ID: 1179947904

View in Genome Browser
Species Human (GRCh38)
Location 21:44690998-44691020
Sequence CAGCTTCTCTAATTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179947902_1179947904 11 Left 1179947902 21:44690964-44690986 CCTAGAAGTCAAGTCTGTAAAAC 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1179947904 21:44690998-44691020 CAGCTTCTCTAATTTAAAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179947904 Original CRISPR CAGCTTCTCTAATTTAAAGT GGG Intronic
900773112 1:4561590-4561612 CTTTTTCTCTAATTTAAATTGGG + Intergenic
904653959 1:32028371-32028393 CATCTTCTATAATTTTAAGGCGG - Intronic
906722538 1:48019642-48019664 CAGCTTCTCATCTGTAAAGTGGG - Intergenic
907560551 1:55383573-55383595 CAGTTTCCCTACTTTAGAGTAGG + Intergenic
908073379 1:60488803-60488825 CAGCTTTTCTTTTTTTAAGTAGG - Intergenic
908725230 1:67168758-67168780 TCGGTTCTCTACTTTAAAGTAGG + Intronic
913499060 1:119453873-119453895 CAGTTTCTCTAATTGGAAGGTGG + Intergenic
918994127 1:191733726-191733748 CTGCTTTTCTAGTTTACAGTAGG + Intergenic
923928092 1:238658868-238658890 CAGATTCTTTAATTTGCAGTTGG + Intergenic
1063268204 10:4477302-4477324 CAGCTTTTCTTCTTTAAAGTGGG - Intergenic
1064137176 10:12761173-12761195 CAGCTGCTCTGATGTAGAGTGGG + Intronic
1067066694 10:43107880-43107902 GAGATTCTTTAATTTACAGTTGG + Intronic
1067571820 10:47377264-47377286 CAGCTTCTCAAACTGAAACTGGG - Intronic
1071720208 10:88136228-88136250 CAGTTTCTCTATTTGAAAGATGG + Intergenic
1077606910 11:3618471-3618493 CAGCTTCTCTGCTGTAAAGTGGG - Intergenic
1077621368 11:3727687-3727709 CACCATCTCTACTATAAAGTAGG + Intronic
1080206267 11:29733296-29733318 CAGCACATCTAATTTAAACTTGG - Intergenic
1080994560 11:37582914-37582936 CAGCTTACCTGATTTAAATTTGG + Intergenic
1081599168 11:44480691-44480713 CAGTTTCCCTATTGTAAAGTGGG - Intergenic
1085506168 11:77061115-77061137 AAGCTTCTGTAATTAAAACTGGG - Intergenic
1086173641 11:83864124-83864146 CAACTTCTTTAGTTTAAAGAGGG + Intronic
1087505598 11:99017003-99017025 CAGCTTCTGTAAGTAAGAGTTGG + Intergenic
1088823823 11:113477149-113477171 CAGTTTCTCCATTTTTAAGTGGG + Intergenic
1089412415 11:118257111-118257133 CAGCTCCTCTAATTTCATATGGG + Intronic
1089853094 11:121517094-121517116 CAGCTTAACTGTTTTAAAGTGGG + Intronic
1090230133 11:125096490-125096512 CATTTTTTCTACTTTAAAGTGGG + Intergenic
1093178329 12:15938895-15938917 AAGCTTATCTAATTTAAAATAGG + Intronic
1093866729 12:24236397-24236419 CAGTTTCTCAAATTTACAGGTGG - Intergenic
1100185462 12:92134254-92134276 GAGCTTCTCCAATTGAAAATGGG + Intronic
1100889575 12:99109649-99109671 CAGCTTTTCCTTTTTAAAGTGGG - Intronic
1101318400 12:103650637-103650659 TACCTTCTTTTATTTAAAGTGGG + Intronic
1101850619 12:108399250-108399272 CAGCTTCTTTATTGTCAAGTGGG - Intergenic
1107142626 13:37018605-37018627 TAGGTCCTCTAATTTAAAGAAGG - Intronic
1107413379 13:40178091-40178113 AAGCTGCTCTAGTTTTAAGTTGG + Intergenic
1107455576 13:40551582-40551604 CAGCTTCACTAATATAATTTGGG - Intergenic
1107502409 13:40993784-40993806 CGGGTTCTTTAATTTAAATTAGG + Intronic
1107783562 13:43931278-43931300 CTGCTTTTTAAATTTAAAGTGGG + Intergenic
