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1052894592 9:33735254-33735276 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1055024089 9:71700905-71700927 GTGGAAGAAGTGGCACATGAAGG - Intronic
1055830687 9:80375013-80375035 GTGGCAGTGGTGGCATATGATGG + Intergenic
1058623211 9:106905595-106905617 GCGGCTGCTGTGGGAGATGAGGG + Intronic
1060517861 9:124277019-124277041 GTGGCGCGTGTGGAAAATGACGG + Intronic
1062324641 9:136006146-136006168 GTGGCAGGTGAGGCAGATGAAGG + Intergenic
1062719030 9:138025235-138025257 GTGGCTGCTGTGGAGCAGGAGGG - Intronic
1062737052 9:138143362-138143384 GAGGCTGGGCTGGCACATGGAGG + Intergenic
1186939249 X:14486959-14486981 GGGGGTGGGGTGGCATATGAAGG + Intergenic
1187180130 X:16936207-16936229 GTGGTTTGTGGGGCACATAAGGG + Intergenic
1187670899 X:21664973-21664995 GTGGATGGTGGGGCACAGGGTGG + Intergenic
1189239592 X:39515353-39515375 GGGCCAGGTGTGGCACAGGAGGG - Intergenic
1189745157 X:44161382-44161404 GAGGCTGAAGGGGCACATGAGGG + Intronic
1191144879 X:57155338-57155360 GTGGCTGCTATGGCAGATGGGGG + Intergenic
1191182878 X:57581313-57581335 GTGGCTTGTTTGGCCCAGGAGGG + Intergenic
1191223255 X:58014231-58014253 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1192257063 X:69470533-69470555 GTGCCTGTTGTGGGACATGAAGG - Intergenic
1194505027 X:94723831-94723853 GTGGCTGCTGTGGGACATGAGGG + Intergenic
1196095247 X:111791719-111791741 TTGGGTGGTGTGCCATATGATGG - Intronic
1196218898 X:113088379-113088401 GTGGCTGGTGTGGGGGATGGAGG - Intergenic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1197737345 X:129861569-129861591 GGGGATGGTGAGGCAGATGATGG - Intergenic
1197872397 X:131072451-131072473 TTGACTGGTGTGGCATTTGAGGG - Intronic
1200399239 X:156009623-156009645 GAGGCTGGGCTGGCACATGGAGG + Intronic
1201306696 Y:12556637-12556659 GTGGCTGCTGTGGGAGATGGGGG - Intergenic