1108202394 13:48056897-48056919 CTGCTTATCCAATTTAAAATTGG - Intronic
1108426809 13:50310528-50310550 CAGCTTCTCATTTTTAAAATGGG + Intronic
1110770854 13:79343465-79343487 TGTCTTTTCTAATTTAAAGTTGG - Intronic
1111792956 13:92881855-92881877 CAGCTTATCTTATTTAAAAACGG - Intergenic
1112744729 13:102513981-102514003 CAGCTACTCTACTTTCAAGAGGG + Intergenic
1114355799 14:21906814-21906836 CAGCTGCCCTAATTGAAAGGCGG + Intergenic
1114582023 14:23770316-23770338 CTGCTTCTGCAAATTAAAGTTGG - Intergenic
1115163563 14:30423180-30423202 CAGCTTCTCTATTTTTTAATGGG + Intergenic
1115322844 14:32103405-32103427 CATTTTCGCTAATTTAAATTTGG + Intronic
1115933024 14:38519316-38519338 TAGATTCTCTAATTAAAAGACGG + Intergenic
1116749051 14:48859024-48859046 AAGCTTTTCTATTATAAAGTTGG + Intergenic
1117505530 14:56398686-56398708 CAGATGCTCTAATTCAAAGGGGG - Intergenic
1118071795 14:62253751-62253773 CAGCTTCCCTAGTATAAAATGGG + Intergenic
1118856196 14:69625169-69625191 CAGCTTCTTTAACTGAAATTGGG + Intronic
1119756096 14:77120803-77120825 CAGCTGCTGTAATTTAAGGCAGG - Intronic
1120304603 14:82752707-82752729 CAGCATCTCTAATTTCAATCAGG - Intergenic
1120501036 14:85297616-85297638 CAGCTTCACAAATTTAAAAGTGG + Intergenic
1121071631 14:91028176-91028198 CATCTTTCATAATTTAAAGTTGG - Intronic
1121075305 14:91063100-91063122 CAGCTCCTCCAACTTAAATTAGG - Intronic
1122374304 14:101248148-101248170 CATCTTCTCTCATTTAACATAGG - Intergenic
1123793747 15:23750720-23750742 CAGCTTCTGTATCTTACAGTGGG - Intergenic
1124004619 15:25785906-25785928 CAGCTTCTTGAACTCAAAGTTGG - Intronic
1124816214 15:32996196-32996218 CAGCTTCTCACCTTTAAAGTGGG - Intronic
1130142512 15:81240285-81240307 TATAGTCTCTAATTTAAAGTAGG - Intronic
1131354168 15:91730178-91730200 CAGCTACTCTTCTTTAAACTGGG + Intergenic
1135487594 16:22879583-22879605 CAGCTAATCTCATGTAAAGTGGG - Intronic
1138290909 16:55846077-55846099 CACCTTCTCTGATAGAAAGTGGG + Intergenic
1138333807 16:56236014-56236036 CAGCTTCTCCAAGTCAAAATAGG - Intronic
1142213600 16:88820431-88820453 GAGCCTCTCTAAATTAAAGACGG - Intronic
1144996589 17:19273714-19273736 CATCTTCACTAACTGAAAGTGGG - Intronic
1145285305 17:21501349-21501371 GAGATTCTCTAATTTGCAGTTGG - Intergenic
1146449368 17:32960405-32960427 AAGCTGCTCTGATTTGAAGTGGG + Intergenic
1149031676 17:52090664-52090686 CAGCATCTTTAAGTTAATGTAGG + Intronic
1149757804 17:59202198-59202220 CAACCTCTCTAATCTAAATTGGG - Exonic
1150905098 17:69328081-69328103 CTGCTTCTCGAATTTAAACCAGG + Intergenic
1155586581 18:27373157-27373179 CAGCTTGTCTAATTTAACACTGG + Intergenic
1156497333 18:37534521-37534543 CAGTTTCTGTAAGTGAAAGTCGG - Intronic
1157996532 18:52564091-52564113 AAGCATCTTTAATTTAAAGCAGG - Intronic
1159085455 18:63784486-63784508 AAGCTTCAGTATTTTAAAGTGGG + Intronic
1159987159 18:74856982-74857004 CAGTTTTTCTAATTCAAAGAAGG + Intronic
1167982043 19:53283380-53283402 CAGGTTCTTTATTTGAAAGTTGG + Intergenic
926540312 2:14169606-14169628 CAGTTTCTCTATATCAAAGTTGG + Intergenic
929403109 2:41608763-41608785 CTGCTTCTATAATTTAACATTGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930688194 2:54331112-54331134 TTGCTTCTCTAATTTCCAGTTGG + Intronic
932670472 2:73733575-73733597 CAGCTTCTCATCTTTAAAATGGG - Intronic
936648813 2:114402958-114402980 CAGCTTCTCTAGGTATAAGTGGG + Intergenic
936848273 2:116864497-116864519 CAGATTCTCTAAATCAAATTGGG + Intergenic
937535042 2:122875801-122875823 AAGCTTCTGTAATTTAAAGAAGG - Intergenic
938082011 2:128375081-128375103 CAGCTTATCCATTTTAAAGCTGG + Intergenic
939908975 2:147956145-147956167 TATCTCCTCAAATTTAAAGTTGG - Intronic
940152803 2:150621440-150621462 CAGCTTCTCATCCTTAAAGTGGG + Intergenic
940505418 2:154547145-154547167 CAATTTCTCTAATTTGGAGTGGG + Intergenic
943575778 2:189629525-189629547 TAGCTTCTTTATTTTAAACTAGG - Intergenic
943994324 2:194739585-194739607 CAGTTTCTCACATTTAAAGTGGG + Intergenic
944130875 2:196346427-196346449 CAGCATCTCTTATTCTAAGTGGG + Intronic
944384549 2:199150149-199150171 CATCTTCTTTGATGTAAAGTGGG - Intergenic
944583358 2:201152367-201152389 CAGTTTCTCTTCTGTAAAGTGGG + Intronic
944600820 2:201301123-201301145 AAGCTTCTCCAAGTTAAAGGAGG + Intronic
945798406 2:214392994-214393016 CAGCTAAAATAATTTAAAGTAGG + Intronic
946423067 2:219575723-219575745 CAGCTTCTCTGATATGGAGTTGG + Intergenic
946919657 2:224565628-224565650 CAGATTCTCTAATGTCAACTTGG + Intronic
948004596 2:234596915-234596937 CAGCTTATGAAATTCAAAGTAGG + Intergenic
1169660419 20:7972819-7972841 CAACTTCTCTAATGTATACTGGG - Intergenic
1170475671 20:16711992-16712014 CAGCCTCCTTAATTTAAAGCAGG + Intergenic
1173339603 20:42141501-42141523 AAGCTCCTCTAATTCAAAGGAGG - Intronic
1174654141 20:52156111-52156133 CAGCTTCTCTAACTTAGGCTGGG + Intronic
1179947904 21:44690998-44691020 CAGCTTCTCTAATTTAAAGTGGG + Intronic
1182915548 22:34026119-34026141 AAGTTTCTCTAATTTACTGTTGG + Intergenic
1184064251 22:42107520-42107542 AAGCTTCTATAATTTGGAGTAGG + Intergenic
950340606 3:12240754-12240776 CAGCTTCTGTAGCTTCAAGTTGG - Intergenic
951863048 3:27275230-27275252 CAGATTCTATATTTTTAAGTTGG - Intronic
953202252 3:40787876-40787898 CAACTTCTCCCATTTAAAATGGG + Intergenic
953224678 3:41007560-41007582 CAAATTCTCTAATTAAAAGATGG - Intergenic
954592312 3:51793149-51793171 CAGCTTCTTTAATAAATAGTGGG - Intergenic
956078311 3:65530161-65530183 CACCTTCTCTATTTTAACCTTGG - Intronic
956357947 3:68414545-68414567 CAGCTTCTCATGTGTAAAGTGGG + Intronic
956517333 3:70063491-70063513 CAGCTTCTCTTCTTTTAGGTAGG + Intergenic
956700453 3:71954441-71954463 CATCTTCTCTAGTTCAAAATGGG + Intergenic
957266813 3:77977499-77977521 CAGCTTCTCCAAAATAAAATGGG + Intergenic
958669319 3:97181983-97182005 CATCTTCTTTAATTTAAACTTGG + Intronic
958683556 3:97362582-97362604 CAGGTTGTTTAATTTAATGTTGG + Intronic
959277623 3:104296731-104296753 AAGATTTTCTAATTTGAAGTTGG - Intergenic
959887115 3:111515849-111515871 CAGCTTCTCTGAATTAATTTGGG - Intronic
963970875 3:151428401-151428423 CTGCTTCTCTAATTTGTATTGGG + Intronic
964159173 3:153625876-153625898 CAGTTTGTCTACTTTGAAGTAGG - Intergenic
965443153 3:168741551-168741573 TAGCTTCACTAATTCAAAATTGG + Intergenic
966490807 3:180526825-180526847 CAGCTTCTATAATACAGAGTTGG - Intergenic
966760928 3:183418597-183418619 CAGTTTCTCTAATTTGGAATGGG - Intronic
969036724 4:4259996-4260018 CAGCTTCTGTAATTTGGGGTTGG - Intergenic
970335738 4:15039273-15039295 TAGTTCCTCTAATATAAAGTGGG - Intronic
970538593 4:17055247-17055269 CACCAACTCTAATTTAAACTAGG + Intergenic
972163658 4:36256482-36256504 CAGGCTTTCCAATTTAAAGTAGG - Intergenic
972427719 4:38950129-38950151 CAGCTTTTCTAATTCTTAGTCGG - Intergenic
974078850 4:57192721-57192743 TAGCTTCTCCATTTTAAAATGGG + Intergenic
975394598 4:73860226-73860248 CTTATTCTCTGATTTAAAGTAGG - Intergenic
975764436 4:77652329-77652351 CAGCTCCTCTGTTTTAAAGATGG + Intergenic
976789396 4:88860726-88860748 CAGCTTCCCTTGTTTATAGTAGG - Intronic
976912644 4:90326383-90326405 CAGCTACTCTAATTTAGAAACGG - Intronic
977946009 4:102914838-102914860 AAACTTCTCAAATTTAAAGAAGG + Intronic
981692756 4:147527951-147527973 CAGATTCAATAATTTAAAGGAGG - Intronic
981911501 4:149986754-149986776 CAGAATCTATATTTTAAAGTAGG + Intergenic
984089349 4:175351866-175351888 CATCTTCTATTATTTGAAGTGGG + Intergenic
985850914 5:2388467-2388489 CAGGTACTTTAATTTAAGGTTGG + Intergenic
986388597 5:7264162-7264184 CCGCTTATCTGATTTAAAATTGG - Intergenic
986502383 5:8414619-8414641 CCGCTTTCCTAATTTAAAATTGG - Intergenic
987600799 5:20067718-20067740 ATGCTTCTTTAATTTACAGTTGG - Intronic
989823985 5:45831499-45831521 CAGCTTGTCTAATTTTCATTTGG - Intergenic
992146259 5:73852454-73852476 CACTTTCTGTAATTTAAAGAGGG - Intronic
992730358 5:79660008-79660030 TAGCTTCTCTAATACAAAATAGG + Intronic
994834883 5:104837374-104837396 CAGATTCTCTGATTTGAAGCTGG + Intergenic
996723945 5:126657439-126657461 CAGCTTCTCATCTTGAAAGTGGG + Intergenic
998842297 5:146267890-146267912 CTTCTTCTCTAATGTAAACTTGG + Intronic
1000739299 5:164946427-164946449 CATTTTCTCTATCTTAAAGTGGG + Intergenic
1001376640 5:171265908-171265930 CAGCTGCTCTAAGATAAATTCGG - Intronic
1004111071 6:12719629-12719651 CTGCTTTTCTATTTTAAAATAGG - Intronic
1004734324 6:18389854-18389876 GAGCTTCTATAAATTAAGGTAGG - Intronic
1005415838 6:25599463-25599485 CAACTTGTCTCATTTAAAGCTGG - Intronic
1005581252 6:27237479-27237501 CAGCTTCTTCAATTTAAAGTCGG - Intergenic
1005648120 6:27861658-27861680 CAGCTTCTATATTTGTAAGTTGG - Intronic
1005963844 6:30712534-30712556 CAGCTTCTCTATTTTCCACTGGG + Exonic
1007026301 6:38578446-38578468 CTGCATCTCAAATTTAAATTTGG - Intronic
1007046118 6:38775965-38775987 CAGCTTTACTAAGTAAAAGTAGG - Intronic
1010085155 6:71908543-71908565 CAACTTCTCTAACTTTAAATGGG + Intronic
1012073302 6:94651296-94651318 CAGCTTCTCTGAGTTAAAACAGG - Intergenic
1012982484 6:105844723-105844745 CAGCTTCTCTTCTCCAAAGTAGG - Intergenic
1013093425 6:106921808-106921830 CAAGCACTCTAATTTAAAGTCGG - Intergenic
1015295559 6:131587892-131587914 CAACTTCTCACATTTAAAGCAGG + Intronic
1019815377 7:3196085-3196107 AAGCTCCTCTAATTTAAGGCAGG + Intergenic
1020154505 7:5711491-5711513 CAGATACTATAATGTAAAGTGGG - Intronic
1020381576 7:7553253-7553275 CCTCTTCTCAAGTTTAAAGTAGG + Intergenic
1021674575 7:23067390-23067412 CAGCTTCTGGCATGTAAAGTAGG + Intergenic
1028803640 7:94998238-94998260 CATCTGCTCTCATTTAAATTAGG + Intronic
1029460685 7:100692554-100692576 CATCTTCTCTCCTCTAAAGTGGG + Intergenic
1029853092 7:103485048-103485070 CAGAGTACCTAATTTAAAGTAGG + Intronic
1032457871 7:132087383-132087405 CAGCATCTCTAACTTCCAGTAGG - Intergenic
1033211274 7:139461975-139461997 CCGCTTATCCAATTTAAAATTGG - Intronic
1033387206 7:140889548-140889570 TAGCTTCTGTTATTTTAAGTCGG - Intronic
1034631950 7:152537998-152538020 TACCTTCTCTGGTTTAAAGTGGG + Intergenic
1035427183 7:158786775-158786797 CATCATTTGTAATTTAAAGTAGG - Intronic
1037191253 8:16128698-16128720 CTGCTTCTTTAATTTATAGGTGG + Intronic
1037329588 8:17731203-17731225 CTGCTTCTCAAATTTTAATTTGG - Intronic
1038520552 8:28228829-28228851 CAGCTGCTCTAAATTAACTTTGG - Intergenic
1038659224 8:29482381-29482403 AAGCTTCTATAGTTAAAAGTAGG + Intergenic
1039374393 8:37018809-37018831 CAGCTTTTCTCATTTAGAATGGG - Intergenic
1042572526 8:70182004-70182026 CAGCTTTTCTAATTTTAGTTGGG - Intronic
1043090630 8:75897949-75897971 TAGCTTATATAATTTAAAGCTGG + Intergenic
1044383155 8:91557833-91557855 CAGGTTGTATAGTTTAAAGTTGG - Intergenic
1044498186 8:92916282-92916304 AAGCTTATCTATTTTAAATTAGG - Intronic
1048188394 8:132265188-132265210 CAGCTTAGCTAATTTCAACTGGG + Intronic
1050243925 9:3668048-3668070 CAGGTTCTTTATTGTAAAGTTGG - Intergenic
1052774179 9:32717264-32717286 CAGCATTTCTGATTTAAAGTTGG - Intergenic
1053569526 9:39289137-39289159 CTGCTTCTCAAATTCACAGTAGG + Intergenic
1053749618 9:41238591-41238613 AAACTACTCTTATTTAAAGTAGG - Intergenic
1053835489 9:42130167-42130189 CTGCTTCTCAAATTCACAGTAGG + Intergenic
1054091153 9:60848118-60848140 CTGCTTCTCAAATTCACAGTAGG + Intergenic
1054112570 9:61123688-61123710 CTGCTTCTCAAATTCACAGTAGG + Intergenic
1054127623 9:61329875-61329897 CTGCTTCTCAAATTCACAGTAGG - Intergenic
1054255120 9:62802927-62802949 AAACTACTCTTATTTAAAGTAGG - Intergenic
1054336190 9:63812682-63812704 AAACTACTCTTATTTAAAGTAGG + Intergenic
1054595139 9:67058443-67058465 CTGCTTCTCAAATTCACAGTAGG - Intergenic
1055739027 9:79365296-79365318 CATCTTCTCTCTTTTAAAGGTGG - Intergenic
1055838576 9:80475110-80475132 GAGCTTCTCTAGTTAAAATTTGG - Intergenic
1057323674 9:94039127-94039149 TATCTTCTCTACTTTTAAGTTGG - Intronic
1058270365 9:102965576-102965598 CAGCCTCTCAAATTTCAACTGGG + Intergenic
1058362568 9:104166473-104166495 CAGCTTCTCTGCTGTAAAATTGG - Intergenic
1058401365 9:104623978-104624000 AATCTTATCTAATTTACAGTGGG + Intergenic
1059027314 9:110648963-110648985 CAGCTTCTTTAATGTAAGGCTGG + Intergenic
1059275400 9:113092305-113092327 CATCTACTCTAACCTAAAGTTGG - Intergenic
1059566434 9:115387006-115387028 CAGCTTCTTTACTTTAAAGGAGG - Intronic
1186210660 X:7246855-7246877 CATCTTCTCTCTTTTAAAATAGG - Intronic
1188234770 X:27714622-27714644 CACCTTCTGTAATGTAATGTTGG - Intronic
1188650185 X:32622784-32622806 CAGCTTCTCAAACTTAAATATGG + Intronic
1194440346 X:93925053-93925075 CAGCTTCTCTCAAATAAATTTGG - Intergenic
1194890991 X:99378450-99378472 CAGATTCTATAATTTACATTAGG + Intergenic
1198033578 X:132779561-132779583 AAGCTTCTCTAAATTAATGGAGG + Intronic